- Email: [email protected]
Temperature-dependent regulation of gene expression in poly (I:C)-treated Japanese flounder, Paralichthys olivaceus
Fish & Shellfish Immunology 45 (2015) 835e840
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Temperature-dependent regulation of gene expression in poly (I:C)-treated Japanese flounder, Paralichthys olivaceus Kittipong Thanasaksiri, Ikuo Hirono, Hidehiro Kondo* Laboratory of Genome Science, Graduate School of Tokyo University of Marine Science and Technology, Konan 4-5-7, Minato-ku, Tokyo 108-8477, Japan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 24 March 2015 Received in revised form 21 May 2015 Accepted 28 May 2015 Available online 4 June 2015
Gene expression profiling of poly (I:C)-treated Japanese flounder, Paralichthys olivaceus, under different temperatures was investigated using microarray analysis. The response was analyzed in spleen tissue at 3 and 24 h post injection (hpi) at 15 C and 25 C. A large number of genes in fish treated with poly (I:C) at 25 C were expressed at 3 hpi, whereas the expression profiles at 24 hpi appeared to be similar to those of the controls. Cluster analysis of the different expression profiles showed three distinct groups of upregulated genes in fish reared at 15 C. These were early (3 hpi), early-to-late (3 and 24 hpi), and late (24 hpi) up-regulated genes. These genes included type I IFN-related genes and inflammatory genes. Among the up-regulated genes, most of the type I IFN-related genes played early-to-late- and lateresponding genes at 15 C but early-responding genes at 25 C. Thus, several up-regulated genes in these groups from the microarray result were further verified by qPCR. These results indicate that the type I IFN gene expressions of P. olivaceus treated with poly (I:C) can be regulated in a temperaturedependent manner. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Temperature Poly (I:C) Japanese flounder Microarray
1. Introduction Temperature is an environmental factor that affects productivity in fish aquaculture. Several studies have addressed the relationship between temperature modulation and susceptibility of fish to pathogens [1e4]. For example, rearing Japanese flounder at 20 C reduces the mortality caused by viral hemorrhagic septicemia virus (VHSV) compared with those reared at 14 C [1]. Temperature changes have been shown to modulate immune-related gