- Email: [email protected]
Telmisartan ameliorates adipoR1 and adipoR2 expression via PPAR-γ activation in the coronary artery and VSMCs
Biomedicine & Pharmacotherapy 95 (2017) 129–136
Available online at
ScienceDirect www.sciencedirect.com
Original article
Telmisartan ameliorates adipoR1 and adipoR2 expression via PPAR-g activation in the coronary artery and VSMCs Xuhua Shen* , Hongwei Li* , Weiping Li, Xing Wu, Zhijun Sun, Xiaosong Ding Department of Cardiology, Beijing Friendship Hospital, Capital Medical University, 95 Yong An Road, West district, Beijing 100050, China
A R T I C L E I N F O
Article history: Received 16 July 2017 Received in revised form 5 August 2017 Accepted 7 August 2017 Keywords: Telmisartan Diabetic PPAR-g Adiponectin receptors
A B S T R A C T
The effects of telmisartan on insulin-resistant properties and expression of adiponectin receptors (AdipoRs) were investigated. A diabetic rat model was established using a high-fat diet and streptozotocin (25 mg/kg) and primary rat coronary vascular smooth muscle cells (VSMCs) were used to elucidate the underlying mechanisms. The diabetic rats were insulin-resistant and exhibited weight gain, elevated blood pressures, and increased plasma triglyceride levels. These manifestations were ameliorated by elmisartan treatment. Four-week telmisartan therapy increased plasma adiponectin and decreased TNF-a expression in the coronary artery. Moreover, telmisartan significantly decreased AdipoR1 and AdipoR2 expression. Using high glucose-treated rat coronary VSMCs, telmisartan and PPARg agonist GW1929 prominently stimulated PPAR-g and decreased TNF-a expression. Interestingly, telmisartan or GW1929 also prevented hyperglycemia-induced downregulation of AdipoR1 and AdipoR2 expression. Additionally, GW9662 (PPAR-g antagonist) significantly decreased the effects of telmisartan on AdipoR1 and AdipoR2 expression. These results demonstrated that telmisartan effectively ameliorated coronary insulin resistance and inflammation in diabetic rats and upregulated AdipoR1/ R2 expression via activation of PPAR-g in the coronary artery and VSMCs. © 2017 Published by Elsevier Masson SAS.
1. Introduction Adiponectin (APN) is an adipose tissue-derived hormone that is capable of promoting insulin sensitivity. Adiponectin has been to regulate cell migration, proliferation, atherothrombosis and inflammation [1–3]. Interestingly, accumulating evidence suggests that adiponectin possesses protective activities in the myocardium and vasculature [4–6]. Adiponectin attenuated the progression of macrovascular disease in rodent models [7], which is consistent with clinical evidence [8]. Adiponectin functions by binding to adiponectin receptors (AdipoRs), AdipoR1 and AdipoR2 [9]. AdipoR1 is dominantly expressed in the skeletal muscle. However, AdipoR2 is abundantly expressed in the liver [4]. The action of adiponectin could be abolished by disruption of both receptors, which would elevate triglyceride levels and aggravate inflammation and oxidative stress, leading to insulin-resistance and glucose intolerance. We previously established a negative correlation between insulin
* Corresponding authors. E-mail addresses: [email protected] (X. Shen), [email protected] (H. Li). http://dx.doi.org/10.1016/j.biopha.2017.08.041 0753-3322/© 2017 Published by Elsevier Masson SAS.
resistance and AdipoRs in rat coronary arteries and vascular smooth muscle cells (VSMCs) [10]. Moreover, genetic variations in AdipoR1 and AdipoR2 correlated with coronary artery disease [4,11,12]. However, the regulation of AdipoRs in diabetic vascular disease has not been fully elucidated. AdipoR expression was variably regulated upon different stimulations. Chinetti et al. [13] demonstrated that peroxisome proliferator-activated receptor-a (PPAR-a) and PPAR-g agonists only magnified AdipoR2 expression, while liver X receptor (LXR) agonists increased the mRNA expressions of AdipoR1 and AdipoR2 in human macrophages. Telmisartan is an angiotensin type 1 receptor (AT1R) blocker, which could also activate PPAR-g[14]. Telmisartan increases plasma adiponectin levels and improves insulin resistance[15]. Although the mechanisms remained unclear, PRAP-g activation has been shown to prevent type 2 diabetes. However, it still remains to be investigated the mechanisms whereby telmisartan regulates AdipoR expression. In this study, we hypothesized that telmisartan could ameliorate coronary insulin resistance through regulating AdipoR expression. Both in vivo and in vitro experiments were carried out to evaluate the mechanism underlying the effects of
130
X. Shen et al. / Biomedicine & Pharmacotherapy 95 (2017) 129–136
telmisartan on AdipoR expression in rat coronary arteries and VSMCs. 2. Materials and methods Telmisartan and GW9662 were purchased from Sigma Co. (St. Louis, MO, USA). Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), TRIzol reagent and Sample Reducing Agent were obtained from Invitrogen Life Technologies (Shanghai, China). Anti-GAPDH antibody was obtained from ProMab Biotechnologies Inc. (ProMab, USA). AdipoR1 (AHP1824) and AdipoR2 (AHP1900) antibodies were obtained from AbD Serotec (AbD, U.K.). PPAR-g (B0557) antibody was from Assay BioTech (ABT, USA). AntiTNF-a and horseradish peroxidase conjugated secondary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). 2.1. Animals The experimental protocols of this study were approved by the Animal Care Committee of Beijing Friendship Hospital. Rats were first divided into two groups, the control group (n = 6) and the diabetic model group (n = 12). The diabetic group was further divided into the DM group and the DM+ telmisartan (TEL) group (called the TEL group). In the control group, the rats were fed with a regular diet for 4 weeks and then injected with an equivalent volume of citrate buffer (0.1 M). In the diabetic model rat group, after being fed with a high-fat diet (HFD) for 4 weeks, male Sprague–Dawley rats (200 20 g)rats received a single intraperitoneal injection of streptozotocin (25 mg/kg diluted in 0.1 M citrate buffer, pH = 4.5; Sigma, USA). The TEL group was diabetic and received telmisartan at 5 mg/kg per day by gavage for 4 weeks. Telmisartan was dissolved in two drops of Tween and diluted in 0.9% saline. On day 7 after injection, fasting blood glucose (FBG) and serum insulin (SI) were measured. The insulin sensitivity index (ISI, ISI = In (FBG SI)) was calculated. Rats with the ISI 4.88 were considered diabetic. The diabetic rats were divided into the diabetic model group (DM group) and the TEL group. Rats in the TEL group received telmisartan by gavage at a dose of 5 mg/kg/day for 4 weeks. A normal control group was also set in the experiment. All the rats were housed (three per cage) in a controlled environment at 18 2 C, 30–70% humidity, 12 h light cycle, and water ad libitum. The rats were weighed and blood samples were collected in the ninth week. In accordance with the protocol, the rats were euthanized after the experiments. The coronary arteries were dissected from the adherent fat and connective tissue on ice, and then frozen in liquid nitrogen and kept at 80 C for subsequent experiments. 2.2. Measurements of blood pressure Blood pressure (systolic, mean and diastolic) was recorded at the end of treatment using the tail cuff blood pressure recorder (Gene&I Co., Model No. BP-98A, China). Blood pressure was measured between 9 and 11 am after rats were acclimatized to the heating chamber (24–26 C) for 20 min. Three parameters were recorded for each rat and the mean was calculated. 2.3. Oral glucose tolerance test (OGTT) Oral glucose tolerance test was performed in the ninth week. All rats fasted for 12 h and blood samples were collected from the caudal vein at 0 (immediately after glucose administration, 2 g/kg),
30, 60 and 120 min after glucose administration. Blood glucose was evaluated by the enzymatic glucose oxidase method using a commercial glucometer (Acku-check, Sensor Confort, Roche, China). The area under the curve for glucose (AUCglucose) was integrated, which was calculated by the trapezoid rule. 2.4. Cell culture and treatment Coronary VSMCs were isolated from the rats (n = 6, in each group) and cultured in DMEM (Gibco, USA) supplemented with 15% fetal calf serum (Gibco, USA), 100 U/mL penicillin G, and 100 mg/mL streptomycin. DMEM had normal glucose (NG, 5.5 mmol/L D-glucose). Coronary VSMCs were incubated with TEL (10 mmol/L) + high glucose (HG, 23 mmol/L D-glucose), or TEL (10 mmol/L) + GW9662 (5 mmol/L) + HG, or GW9662 (5 mmol/ L) + HG, or GW1929(20 mmol/L) + HG, or 0.1% dimethyl sulfoxide vehicle in DMEM HG or DMEM NG for 24 h at 37 C before each assay. 2.5. Real-time (RT)-PCR Total RNA was isolated from rat coronary arteries and coronary VSMCs using TRIzol reagent (Invitrogen, China). Complementary DNA synthesis was performed using a RevertAidTM H Minus First Strand cDNA Synthesis Kit (Fermentas, China) from 1 mg of extracted total RNA. Then, RT-PCR was performed with specific primers and SYBR green dye using an Applied Biosystems 7500 Real-Time PCR System. The forward (fwd) and reverse (rev) primer sequences were as follows: AdipoR1 (fwd: 50 -CCTGGGACTTGGCTTGAGT- 30 ; rev: 50 -GGAATCCGAGCAGCATAAA 30 ), AdipoR2 (fwd: 50 - ACGAATGGAAGAGTTTGTTTG-30 ; rev: 50 -GGCGAAACATATAAAAGATCC 30 ), TNF- a (fwd: 50 - GAACAACCCTACGAGCACCT 30 ; rev: 50 -GGGTAGTTTGGCTGGGATAA-30 ), GAPDH (fwd: 50 -CCTGCCAAGTATGATGACATCAAG 30 ; rev: 50 -GTAGCCCAGGATGCCCTTTAGT 30 ). After initial denaturation at 95 C for 10 min, PCR was run for forty cycles, each consisting of 60 C for 1 min, melting curve 95 C for 15s, 60 C for 30 s, and 95 C for 15 s. The product was confirmed by melting curve analysis. The ratio of the amounts of target mRNA to those of the internal standard (GAPDH) mRNA was determined as an arbitrary unit. 2.6. Western blotting assays Western blot analyses (n = 6, in each group) were conducted as previously described (Shen et al., 2012) to assess the expression of AdipoR1, AdipoR2, TNF-a and PPAR-g. In brief, the coronary arteries and serum-starved coronary VSMCs cells were homogenized in a cold Tris–HCl buffer (150 mM NaCl, 1.0%, Triton X-100, 50 mM Tris–HCl, pH 7.5, 10% glycerol, 1 mM Na3VO4, 1 mM EDTA, and protease inhibitor cocktail) for 30 min at 4 C. Total protein was quantified using a BCA protein assay kit as required (ProMab, No. SJ- 200501, China). Equal amounts of protein (40 mg) were separated by SDS-PAGE. Then, the corresponding primary antibodies, goat AdipoR1 polyclonal antibody (1:1000 dilution; AbD Inc., U.K.), goat AdipoR2 polyclonal antibody (1:1000 dilution; AbD Inc., U.K.), rabbit PPAR-g polyclonal antibody (1:400 dilution; ABT, USA), goat TNF-a polyclonal antibody (1:500 dilution; Santa, USA), or with polyclonal anti-Mouse GAPDH (1:1000 dilution; ProMab, USA) were applied. The membranes were incubated with the diluted antibody preparations overnight at 4 C. After washing, rabbit anti-goat peroxidase conjugated antibody was added (1:2000 dilution; Sigma, Shanghai, China) and the bands were visualized by ECL. Target proteins were quantified and normalized relatively to GAPDH (1:800, SANTA, China).
X. Shen et al. / Biomedicine & Pharmacotherapy 95 (2017) 129–136
131
Table 1 Characteristics of rats in the control group (Control), the diabetic mellitus group (DM) and the telmisartan group (TEL). Parameter
Control
DM
TEL
BW (g) Plasma FBG (mmol/L) AUC from OGTT (mmol/Lmin) Plasma T-Cho (mg/dL) Plasma TG (mg/dL) Plasma insulin (pmol) Plasma APN(mg/mL) ISI SBP (mmHg) MBP (mmHg) DBP (mmHg)
476 41 5.49 0.58 981 81 51.5 3.14 46.3 3.23 140 10.2 12.60 1.26 4.49 0.18 119 7.6 93 9.4 80 11.6
514 61*a 9.78 2.65**a 1396 225*a 156 21.29**a 207.84 23.84**a 179.3 19.5*a 9.04 0.87**a 5.46 0.26**a 135 1.6*a 107 10.0*a 93 6.2*a
486 48*a *b 8.01 1.66**a *b 1186 156*a*b 148 9.17**a 168 18.81**a *b 168.9 33.2 *a 12.16 1.21*b 5.25 0.23**a *b 96 13.6**b 77.7 12.4**b 68.8 12.7**b
Values are means S.E.M. (n = 6–8). BW, body weight; FBG, fasting blood glucose, AUC, area under the curve; OGTT, oral glucose tolerance test; T-Cho, total cholesterol; TG, triglycerides. APN, adiponectin. ISI, Insulin Sensitive Index; SBP, systolic blood pressure; MBP, mean blood pressure; DBP, diastolic blood pressure; *P < 0.05; **P < 0.01. a vs. The control group, b vs. the diabetic mellitus group.
2.7. Immunohistochemistry Dissected coronary arteries were embedded in OCT compound and snap-frozen (n = 6, in each group) as described previously [10]. The immunohistochemistry procedures were performed to detect AdipoR1 and AdipoR2 expressions. Negative controls were incubated with PBS without adding primary antibody. Acquired images were standardized by ignoring background pixels using the density slice manipulation. The integrated optical intensity of AdipoR1 and AdipoR2 immuno-positive plaques were measured in a region (50 50 mm2), randomly selected from different areas. 2.8. Statistics analysis Data were expressed as mean S.D. and analyzed by one-way ANOVA, followed with post-hoc analysis of Student-NewmanKeuls test. A P-value less than 0.05 was considered to be statistically significant. Data were analyzed using SPSS 11.0 software. 3. Results 3.1. Telmisartan ameliorated the symptoms of diabetic rats Blood glucose levels were significantly higher in diabetic rats (9.78 2.65 mmol/L) than the control group (5.49 0.58 mmol/L; P < 0.01). However, TEL treatment significantly decreased blood glucose levels versus diabetic control rats (8.01 1.66 mmol/L, P < 0.05; Table 1). The body weight of diabetic rats (514 61 g) was significantly higher than that of normal control rats (476 41 g), and was significantly decreased by TEL treatment (486 48 g, vs diabetic rats P < 0.05). TEL treatment reduced the changes of FBG (Control: 5.49 0.58 mmol/L, Diabetes: 9.78 2.65 mmol/L, TEL: 8.01 1.66 mmol/L) and AUC (Control: 981 81 mmol/L min, Diabetes: 1396 225 mmol/L min, TEL: 1186 156 mmol/L min) compared with the model group Plasma triglycerides, plasma insulin and ISI also decreased after the 4 week treatment of TEL compared with the model group P < 0.05 Triglycerides: 46.3 3.23 mg/dL, 207.84 23.84 mg/dL and 168 18.81 mg/dL in Control, Diabetes and TEL groups; Insulin: 140 10.2 pmol, 179.3 19.5 pmol and 168.9 33.2 pmol in Control, Diabetes and TEL groups; ISI: 4.49 0.18, 5.46 0.26 and 5.25 0.23 in Control, Diabetes and TEL groups. As shown in Table 1, systolic, diastolic and mean arterial blood pressures were significantly elevated in the DM group compared with normal controls (SBP: 119 7.6 mmHg, 135 1.6 mmHg and
96 13.6 mmHg in Control, Diabetes and TEL groups; MBP: 93 9.4 mmHg, 107 10.0 mmHg and 77.7 12.4 mmHg in Control, Diabetes and TEL groups; DBP: 80 11.6, 93 6.2 and 68.8 12.7 mmHg in Control, Diabetes and TEL groups) (P < 0.05). TEL treatment significantly decreased systolic, mean and diastolic blood pressures in diabetic rats (P < 0.05). 3.2. Telmisartan improved plasma APN in diabetic rats The DM rats had lower plasma APN compared with the control group (9.04 0.87 mg/mL vs. 12.6 1.26 mg/mL, P = 0.013). By contrast, TEL prevented the decrease of plasma APN in diabetic rats (12.16 1.21 mg/mL vs. 9.04 0.87 mg/mL, P < 0.05, Table 1). 3.3. Telmisartan promoted AdipoR1 and AdipoR2 expression in the coronary artery As shown in Fig. 1A, both mRNA and protein expressions of AdipoR1 and AdipoR2 in the coronary arteries were decreased in diabetic rats compared with controls. The decrease of AdipoR1 and AdipoR2 in the diabetic model was prevented by TEL treatment (Fig. 1A and B). As confirmed by immunohistochemistry, treatment with TEL increased the expression of AdipoR1 and AdipoR2 protein in the coronary artery of diabetic rats (Fig. 1C). 3.4. Telmisartan decreased TNF-a expression in diabetic rats TNF-a level in diabetic rats was significantly elevated at the both mRNA and protein levels (Fig. 2). However, the increase of TNF-a was prohibited by TEL treatment. The expression of TNF-a mRNA in the TEL group was even lower than that of the control group. 3.5. Telmisartan promoted PPAR-g expression in VSMCs under high glucose The PPAR-g protein level in the HG group was significantly lower than that in the control group (Fig. 3). However, 10 mM TEL, as well as 20 mM GW1929 pretreatment for 24 h prevented high glucose-induced decrease of PPAR-g protein. 3.6. Telmisartan decreased the expression of AdipoR1 and AdipoR2 protein in VSMCs under high glucose As shown in Fig. 4A and B, AdipoR1 and AdipoR2 mRNA and protein level in coronary VSMCs were significantly decreased by
132
X. Shen et al. / Biomedicine & Pharmacotherapy 95 (2017) 129–136
Fig. 1. Telmisartan normalizes of AdipoR1 and AdipoR2 expression in rat coronary artery. (A) The mRNA expression of AdipoR1 and AdipoR2. Data represent mean S.E.M. (n = 6). (B) Protein expression of AdipoR1 and AdipoR2. (n = 6) (C) Immunohistochemical analysis of AdipoR1 and AdipoR2 protein levels in the coronary arteries (Left panels). (n=6)Scale bar: 10 mm. Right panel: Quantification data of AdipoR1 and AdipoR2 expression in the rat coronary artery. *P < 0.05 compared with the control group; **P < 0.01 compared with the control group (Control); # P < 0.05 compared with the DM group; ##P < 0.01 compared with the DM group.
treatment with HG. TEL, as well as GW1929 prevented hyperglycemia induced decrease of AdipoR1 and AdipoR2 in coronary VSMCs. Pretreatment of GW9662, however, significantly attenuated the effects of TEL on AdipoR1 and AdipoR2 expression. 3.7. Telmisartan decreased high glucose-induced increase in TNF-a levels in coronary VSMCs To assess the potential cellular mechanisms underlying the effects of TEL on inflammation, we determined whether TEL affected the activation of key components of inflammation signaling pathways by measuring TNF-a protein level. As shown in Fig. 5, HG enhanced the protein expression of TNF-a in VSMCs compared with the control group. TEL, as well as GW1929 significantly decreased hyperglycemia-induced increase of TNFa in coronary VSMCs. Moreover, GW9662 significantly decreased the effect of TEL.
4. Discussion In this study, we demonstrated that telmisartan promoted the expression of adiponectin receptors and improved parameters of insulin sensitivity in diabetic rats. The mechanisms were further confirmed by in vitro experiments which showed that the effects of telmisartan on expression of adiponectin receptors were PPARg-dependent. The abnormalities of plasma glucose tolerance and FPG were ameliorated after treatment with TEL. As reported previously, the beneficial effect of telmisartan on glucose-lowering has been proposed through increasing energy expenditure by raising some mitochondrial gene expression in brown adipose tissue [16]. TEL increased the number of smaller adipocytes, attenuated body weight gains and decreased the amount of fat tissues [17,18]. It has also been reported by many clinical trials that TEL treatment had a tendencyto decrease FPG and HbA1c [19,20]. In our study, TEL
X. Shen et al. / Biomedicine & Pharmacotherapy 95 (2017) 129–136
133
Fig. 2. Effects of telmisartan on TNF-a expression in the coronary arteries. A) RT-PCR assay of TNF-a expression in the coronary arteries. (n = 6) B) Representative expression of TNF-a protein, as determined by Western blot analysis. Densitometric analysis of TNF-a expression. Values are mean S.E.M. (n = 6, TNF-a/GAPDH). **P < 0.01 compared with the control group, *P < 0.05 compared with the control group, ## P < 0.01 compared with the DM group, #P < 0.05 compared with the DM group. with NG group, #P < 0.05 compared with HG group.
Fig. 3. Western blotting assay of the expression of PPARg protein in coronary VSMCs. (A). After pretreatment with TEL(10 mM) + high glucose (HG, 23 mmol/L D-glucose), or TEL (10 mM) + GW9662 (5 mM) + HG, or GW9662 (5 mM) + HG, or GW1929 (20 mM) + HG, or 0.1% dimethyl sulfoxide in DMEM HG, or DMEM normal glucose (NG, 5.5 mmol/L D-glucose) for 24 h, followed by measurement of PPAR-g protein in coronary VSMCs. Representative expression of PPARg protein, as determined by Western blot analysis. Levels of GAPDH were used for normalization of sample loading. Data represent the mean SE of 3 independent experiments (1 experiment performed with 6 samples). (B) Densitometric analysis of the expression of the protein for PPARg. **P < 0.01 compared.
treatment obviously attenuated the glucose level. TEL might have a beneficial effect because of its lipid metabolic state and insulin resistance. Elevated triglyceride and/or cholesterol levels could increase the risk of mortality in coronary heart disease [21]. TEL improved the atherogenic lipid profile, which is typical in type 2 diabetes, with effects on small dense low-density and high-density lipoprotein (LDL and HDL) cholesterols and triglyceride-rich lipoprotein particles [18]. Sugimoto et al. demonstrated that TEL significantly attenuated weight gain in rats fed a high-fat, highcarbohydrate diet [22]. Moreover, their group also demonstrated that TEL reduced the accumulation of visceral fat accompanied by decrease of adipocyte size. Telmisartan has also been known to activate PPAR-g [14]. Our previous study demonstrated that pioglitazone, a full agonist of PPAR-g, prevented the insulin resistance in small vessels based on the up-regulation of AdipoRs expression [10]. However, TEL didn’t work as a full PPAR-g agonist but as a selective PPAR-g modulator characterized by the reduction which caused weight gain [17]. This fact indicated that TEL may avoid the maximal side effects as a full PPAR-g agonist. The property of telmisartan determines the unique intervention. Moreover, endothelial protection, amelioration of insulin resistance and anti-oxidative stress activities of telmisartan were also documented [23,24]. Previous studies showed that TEL could increase adiponectin levels, which improved insulin sensitivity [25]. In vivo and in vitro studies indicated that adiponectin might also protect against atherosclerosis by decreasing adhesion molecule expression on endothelial cells and inhibiting foam cell formation and vascular smooth muscle cell proliferation [26,27]. Adiponectin also inhibited TNF-a-induced adhesion molecule expression on endothelial cells and might be potentially used as a target for cardiovascular disease [28]. In our study, TEL decreased insulin levels and increased plasma APN in diabetic rats, which suggested TEL improved insulin sensitivity. Additionally, TEL restored hyperglycemia-induced decrease of
134
X. Shen et al. / Biomedicine & Pharmacotherapy 95 (2017) 129–136
Fig. 4. Telmisartan prevents the decreased expression of AdipoR1 and AdipoR2 protein in. coronary VSMCs. (A) mRNA expression of AdipoR1 and AdipoR2 in coronary VSMCs. (B) Protein expression of AdipoR1 and AdipoR2 protein in coronary VSMCs. After pretreatment with TEL (10 mM) + HG, or TEL (10 mM) + GW9662 (5 mM) + HG, or GW9662 (5 mM) + HG, or GW1929 (20 mM) + HG, or 0.1% dimethyl sulfoxide in DMEM high glucose (HG, 23 mmol/L D-glucose), or DMEM normal glucose (NG, 5.5 mmol/L D-glucose) for 24 h, followed by measurement of AdipoR1 and AdipoR2 in coronary VSMCs. Levels of GAPDH were used for normalization of sample loading. Data represent the mean SE of 3 independent experiments (1 experiment performed with 6 samples). *P < 0.05 compared with the NG group; **P < 0.01 compared with the NG group; # P < 0.05 compared with the HG group; ##P < 0.01 compared with the HG group.
AdipoR1 and AdipoR2 expression in the coronary arteries and coronary VSMCs. GW9662 affected TEL effects on AdipoR1 and AdipoR2 expression. These findings raised the possibility that TEL might increase AdipoR1 and AdipoR2 expression in coronary arteries and coronary VSMCs which were PPAR-g dependent. Reductions in plasma adiponectin levels and adiponectin receptors have great impact on the development of insulin resistance, type 2 diabetes, metabolic syndrome and cardiovascular diseases [29]. AdipoR1 and AdipoR2 could be the integral membrane proteins. Scatchard plot analysis revealed that AdipoR1 was a globular adiponectin receptor, whereas AdipoR2 was a receptor for fulllength adiponectin [4]. Suppression of AdipoR1 with small interfering RNA (siRNA) reduced the increase in fatty acid oxidation by globular adiponectin. Suppression of AdipoR2 with siRNA reduced the increase in fatty-acid oxidation by full-length adiponectin [30]. A central finding in this study was that TEL ameliorated the down-regulation of AdipoR1 and AdipoR2 in the coronary artery, which were reduced notably in DM rats, and prevented hyperglycemia-induced decrease of AdipoR1 and AdipoR2 expression in coronary VSMCs. Previous studies indicated that the expression of AdipoR1 and AdipoR2 were also decreased both in diabetic adipose tissue and liver, and decreased AdipoRs can reduce adiponectin
sensitivity, which ultimately leads to diminished insulin sensitivity. Younis et al. [31] demonstrated that TEL up-regulated the AdipoRs in fat and liver, and diabetes induced tissue-specific changes in messenger RNAs expression of AdipoRs genes, which were restored by TEL treatment. There are several pathways for AdipoRs to exert their function. A pleckstrin homology domaincontaining adaptor protein and Phosphotyrosine binding domain, which interacts with the cytoplasmic domains of AdipoRs, has been shown to double adiponectin binding and its effects, including AMP-Activated Protein Kinase activation, glucose uptake, and b-oxidation [32]. And PPAR-g is also one of the key molecules downstream of the AdipoRs that can also up-regulate the expression of AdipoRs [33]. The authors and other researchers recently demonstrated that TEL had the potential to activate the insulin-sensitizing nuclear hormone receptor PPARg, which was independent of their AT1R blocking properties [34,35]. PPARg activation has been proved to stimulate the expression of adiponectin receptor in coronary VSMCs and it could also upregulate the levels of adiponectin plasma in animals as well as in humans [10,36]. In the present study, pharmacological antagonism of PPARg completely blocked TEL-induced adiponectin receptor expression in vitro. In addition, adiponectin receptor expression in the coronary artery was upregulated by telmisartan.
X. Shen et al. / Biomedicine & Pharmacotherapy 95 (2017) 129–136
135
Fig. 5. Effects of telmisartan on expression of TNF-a protein in coronary VSMCs. (A). Representative expression of TNF-a protein, as determined by Western blot analysis. (n = 6) (B) Densitometric analysis of the expression of the protein for TNF-a. (n = 6) **P < 0.01 vs. the NG group, ## P < 0.01 compared with the HG group, # P < 0.05 compared with the HG group.
These data suggested that PPARg activation was important for adiponectin receptor induction by TEL. GW1929 is used as a reference drug with PPAR-g agonistic action. TNF-a expression in coronary VSMCs was significantly suppressed in the GW1929treated group, which indicated that the drug exerted PPAR-g agonistic activity. Previous observations have confirmed that PPAR-g agonists could elevate the concentration of plasma adiponectin [37], and suppress mRNA TNF-a and interleukins expressions in tissues [38]. GW9662, significantly, but not completely diminished the suppression of TNF-a by TEL. Based on those findings, we speculated that the anti-inflammatory effect of TEL observed in this study might depend on activation of PPAR-g and blockade of AT1 receptors. Nieto-Vazquez et al. have reported that TNF-a inhibited insulin-stimulated glucose uptake by adipose tissues and skeletal muscle, which caused insulin resistance [39]. More recently, it was reported that TEL improved insulin sensitivity, enhanced adiponectin expression, and also suppressed TNF-a and IL-6 expression [40]. We showed that TEL significantly
induced PPAR-g expression and reduced TNF-a expression. Thus, it was possible that TEL had anti-atherogenic properties by suppression of TNF-a expression and increase of adiponectin, while upregulation of PPAR-g by TEL was a probable contributor to prevention of atherosclerosis. 5. Conclusion The present study demonstrated that TEL attenuated the overexpression of TNF-a and ameliorated insulin resistance. These effects of improving insulin sensitivity and anti-inflammatory activities were related to enhanced expression of AdipoR1 and AdipoR2 via the activation of PPAR-g. Declaration of interest There was no conflict of interest.
136
X. Shen et al. / Biomedicine & Pharmacotherapy 95 (2017) 129–136
Funding This work was supported by Scientific Research Foundation from Beijing Friendship Hospital (Grant No. 20150512030091) and Open Project of Beijing Key Laboratory of Tolerance Induction and Organ Protection in Transplantation(Grant No.2017YZNS04). References [1] P.E. Scherer, Adipose tissue: from lipid storage compartment to endocrine organ, Diabetes 55 (6) (2006) 1537–1545. [2] P.E. Scherer, S. Williams, M. Fogliano, G. Baldini, H.F. Lodish, A novel serum protein similar to C1q, produced exclusively in adipocytes, J. Biol. Chem. 270 (45) (1995) 26746–26749. [3] N. Katsiki, C. Mantzoros, D.P. Mikhailidis, Adiponectin, lipids and atherosclerosis, Curr. Opin. Lipidol. 28 (4) (2017) 347–354. [4] T. Yamauchi, T. Kadowaki, Adiponectin receptor as a key player in healthy longevity and obesity-related diseases, Cell Metab. 17 (2) (2013) 185–196. [5] A. Xu, P.M. Vanhoutte, Adiponectin and adipocyte fatty acid binding protein in the pathogenesis of cardiovascular disease, Am. J. Physiol. Heart Circ. Physiol. 302 (6) (2012) 1231–1240. [6] B.J. Goldstein, R.G. Scalia, X.L. Ma, Protective vascular and myocardial effects of adiponectin, Nat. Clin. Pract. Cardiovasc. Med. 6 (1) (2009) 27–35. [7] E.Z. Fisman, A. Tenenbaum, Adiponectin: a manifold therapeutic target for metabolic syndrome, diabetes, and coronary disease? Cardiovasc. Diabetol. 13 (2014) 103. [8] F. Halperin, J.A. Beckman, M.E. Patti, M.E. Trujillo, M. Garvin, M.A. Creager, P.E. Scherer, Goldfine AB.;1;:The role of total and high-molecular – weight complex of adiponectin in vascular function in offspring whose parents both had type 2 diabetes, Diabetologia 48 (10) (2005) 2147–2154. [9] T. Yamauchi, K. Hara, N. Kubota, Y. Terauchi, K. Tobe, P. Froguel, R. Nagai, T. Kadowaki, Dual roles of adiponectin/Acrp30 in vivo as an anti-diabetic and anti-atherogenic adipokine, Curr. Drug Targets Immune, Endocr. Metab. Disord. 3 (4) (2003) 243–254. [10] X. Shen, H. Li, W. Li, X. Wu, X. Ding, Pioglitazone prevents hyperglycemia induced decrease of AdipoR1 and AdipoR2 in coronary arteries and coronary VSMCs, Mol. Cell. Endocrinol. 363 (1–2) (2012) 27–35. [11] I. Halvatsiotis, P.C. Tsiotra, I. Ikonomidis, A. Kollias, P. Mitrou, E. Maratou, E. Boutati, J. Lekakis, G. Dimitriadis, T. Economopoulos, et al., Genetic variation in the adiponectin receptor 2 (ADIPOR2) gene is associated with coronary artery disease and increased ADIPOR2 expression in peripheral monocytes, Cardiovasc. Diabetol. 9 (2010) 10. [12] T. Soccio, Y.Y. Zhang, S. Bacci, M.L.W. ynarski, G. Placha, G. Raggio, R. Di Paola, A. Marucci, M.T. Johnstone, E.V. Gervino, et al., Common haplotypes at the adiponectin receptor 1 (ADIPOR1) locus are associated with increased risk of coronary artery disease in type 2 diabetes, Diabetes 55 (10) (2006) 2763–2770. [13] G. Chinetti, C. Zawadski, J.C. Fruchart, B. Staels, Expression of adiponectin receptors in human macrophages and regulation by agonists of the nuclear receptors PPARalpha, PPARgamma, and LXR, Biochem. Biophys. Res. Commun. 314 (1) (2004) 151–158. [14] V. Obermoser, M.E. Urban, M.S. Murgueitio, G. Wolber, U. Kintscher, R. Gust, New telmisartan-derived PPARgamma agonists: impact of the 3D-binding mode on the pharmacological profile, Eur. J. Med. Chem. 124 (2016) 138–152. [15] Z. Guo, R. Zhang, J. Li, G. Xu, Effect of telmisartan on the expression of adiponectin receptors and nicotinamide adenine dinucleotide phosphate oxidase in the heart and aorta in type 2 diabetic rats, Cardiovasc. Diabetol. 11 (2012) 94. [16] K. Araki, T. Masaki, I. Katsuragi, K. Tanaka, T. Kakuma, H. Yoshimatsu, Telmisartan prevents obesity and increases the expression of uncoupling protein 1 in diet-induced obese mice, Hypertension 48 (1) (2006) 51–57. [17] H. He, D. Yang, L. Ma, Z. Luo, S. Ma, X. Feng, T. Cao, Z. Yan, D. Liu, M. Tepel, et al., Telmisartan prevents weight gain and obesity through activation of peroxisome proliferator-activated receptor-delta-dependent pathways, Hypertension 55 (4) (2010) 869–879. [18] N. Suksomboon, N. Poolsup, T. Prasit, Systematic review of the effect of telmisartan on insulin sensitivity in hypertensive patients with insulin resistance or diabetes, J. Clin. Pharm. Ther. 37 (3) (2012) 319–327. [19] O. Bahadir, M. Uzunlulu, A. Oguz, M.A. Bahadir, Effects of telmisartan and losartan on insulin resistance in hypertensive patients with metabolic syndrome, Hypertension research, Off. J. Jpn. Soc. Hypertens. 30 (1) (2007) 49– 53. [20] S. Honjo, Y. Nichi, Y. Wada, Y. Hamamoto, Y. Koshiyama, Possible beneficial effect of telmisartan on glycemic control in diabetic subjects, Diabetes Care 28 (2) (2005) 498.
[21] I. Goldenberg, M. Benderly, R. Sidi, V. Boyko, A. Tenenbaum, D. Tanne, S. Behar, Relation of clinical benefit of raising high-density lipoprotein cholesterol to serum levels of low-density lipoprotein cholesterol in patients with coronary heart disease (from the Bezafibrate Infarction Prevention Trial), Am. J. Cardiol. 103 (1) (2009) 41–45. [22] K. Sugimoto, N.R. Qi, L. Kazdova, M. Pravenec, T. Ogihara, T.W. Kurtz, Telmisartan but not valsartan increases caloric expenditure and protects against weight gain and hepatic steatosis, Hypertension 47 (5) (2006) 1003– 1009. [23] S. Takai, K. Kirimura, D. Jin, M. Muramatsu, K. Yoshikawa, Y. Mino, M. Miyazaki, Significance of angiotensin II receptor blocker lipophilicities and their protective effect against vascular remodeling, Hypertens. Res. 28 (7) (2005) 593–600. [24] Y. Mori, T. Tanaka, K. Matsuura, J. Yokoyama, K. Utsunomiya, Influence of telmisartan on insulin response after glucose loading in obese patients with hypertension: ARB trial of hypertension in obese patients with hyperinsulinemia assessed by oral glucose tolerance test (ATHLETE), Adv. Ther. 28 (8) (2011) 698–706. [25] Z. Guo, X. Yan, L. Wang, J. Wu, X. Jing, J. Liu, Effect of telmisartan or insulin on the expression of adiponectin and its receptors in the testis of streptozotocinInduced diabetic rats, Hormone Metab. Res. = Hormon- und Stoffwechselforschung = Hormones et metabolisme 48 (6) (2016) 404–412. [26] C. Caselli, Role of adiponectin system in insulin resistance, Mol. Genet. Metab. 113 (3) (2014) 155–160. [27] S. Ida, K. Murata, K. Betou, C. Kobayashi, Y. Ishihara, K. Imataka, A. Uchida, K. Monguchi, R. Kaneko, R. Fujiwara, et al., Effect of trelagliptin on vascular endothelial functions and serum adiponectin level in patients with type 2 diabetes: a preliminary single-arm prospective pilot study, Cardiovasc. Diabetol. 15 (1) (2016) 153. [28] C. Caselli, A. D'Amico, M. Cabiati, T. Prescimone, S. Del Ry, D. Giannessi, Back to the heart: the protective role of adiponectin, Pharmacol. Res. 82 (2014) 9–20. [29] W.Y. Huang, C.C. Chang, D.R. Chen, C.T. Kor, T.Y. Chen, H.M. Wu, Circulating leptin and adiponectin are associated with insulin resistance in healthy postmenopausal women with hot flashes, PLoS One 12 (4) (2017) e0176430. [30] J. Wang, Y. Cheng, X. Yin, J. Wu, Y. Luo, J. Wu, J. Di, D. Liu, Y. Huang, R. Zhang, et al., Globular adiponectin inhibits leptin-stimulated esophageal adenocarcinoma cell proliferation via adiponectin receptor 2-mediated suppression of UHRF1, Mol. Cell. Biochem. 431 (1–2) (2017) 103–112. [31] F. Younis, Y. Oron, R. Limor, N. Stern, T. Rosenthal, Prophylactic treatment with telmisartan induces tissue-specific gene modulation favoring normal glucose homeostasis in Cohen-Rosenthal diabetic hypertensive rats, Metabolism 61 (2) (2012) 164–174. [32] S. Jin, C. Chang, L. Zhang, Y. Liu, X. Huang, Z. Chen, Chlorogenic acid improves late diabetes through adiponectin receptor signaling pathways in db/db mice, PLoS One 10 (4) (2015) e0120842. [33] T. Yamauchi, T. Kadowaki, Physiological and pathophysiological roles of adiponectin and adiponectin receptors in the integrated regulation of metabolic and cardiovascular diseases, Int. J. Obes. (Lond) 32 (Suppl 7) (2008) S13–S18. [34] H. Furukawa, K. Mawatari, K. Koyama, S. Yasui, R. Morizumi, T. Shimohata, N. Harada, A. Takahashi, Y. Nakaya, Telmisartan increases localization of glucose transporter 4 to the plasma membrane and increases glucose uptake via peroxisome proliferator-activated receptor gamma in 3T3-L1 adipocytes, Eur. J. Pharmacol. 660 (2-3) (2011) 485–491. [35] S.C. Benson, H.A. Pershadsingh, C.I. Ho, A. Chittiboyina, P. Desai, M. Pravenec, N. Qi, J. Wang, M.A. Avery, T.W. Kurtz, Identification of telmisartan as a unique angiotensin II receptor antagonist with selective PPARgamma-modulating activity, Hypertension 43 (5) (2004) 993–1002. [36] K. Kishida, T. Funahashi, I. Shimomura, Molecular mechanisms of diabetes and atherosclerosis: role of adiponectin, Endocr. Metab. Immune Disord. Drug Targets 12 (2) (2012) 118–131. [37] N. Maeda, M. Takahashi, T. Funahashi, S. Kihara, H. Nishizawa, K. Kishida, H. Nagaretani, M. Matsuda, R. Komuro, N. Ouchi, et al., PPARgamma ligands increase expression and plasma concentrations of adiponectin, an adiposederived protein, Diabetes 50 (9) (2001) 2094–2099. [38] C. Jiang, A.T. Ting, B. Seed, PPAR-gamma agonists inhibit production of monocyte inflammatory cytokines, Nature 391 (6662) (1998) 82–86. [39] I. Nieto-Vazquez, S. Fernandez-Veledo, D.K. Kramer, R. Vila-Bedmar, L. GarciaGuerra, M. Lorenzo, Insulin resistance associated to obesity: the link TNFalpha, Arch. Physiol. Biochem. 114 (3) (2008) 183–194. [40] K. Ushijima, M. Takuma, H. Ando, E. Ishikawa-Kobayashi, M. Nozawa, T. Maekawa, T. Shiga, A. Fujimura, Effects of telmisartan and valsartan on insulin sensitivity in obese diabetic mice, Eur. J. Pharmacol. 698 (1–3) (2013) 505–510.
Available online at
ScienceDirect www.sciencedirect.com
Original article
Telmisartan ameliorates adipoR1 and adipoR2 expression via PPAR-g activation in the coronary artery and VSMCs Xuhua Shen* , Hongwei Li* , Weiping Li, Xing Wu, Zhijun Sun, Xiaosong Ding Department of Cardiology, Beijing Friendship Hospital, Capital Medical University, 95 Yong An Road, West district, Beijing 100050, China
A R T I C L E I N F O
Article history: Received 16 July 2017 Received in revised form 5 August 2017 Accepted 7 August 2017 Keywords: Telmisartan Diabetic PPAR-g Adiponectin receptors
A B S T R A C T
The effects of telmisartan on insulin-resistant properties and expression of adiponectin receptors (AdipoRs) were investigated. A diabetic rat model was established using a high-fat diet and streptozotocin (25 mg/kg) and primary rat coronary vascular smooth muscle cells (VSMCs) were used to elucidate the underlying mechanisms. The diabetic rats were insulin-resistant and exhibited weight gain, elevated blood pressures, and increased plasma triglyceride levels. These manifestations were ameliorated by elmisartan treatment. Four-week telmisartan therapy increased plasma adiponectin and decreased TNF-a expression in the coronary artery. Moreover, telmisartan significantly decreased AdipoR1 and AdipoR2 expression. Using high glucose-treated rat coronary VSMCs, telmisartan and PPARg agonist GW1929 prominently stimulated PPAR-g and decreased TNF-a expression. Interestingly, telmisartan or GW1929 also prevented hyperglycemia-induced downregulation of AdipoR1 and AdipoR2 expression. Additionally, GW9662 (PPAR-g antagonist) significantly decreased the effects of telmisartan on AdipoR1 and AdipoR2 expression. These results demonstrated that telmisartan effectively ameliorated coronary insulin resistance and inflammation in diabetic rats and upregulated AdipoR1/ R2 expression via activation of PPAR-g in the coronary artery and VSMCs. © 2017 Published by Elsevier Masson SAS.
1. Introduction Adiponectin (APN) is an adipose tissue-derived hormone that is capable of promoting insulin sensitivity. Adiponectin has been to regulate cell migration, proliferation, atherothrombosis and inflammation [1–3]. Interestingly, accumulating evidence suggests that adiponectin possesses protective activities in the myocardium and vasculature [4–6]. Adiponectin attenuated the progression of macrovascular disease in rodent models [7], which is consistent with clinical evidence [8]. Adiponectin functions by binding to adiponectin receptors (AdipoRs), AdipoR1 and AdipoR2 [9]. AdipoR1 is dominantly expressed in the skeletal muscle. However, AdipoR2 is abundantly expressed in the liver [4]. The action of adiponectin could be abolished by disruption of both receptors, which would elevate triglyceride levels and aggravate inflammation and oxidative stress, leading to insulin-resistance and glucose intolerance. We previously established a negative correlation between insulin
* Corresponding authors. E-mail addresses: [email protected] (X. Shen), [email protected] (H. Li). http://dx.doi.org/10.1016/j.biopha.2017.08.041 0753-3322/© 2017 Published by Elsevier Masson SAS.
resistance and AdipoRs in rat coronary arteries and vascular smooth muscle cells (VSMCs) [10]. Moreover, genetic variations in AdipoR1 and AdipoR2 correlated with coronary artery disease [4,11,12]. However, the regulation of AdipoRs in diabetic vascular disease has not been fully elucidated. AdipoR expression was variably regulated upon different stimulations. Chinetti et al. [13] demonstrated that peroxisome proliferator-activated receptor-a (PPAR-a) and PPAR-g agonists only magnified AdipoR2 expression, while liver X receptor (LXR) agonists increased the mRNA expressions of AdipoR1 and AdipoR2 in human macrophages. Telmisartan is an angiotensin type 1 receptor (AT1R) blocker, which could also activate PPAR-g[14]. Telmisartan increases plasma adiponectin levels and improves insulin resistance[15]. Although the mechanisms remained unclear, PRAP-g activation has been shown to prevent type 2 diabetes. However, it still remains to be investigated the mechanisms whereby telmisartan regulates AdipoR expression. In this study, we hypothesized that telmisartan could ameliorate coronary insulin resistance through regulating AdipoR expression. Both in vivo and in vitro experiments were carried out to evaluate the mechanism underlying the effects of
130
X. Shen et al. / Biomedicine & Pharmacotherapy 95 (2017) 129–136
telmisartan on AdipoR expression in rat coronary arteries and VSMCs. 2. Materials and methods Telmisartan and GW9662 were purchased from Sigma Co. (St. Louis, MO, USA). Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), TRIzol reagent and Sample Reducing Agent were obtained from Invitrogen Life Technologies (Shanghai, China). Anti-GAPDH antibody was obtained from ProMab Biotechnologies Inc. (ProMab, USA). AdipoR1 (AHP1824) and AdipoR2 (AHP1900) antibodies were obtained from AbD Serotec (AbD, U.K.). PPAR-g (B0557) antibody was from Assay BioTech (ABT, USA). AntiTNF-a and horseradish peroxidase conjugated secondary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). 2.1. Animals The experimental protocols of this study were approved by the Animal Care Committee of Beijing Friendship Hospital. Rats were first divided into two groups, the control group (n = 6) and the diabetic model group (n = 12). The diabetic group was further divided into the DM group and the DM+ telmisartan (TEL) group (called the TEL group). In the control group, the rats were fed with a regular diet for 4 weeks and then injected with an equivalent volume of citrate buffer (0.1 M). In the diabetic model rat group, after being fed with a high-fat diet (HFD) for 4 weeks, male Sprague–Dawley rats (200 20 g)rats received a single intraperitoneal injection of streptozotocin (25 mg/kg diluted in 0.1 M citrate buffer, pH = 4.5; Sigma, USA). The TEL group was diabetic and received telmisartan at 5 mg/kg per day by gavage for 4 weeks. Telmisartan was dissolved in two drops of Tween and diluted in 0.9% saline. On day 7 after injection, fasting blood glucose (FBG) and serum insulin (SI) were measured. The insulin sensitivity index (ISI, ISI = In (FBG SI)) was calculated. Rats with the ISI 4.88 were considered diabetic. The diabetic rats were divided into the diabetic model group (DM group) and the TEL group. Rats in the TEL group received telmisartan by gavage at a dose of 5 mg/kg/day for 4 weeks. A normal control group was also set in the experiment. All the rats were housed (three per cage) in a controlled environment at 18 2 C, 30–70% humidity, 12 h light cycle, and water ad libitum. The rats were weighed and blood samples were collected in the ninth week. In accordance with the protocol, the rats were euthanized after the experiments. The coronary arteries were dissected from the adherent fat and connective tissue on ice, and then frozen in liquid nitrogen and kept at 80 C for subsequent experiments. 2.2. Measurements of blood pressure Blood pressure (systolic, mean and diastolic) was recorded at the end of treatment using the tail cuff blood pressure recorder (Gene&I Co., Model No. BP-98A, China). Blood pressure was measured between 9 and 11 am after rats were acclimatized to the heating chamber (24–26 C) for 20 min. Three parameters were recorded for each rat and the mean was calculated. 2.3. Oral glucose tolerance test (OGTT) Oral glucose tolerance test was performed in the ninth week. All rats fasted for 12 h and blood samples were collected from the caudal vein at 0 (immediately after glucose administration, 2 g/kg),
30, 60 and 120 min after glucose administration. Blood glucose was evaluated by the enzymatic glucose oxidase method using a commercial glucometer (Acku-check, Sensor Confort, Roche, China). The area under the curve for glucose (AUCglucose) was integrated, which was calculated by the trapezoid rule. 2.4. Cell culture and treatment Coronary VSMCs were isolated from the rats (n = 6, in each group) and cultured in DMEM (Gibco, USA) supplemented with 15% fetal calf serum (Gibco, USA), 100 U/mL penicillin G, and 100 mg/mL streptomycin. DMEM had normal glucose (NG, 5.5 mmol/L D-glucose). Coronary VSMCs were incubated with TEL (10 mmol/L) + high glucose (HG, 23 mmol/L D-glucose), or TEL (10 mmol/L) + GW9662 (5 mmol/L) + HG, or GW9662 (5 mmol/ L) + HG, or GW1929(20 mmol/L) + HG, or 0.1% dimethyl sulfoxide vehicle in DMEM HG or DMEM NG for 24 h at 37 C before each assay. 2.5. Real-time (RT)-PCR Total RNA was isolated from rat coronary arteries and coronary VSMCs using TRIzol reagent (Invitrogen, China). Complementary DNA synthesis was performed using a RevertAidTM H Minus First Strand cDNA Synthesis Kit (Fermentas, China) from 1 mg of extracted total RNA. Then, RT-PCR was performed with specific primers and SYBR green dye using an Applied Biosystems 7500 Real-Time PCR System. The forward (fwd) and reverse (rev) primer sequences were as follows: AdipoR1 (fwd: 50 -CCTGGGACTTGGCTTGAGT- 30 ; rev: 50 -GGAATCCGAGCAGCATAAA 30 ), AdipoR2 (fwd: 50 - ACGAATGGAAGAGTTTGTTTG-30 ; rev: 50 -GGCGAAACATATAAAAGATCC 30 ), TNF- a (fwd: 50 - GAACAACCCTACGAGCACCT 30 ; rev: 50 -GGGTAGTTTGGCTGGGATAA-30 ), GAPDH (fwd: 50 -CCTGCCAAGTATGATGACATCAAG 30 ; rev: 50 -GTAGCCCAGGATGCCCTTTAGT 30 ). After initial denaturation at 95 C for 10 min, PCR was run for forty cycles, each consisting of 60 C for 1 min, melting curve 95 C for 15s, 60 C for 30 s, and 95 C for 15 s. The product was confirmed by melting curve analysis. The ratio of the amounts of target mRNA to those of the internal standard (GAPDH) mRNA was determined as an arbitrary unit. 2.6. Western blotting assays Western blot analyses (n = 6, in each group) were conducted as previously described (Shen et al., 2012) to assess the expression of AdipoR1, AdipoR2, TNF-a and PPAR-g. In brief, the coronary arteries and serum-starved coronary VSMCs cells were homogenized in a cold Tris–HCl buffer (150 mM NaCl, 1.0%, Triton X-100, 50 mM Tris–HCl, pH 7.5, 10% glycerol, 1 mM Na3VO4, 1 mM EDTA, and protease inhibitor cocktail) for 30 min at 4 C. Total protein was quantified using a BCA protein assay kit as required (ProMab, No. SJ- 200501, China). Equal amounts of protein (40 mg) were separated by SDS-PAGE. Then, the corresponding primary antibodies, goat AdipoR1 polyclonal antibody (1:1000 dilution; AbD Inc., U.K.), goat AdipoR2 polyclonal antibody (1:1000 dilution; AbD Inc., U.K.), rabbit PPAR-g polyclonal antibody (1:400 dilution; ABT, USA), goat TNF-a polyclonal antibody (1:500 dilution; Santa, USA), or with polyclonal anti-Mouse GAPDH (1:1000 dilution; ProMab, USA) were applied. The membranes were incubated with the diluted antibody preparations overnight at 4 C. After washing, rabbit anti-goat peroxidase conjugated antibody was added (1:2000 dilution; Sigma, Shanghai, China) and the bands were visualized by ECL. Target proteins were quantified and normalized relatively to GAPDH (1:800, SANTA, China).
X. Shen et al. / Biomedicine & Pharmacotherapy 95 (2017) 129–136
131
Table 1 Characteristics of rats in the control group (Control), the diabetic mellitus group (DM) and the telmisartan group (TEL). Parameter
Control
DM
TEL
BW (g) Plasma FBG (mmol/L) AUC from OGTT (mmol/Lmin) Plasma T-Cho (mg/dL) Plasma TG (mg/dL) Plasma insulin (pmol) Plasma APN(mg/mL) ISI SBP (mmHg) MBP (mmHg) DBP (mmHg)
476 41 5.49 0.58 981 81 51.5 3.14 46.3 3.23 140 10.2 12.60 1.26 4.49 0.18 119 7.6 93 9.4 80 11.6
514 61*a 9.78 2.65**a 1396 225*a 156 21.29**a 207.84 23.84**a 179.3 19.5*a 9.04 0.87**a 5.46 0.26**a 135 1.6*a 107 10.0*a 93 6.2*a
486 48*a *b 8.01 1.66**a *b 1186 156*a*b 148 9.17**a 168 18.81**a *b 168.9 33.2 *a 12.16 1.21*b 5.25 0.23**a *b 96 13.6**b 77.7 12.4**b 68.8 12.7**b
Values are means S.E.M. (n = 6–8). BW, body weight; FBG, fasting blood glucose, AUC, area under the curve; OGTT, oral glucose tolerance test; T-Cho, total cholesterol; TG, triglycerides. APN, adiponectin. ISI, Insulin Sensitive Index; SBP, systolic blood pressure; MBP, mean blood pressure; DBP, diastolic blood pressure; *P < 0.05; **P < 0.01. a vs. The control group, b vs. the diabetic mellitus group.
2.7. Immunohistochemistry Dissected coronary arteries were embedded in OCT compound and snap-frozen (n = 6, in each group) as described previously [10]. The immunohistochemistry procedures were performed to detect AdipoR1 and AdipoR2 expressions. Negative controls were incubated with PBS without adding primary antibody. Acquired images were standardized by ignoring background pixels using the density slice manipulation. The integrated optical intensity of AdipoR1 and AdipoR2 immuno-positive plaques were measured in a region (50 50 mm2), randomly selected from different areas. 2.8. Statistics analysis Data were expressed as mean S.D. and analyzed by one-way ANOVA, followed with post-hoc analysis of Student-NewmanKeuls test. A P-value less than 0.05 was considered to be statistically significant. Data were analyzed using SPSS 11.0 software. 3. Results 3.1. Telmisartan ameliorated the symptoms of diabetic rats Blood glucose levels were significantly higher in diabetic rats (9.78 2.65 mmol/L) than the control group (5.49 0.58 mmol/L; P < 0.01). However, TEL treatment significantly decreased blood glucose levels versus diabetic control rats (8.01 1.66 mmol/L, P < 0.05; Table 1). The body weight of diabetic rats (514 61 g) was significantly higher than that of normal control rats (476 41 g), and was significantly decreased by TEL treatment (486 48 g, vs diabetic rats P < 0.05). TEL treatment reduced the changes of FBG (Control: 5.49 0.58 mmol/L, Diabetes: 9.78 2.65 mmol/L, TEL: 8.01 1.66 mmol/L) and AUC (Control: 981 81 mmol/L min, Diabetes: 1396 225 mmol/L min, TEL: 1186 156 mmol/L min) compared with the model group Plasma triglycerides, plasma insulin and ISI also decreased after the 4 week treatment of TEL compared with the model group P < 0.05 Triglycerides: 46.3 3.23 mg/dL, 207.84 23.84 mg/dL and 168 18.81 mg/dL in Control, Diabetes and TEL groups; Insulin: 140 10.2 pmol, 179.3 19.5 pmol and 168.9 33.2 pmol in Control, Diabetes and TEL groups; ISI: 4.49 0.18, 5.46 0.26 and 5.25 0.23 in Control, Diabetes and TEL groups. As shown in Table 1, systolic, diastolic and mean arterial blood pressures were significantly elevated in the DM group compared with normal controls (SBP: 119 7.6 mmHg, 135 1.6 mmHg and
96 13.6 mmHg in Control, Diabetes and TEL groups; MBP: 93 9.4 mmHg, 107 10.0 mmHg and 77.7 12.4 mmHg in Control, Diabetes and TEL groups; DBP: 80 11.6, 93 6.2 and 68.8 12.7 mmHg in Control, Diabetes and TEL groups) (P < 0.05). TEL treatment significantly decreased systolic, mean and diastolic blood pressures in diabetic rats (P < 0.05). 3.2. Telmisartan improved plasma APN in diabetic rats The DM rats had lower plasma APN compared with the control group (9.04 0.87 mg/mL vs. 12.6 1.26 mg/mL, P = 0.013). By contrast, TEL prevented the decrease of plasma APN in diabetic rats (12.16 1.21 mg/mL vs. 9.04 0.87 mg/mL, P < 0.05, Table 1). 3.3. Telmisartan promoted AdipoR1 and AdipoR2 expression in the coronary artery As shown in Fig. 1A, both mRNA and protein expressions of AdipoR1 and AdipoR2 in the coronary arteries were decreased in diabetic rats compared with controls. The decrease of AdipoR1 and AdipoR2 in the diabetic model was prevented by TEL treatment (Fig. 1A and B). As confirmed by immunohistochemistry, treatment with TEL increased the expression of AdipoR1 and AdipoR2 protein in the coronary artery of diabetic rats (Fig. 1C). 3.4. Telmisartan decreased TNF-a expression in diabetic rats TNF-a level in diabetic rats was significantly elevated at the both mRNA and protein levels (Fig. 2). However, the increase of TNF-a was prohibited by TEL treatment. The expression of TNF-a mRNA in the TEL group was even lower than that of the control group. 3.5. Telmisartan promoted PPAR-g expression in VSMCs under high glucose The PPAR-g protein level in the HG group was significantly lower than that in the control group (Fig. 3). However, 10 mM TEL, as well as 20 mM GW1929 pretreatment for 24 h prevented high glucose-induced decrease of PPAR-g protein. 3.6. Telmisartan decreased the expression of AdipoR1 and AdipoR2 protein in VSMCs under high glucose As shown in Fig. 4A and B, AdipoR1 and AdipoR2 mRNA and protein level in coronary VSMCs were significantly decreased by
132
X. Shen et al. / Biomedicine & Pharmacotherapy 95 (2017) 129–136
Fig. 1. Telmisartan normalizes of AdipoR1 and AdipoR2 expression in rat coronary artery. (A) The mRNA expression of AdipoR1 and AdipoR2. Data represent mean S.E.M. (n = 6). (B) Protein expression of AdipoR1 and AdipoR2. (n = 6) (C) Immunohistochemical analysis of AdipoR1 and AdipoR2 protein levels in the coronary arteries (Left panels). (n=6)Scale bar: 10 mm. Right panel: Quantification data of AdipoR1 and AdipoR2 expression in the rat coronary artery. *P < 0.05 compared with the control group; **P < 0.01 compared with the control group (Control); # P < 0.05 compared with the DM group; ##P < 0.01 compared with the DM group.
treatment with HG. TEL, as well as GW1929 prevented hyperglycemia induced decrease of AdipoR1 and AdipoR2 in coronary VSMCs. Pretreatment of GW9662, however, significantly attenuated the effects of TEL on AdipoR1 and AdipoR2 expression. 3.7. Telmisartan decreased high glucose-induced increase in TNF-a levels in coronary VSMCs To assess the potential cellular mechanisms underlying the effects of TEL on inflammation, we determined whether TEL affected the activation of key components of inflammation signaling pathways by measuring TNF-a protein level. As shown in Fig. 5, HG enhanced the protein expression of TNF-a in VSMCs compared with the control group. TEL, as well as GW1929 significantly decreased hyperglycemia-induced increase of TNFa in coronary VSMCs. Moreover, GW9662 significantly decreased the effect of TEL.
4. Discussion In this study, we demonstrated that telmisartan promoted the expression of adiponectin receptors and improved parameters of insulin sensitivity in diabetic rats. The mechanisms were further confirmed by in vitro experiments which showed that the effects of telmisartan on expression of adiponectin receptors were PPARg-dependent. The abnormalities of plasma glucose tolerance and FPG were ameliorated after treatment with TEL. As reported previously, the beneficial effect of telmisartan on glucose-lowering has been proposed through increasing energy expenditure by raising some mitochondrial gene expression in brown adipose tissue [16]. TEL increased the number of smaller adipocytes, attenuated body weight gains and decreased the amount of fat tissues [17,18]. It has also been reported by many clinical trials that TEL treatment had a tendencyto decrease FPG and HbA1c [19,20]. In our study, TEL
X. Shen et al. / Biomedicine & Pharmacotherapy 95 (2017) 129–136
133
Fig. 2. Effects of telmisartan on TNF-a expression in the coronary arteries. A) RT-PCR assay of TNF-a expression in the coronary arteries. (n = 6) B) Representative expression of TNF-a protein, as determined by Western blot analysis. Densitometric analysis of TNF-a expression. Values are mean S.E.M. (n = 6, TNF-a/GAPDH). **P < 0.01 compared with the control group, *P < 0.05 compared with the control group, ## P < 0.01 compared with the DM group, #P < 0.05 compared with the DM group. with NG group, #P < 0.05 compared with HG group.
Fig. 3. Western blotting assay of the expression of PPARg protein in coronary VSMCs. (A). After pretreatment with TEL(10 mM) + high glucose (HG, 23 mmol/L D-glucose), or TEL (10 mM) + GW9662 (5 mM) + HG, or GW9662 (5 mM) + HG, or GW1929 (20 mM) + HG, or 0.1% dimethyl sulfoxide in DMEM HG, or DMEM normal glucose (NG, 5.5 mmol/L D-glucose) for 24 h, followed by measurement of PPAR-g protein in coronary VSMCs. Representative expression of PPARg protein, as determined by Western blot analysis. Levels of GAPDH were used for normalization of sample loading. Data represent the mean SE of 3 independent experiments (1 experiment performed with 6 samples). (B) Densitometric analysis of the expression of the protein for PPARg. **P < 0.01 compared.
treatment obviously attenuated the glucose level. TEL might have a beneficial effect because of its lipid metabolic state and insulin resistance. Elevated triglyceride and/or cholesterol levels could increase the risk of mortality in coronary heart disease [21]. TEL improved the atherogenic lipid profile, which is typical in type 2 diabetes, with effects on small dense low-density and high-density lipoprotein (LDL and HDL) cholesterols and triglyceride-rich lipoprotein particles [18]. Sugimoto et al. demonstrated that TEL significantly attenuated weight gain in rats fed a high-fat, highcarbohydrate diet [22]. Moreover, their group also demonstrated that TEL reduced the accumulation of visceral fat accompanied by decrease of adipocyte size. Telmisartan has also been known to activate PPAR-g [14]. Our previous study demonstrated that pioglitazone, a full agonist of PPAR-g, prevented the insulin resistance in small vessels based on the up-regulation of AdipoRs expression [10]. However, TEL didn’t work as a full PPAR-g agonist but as a selective PPAR-g modulator characterized by the reduction which caused weight gain [17]. This fact indicated that TEL may avoid the maximal side effects as a full PPAR-g agonist. The property of telmisartan determines the unique intervention. Moreover, endothelial protection, amelioration of insulin resistance and anti-oxidative stress activities of telmisartan were also documented [23,24]. Previous studies showed that TEL could increase adiponectin levels, which improved insulin sensitivity [25]. In vivo and in vitro studies indicated that adiponectin might also protect against atherosclerosis by decreasing adhesion molecule expression on endothelial cells and inhibiting foam cell formation and vascular smooth muscle cell proliferation [26,27]. Adiponectin also inhibited TNF-a-induced adhesion molecule expression on endothelial cells and might be potentially used as a target for cardiovascular disease [28]. In our study, TEL decreased insulin levels and increased plasma APN in diabetic rats, which suggested TEL improved insulin sensitivity. Additionally, TEL restored hyperglycemia-induced decrease of
134
X. Shen et al. / Biomedicine & Pharmacotherapy 95 (2017) 129–136
Fig. 4. Telmisartan prevents the decreased expression of AdipoR1 and AdipoR2 protein in. coronary VSMCs. (A) mRNA expression of AdipoR1 and AdipoR2 in coronary VSMCs. (B) Protein expression of AdipoR1 and AdipoR2 protein in coronary VSMCs. After pretreatment with TEL (10 mM) + HG, or TEL (10 mM) + GW9662 (5 mM) + HG, or GW9662 (5 mM) + HG, or GW1929 (20 mM) + HG, or 0.1% dimethyl sulfoxide in DMEM high glucose (HG, 23 mmol/L D-glucose), or DMEM normal glucose (NG, 5.5 mmol/L D-glucose) for 24 h, followed by measurement of AdipoR1 and AdipoR2 in coronary VSMCs. Levels of GAPDH were used for normalization of sample loading. Data represent the mean SE of 3 independent experiments (1 experiment performed with 6 samples). *P < 0.05 compared with the NG group; **P < 0.01 compared with the NG group; # P < 0.05 compared with the HG group; ##P < 0.01 compared with the HG group.
AdipoR1 and AdipoR2 expression in the coronary arteries and coronary VSMCs. GW9662 affected TEL effects on AdipoR1 and AdipoR2 expression. These findings raised the possibility that TEL might increase AdipoR1 and AdipoR2 expression in coronary arteries and coronary VSMCs which were PPAR-g dependent. Reductions in plasma adiponectin levels and adiponectin receptors have great impact on the development of insulin resistance, type 2 diabetes, metabolic syndrome and cardiovascular diseases [29]. AdipoR1 and AdipoR2 could be the integral membrane proteins. Scatchard plot analysis revealed that AdipoR1 was a globular adiponectin receptor, whereas AdipoR2 was a receptor for fulllength adiponectin [4]. Suppression of AdipoR1 with small interfering RNA (siRNA) reduced the increase in fatty acid oxidation by globular adiponectin. Suppression of AdipoR2 with siRNA reduced the increase in fatty-acid oxidation by full-length adiponectin [30]. A central finding in this study was that TEL ameliorated the down-regulation of AdipoR1 and AdipoR2 in the coronary artery, which were reduced notably in DM rats, and prevented hyperglycemia-induced decrease of AdipoR1 and AdipoR2 expression in coronary VSMCs. Previous studies indicated that the expression of AdipoR1 and AdipoR2 were also decreased both in diabetic adipose tissue and liver, and decreased AdipoRs can reduce adiponectin
sensitivity, which ultimately leads to diminished insulin sensitivity. Younis et al. [31] demonstrated that TEL up-regulated the AdipoRs in fat and liver, and diabetes induced tissue-specific changes in messenger RNAs expression of AdipoRs genes, which were restored by TEL treatment. There are several pathways for AdipoRs to exert their function. A pleckstrin homology domaincontaining adaptor protein and Phosphotyrosine binding domain, which interacts with the cytoplasmic domains of AdipoRs, has been shown to double adiponectin binding and its effects, including AMP-Activated Protein Kinase activation, glucose uptake, and b-oxidation [32]. And PPAR-g is also one of the key molecules downstream of the AdipoRs that can also up-regulate the expression of AdipoRs [33]. The authors and other researchers recently demonstrated that TEL had the potential to activate the insulin-sensitizing nuclear hormone receptor PPARg, which was independent of their AT1R blocking properties [34,35]. PPARg activation has been proved to stimulate the expression of adiponectin receptor in coronary VSMCs and it could also upregulate the levels of adiponectin plasma in animals as well as in humans [10,36]. In the present study, pharmacological antagonism of PPARg completely blocked TEL-induced adiponectin receptor expression in vitro. In addition, adiponectin receptor expression in the coronary artery was upregulated by telmisartan.
X. Shen et al. / Biomedicine & Pharmacotherapy 95 (2017) 129–136
135
Fig. 5. Effects of telmisartan on expression of TNF-a protein in coronary VSMCs. (A). Representative expression of TNF-a protein, as determined by Western blot analysis. (n = 6) (B) Densitometric analysis of the expression of the protein for TNF-a. (n = 6) **P < 0.01 vs. the NG group, ## P < 0.01 compared with the HG group, # P < 0.05 compared with the HG group.
These data suggested that PPARg activation was important for adiponectin receptor induction by TEL. GW1929 is used as a reference drug with PPAR-g agonistic action. TNF-a expression in coronary VSMCs was significantly suppressed in the GW1929treated group, which indicated that the drug exerted PPAR-g agonistic activity. Previous observations have confirmed that PPAR-g agonists could elevate the concentration of plasma adiponectin [37], and suppress mRNA TNF-a and interleukins expressions in tissues [38]. GW9662, significantly, but not completely diminished the suppression of TNF-a by TEL. Based on those findings, we speculated that the anti-inflammatory effect of TEL observed in this study might depend on activation of PPAR-g and blockade of AT1 receptors. Nieto-Vazquez et al. have reported that TNF-a inhibited insulin-stimulated glucose uptake by adipose tissues and skeletal muscle, which caused insulin resistance [39]. More recently, it was reported that TEL improved insulin sensitivity, enhanced adiponectin expression, and also suppressed TNF-a and IL-6 expression [40]. We showed that TEL significantly
induced PPAR-g expression and reduced TNF-a expression. Thus, it was possible that TEL had anti-atherogenic properties by suppression of TNF-a expression and increase of adiponectin, while upregulation of PPAR-g by TEL was a probable contributor to prevention of atherosclerosis. 5. Conclusion The present study demonstrated that TEL attenuated the overexpression of TNF-a and ameliorated insulin resistance. These effects of improving insulin sensitivity and anti-inflammatory activities were related to enhanced expression of AdipoR1 and AdipoR2 via the activation of PPAR-g. Declaration of interest There was no conflict of interest.
136
X. Shen et al. / Biomedicine & Pharmacotherapy 95 (2017) 129–136
Funding This work was supported by Scientific Research Foundation from Beijing Friendship Hospital (Grant No. 20150512030091) and Open Project of Beijing Key Laboratory of Tolerance Induction and Organ Protection in Transplantation(Grant No.2017YZNS04). References [1] P.E. Scherer, Adipose tissue: from lipid storage compartment to endocrine organ, Diabetes 55 (6) (2006) 1537–1545. [2] P.E. Scherer, S. Williams, M. Fogliano, G. Baldini, H.F. Lodish, A novel serum protein similar to C1q, produced exclusively in adipocytes, J. Biol. Chem. 270 (45) (1995) 26746–26749. [3] N. Katsiki, C. Mantzoros, D.P. Mikhailidis, Adiponectin, lipids and atherosclerosis, Curr. Opin. Lipidol. 28 (4) (2017) 347–354. [4] T. Yamauchi, T. Kadowaki, Adiponectin receptor as a key player in healthy longevity and obesity-related diseases, Cell Metab. 17 (2) (2013) 185–196. [5] A. Xu, P.M. Vanhoutte, Adiponectin and adipocyte fatty acid binding protein in the pathogenesis of cardiovascular disease, Am. J. Physiol. Heart Circ. Physiol. 302 (6) (2012) 1231–1240. [6] B.J. Goldstein, R.G. Scalia, X.L. Ma, Protective vascular and myocardial effects of adiponectin, Nat. Clin. Pract. Cardiovasc. Med. 6 (1) (2009) 27–35. [7] E.Z. Fisman, A. Tenenbaum, Adiponectin: a manifold therapeutic target for metabolic syndrome, diabetes, and coronary disease? Cardiovasc. Diabetol. 13 (2014) 103. [8] F. Halperin, J.A. Beckman, M.E. Patti, M.E. Trujillo, M. Garvin, M.A. Creager, P.E. Scherer, Goldfine AB.;1;:The role of total and high-molecular – weight complex of adiponectin in vascular function in offspring whose parents both had type 2 diabetes, Diabetologia 48 (10) (2005) 2147–2154. [9] T. Yamauchi, K. Hara, N. Kubota, Y. Terauchi, K. Tobe, P. Froguel, R. Nagai, T. Kadowaki, Dual roles of adiponectin/Acrp30 in vivo as an anti-diabetic and anti-atherogenic adipokine, Curr. Drug Targets Immune, Endocr. Metab. Disord. 3 (4) (2003) 243–254. [10] X. Shen, H. Li, W. Li, X. Wu, X. Ding, Pioglitazone prevents hyperglycemia induced decrease of AdipoR1 and AdipoR2 in coronary arteries and coronary VSMCs, Mol. Cell. Endocrinol. 363 (1–2) (2012) 27–35. [11] I. Halvatsiotis, P.C. Tsiotra, I. Ikonomidis, A. Kollias, P. Mitrou, E. Maratou, E. Boutati, J. Lekakis, G. Dimitriadis, T. Economopoulos, et al., Genetic variation in the adiponectin receptor 2 (ADIPOR2) gene is associated with coronary artery disease and increased ADIPOR2 expression in peripheral monocytes, Cardiovasc. Diabetol. 9 (2010) 10. [12] T. Soccio, Y.Y. Zhang, S. Bacci, M.L.W. ynarski, G. Placha, G. Raggio, R. Di Paola, A. Marucci, M.T. Johnstone, E.V. Gervino, et al., Common haplotypes at the adiponectin receptor 1 (ADIPOR1) locus are associated with increased risk of coronary artery disease in type 2 diabetes, Diabetes 55 (10) (2006) 2763–2770. [13] G. Chinetti, C. Zawadski, J.C. Fruchart, B. Staels, Expression of adiponectin receptors in human macrophages and regulation by agonists of the nuclear receptors PPARalpha, PPARgamma, and LXR, Biochem. Biophys. Res. Commun. 314 (1) (2004) 151–158. [14] V. Obermoser, M.E. Urban, M.S. Murgueitio, G. Wolber, U. Kintscher, R. Gust, New telmisartan-derived PPARgamma agonists: impact of the 3D-binding mode on the pharmacological profile, Eur. J. Med. Chem. 124 (2016) 138–152. [15] Z. Guo, R. Zhang, J. Li, G. Xu, Effect of telmisartan on the expression of adiponectin receptors and nicotinamide adenine dinucleotide phosphate oxidase in the heart and aorta in type 2 diabetic rats, Cardiovasc. Diabetol. 11 (2012) 94. [16] K. Araki, T. Masaki, I. Katsuragi, K. Tanaka, T. Kakuma, H. Yoshimatsu, Telmisartan prevents obesity and increases the expression of uncoupling protein 1 in diet-induced obese mice, Hypertension 48 (1) (2006) 51–57. [17] H. He, D. Yang, L. Ma, Z. Luo, S. Ma, X. Feng, T. Cao, Z. Yan, D. Liu, M. Tepel, et al., Telmisartan prevents weight gain and obesity through activation of peroxisome proliferator-activated receptor-delta-dependent pathways, Hypertension 55 (4) (2010) 869–879. [18] N. Suksomboon, N. Poolsup, T. Prasit, Systematic review of the effect of telmisartan on insulin sensitivity in hypertensive patients with insulin resistance or diabetes, J. Clin. Pharm. Ther. 37 (3) (2012) 319–327. [19] O. Bahadir, M. Uzunlulu, A. Oguz, M.A. Bahadir, Effects of telmisartan and losartan on insulin resistance in hypertensive patients with metabolic syndrome, Hypertension research, Off. J. Jpn. Soc. Hypertens. 30 (1) (2007) 49– 53. [20] S. Honjo, Y. Nichi, Y. Wada, Y. Hamamoto, Y. Koshiyama, Possible beneficial effect of telmisartan on glycemic control in diabetic subjects, Diabetes Care 28 (2) (2005) 498.
[21] I. Goldenberg, M. Benderly, R. Sidi, V. Boyko, A. Tenenbaum, D. Tanne, S. Behar, Relation of clinical benefit of raising high-density lipoprotein cholesterol to serum levels of low-density lipoprotein cholesterol in patients with coronary heart disease (from the Bezafibrate Infarction Prevention Trial), Am. J. Cardiol. 103 (1) (2009) 41–45. [22] K. Sugimoto, N.R. Qi, L. Kazdova, M. Pravenec, T. Ogihara, T.W. Kurtz, Telmisartan but not valsartan increases caloric expenditure and protects against weight gain and hepatic steatosis, Hypertension 47 (5) (2006) 1003– 1009. [23] S. Takai, K. Kirimura, D. Jin, M. Muramatsu, K. Yoshikawa, Y. Mino, M. Miyazaki, Significance of angiotensin II receptor blocker lipophilicities and their protective effect against vascular remodeling, Hypertens. Res. 28 (7) (2005) 593–600. [24] Y. Mori, T. Tanaka, K. Matsuura, J. Yokoyama, K. Utsunomiya, Influence of telmisartan on insulin response after glucose loading in obese patients with hypertension: ARB trial of hypertension in obese patients with hyperinsulinemia assessed by oral glucose tolerance test (ATHLETE), Adv. Ther. 28 (8) (2011) 698–706. [25] Z. Guo, X. Yan, L. Wang, J. Wu, X. Jing, J. Liu, Effect of telmisartan or insulin on the expression of adiponectin and its receptors in the testis of streptozotocinInduced diabetic rats, Hormone Metab. Res. = Hormon- und Stoffwechselforschung = Hormones et metabolisme 48 (6) (2016) 404–412. [26] C. Caselli, Role of adiponectin system in insulin resistance, Mol. Genet. Metab. 113 (3) (2014) 155–160. [27] S. Ida, K. Murata, K. Betou, C. Kobayashi, Y. Ishihara, K. Imataka, A. Uchida, K. Monguchi, R. Kaneko, R. Fujiwara, et al., Effect of trelagliptin on vascular endothelial functions and serum adiponectin level in patients with type 2 diabetes: a preliminary single-arm prospective pilot study, Cardiovasc. Diabetol. 15 (1) (2016) 153. [28] C. Caselli, A. D'Amico, M. Cabiati, T. Prescimone, S. Del Ry, D. Giannessi, Back to the heart: the protective role of adiponectin, Pharmacol. Res. 82 (2014) 9–20. [29] W.Y. Huang, C.C. Chang, D.R. Chen, C.T. Kor, T.Y. Chen, H.M. Wu, Circulating leptin and adiponectin are associated with insulin resistance in healthy postmenopausal women with hot flashes, PLoS One 12 (4) (2017) e0176430. [30] J. Wang, Y. Cheng, X. Yin, J. Wu, Y. Luo, J. Wu, J. Di, D. Liu, Y. Huang, R. Zhang, et al., Globular adiponectin inhibits leptin-stimulated esophageal adenocarcinoma cell proliferation via adiponectin receptor 2-mediated suppression of UHRF1, Mol. Cell. Biochem. 431 (1–2) (2017) 103–112. [31] F. Younis, Y. Oron, R. Limor, N. Stern, T. Rosenthal, Prophylactic treatment with telmisartan induces tissue-specific gene modulation favoring normal glucose homeostasis in Cohen-Rosenthal diabetic hypertensive rats, Metabolism 61 (2) (2012) 164–174. [32] S. Jin, C. Chang, L. Zhang, Y. Liu, X. Huang, Z. Chen, Chlorogenic acid improves late diabetes through adiponectin receptor signaling pathways in db/db mice, PLoS One 10 (4) (2015) e0120842. [33] T. Yamauchi, T. Kadowaki, Physiological and pathophysiological roles of adiponectin and adiponectin receptors in the integrated regulation of metabolic and cardiovascular diseases, Int. J. Obes. (Lond) 32 (Suppl 7) (2008) S13–S18. [34] H. Furukawa, K. Mawatari, K. Koyama, S. Yasui, R. Morizumi, T. Shimohata, N. Harada, A. Takahashi, Y. Nakaya, Telmisartan increases localization of glucose transporter 4 to the plasma membrane and increases glucose uptake via peroxisome proliferator-activated receptor gamma in 3T3-L1 adipocytes, Eur. J. Pharmacol. 660 (2-3) (2011) 485–491. [35] S.C. Benson, H.A. Pershadsingh, C.I. Ho, A. Chittiboyina, P. Desai, M. Pravenec, N. Qi, J. Wang, M.A. Avery, T.W. Kurtz, Identification of telmisartan as a unique angiotensin II receptor antagonist with selective PPARgamma-modulating activity, Hypertension 43 (5) (2004) 993–1002. [36] K. Kishida, T. Funahashi, I. Shimomura, Molecular mechanisms of diabetes and atherosclerosis: role of adiponectin, Endocr. Metab. Immune Disord. Drug Targets 12 (2) (2012) 118–131. [37] N. Maeda, M. Takahashi, T. Funahashi, S. Kihara, H. Nishizawa, K. Kishida, H. Nagaretani, M. Matsuda, R. Komuro, N. Ouchi, et al., PPARgamma ligands increase expression and plasma concentrations of adiponectin, an adiposederived protein, Diabetes 50 (9) (2001) 2094–2099. [38] C. Jiang, A.T. Ting, B. Seed, PPAR-gamma agonists inhibit production of monocyte inflammatory cytokines, Nature 391 (6662) (1998) 82–86. [39] I. Nieto-Vazquez, S. Fernandez-Veledo, D.K. Kramer, R. Vila-Bedmar, L. GarciaGuerra, M. Lorenzo, Insulin resistance associated to obesity: the link TNFalpha, Arch. Physiol. Biochem. 114 (3) (2008) 183–194. [40] K. Ushijima, M. Takuma, H. Ando, E. Ishikawa-Kobayashi, M. Nozawa, T. Maekawa, T. Shiga, A. Fujimura, Effects of telmisartan and valsartan on insulin sensitivity in obese diabetic mice, Eur. J. Pharmacol. 698 (1–3) (2013) 505–510.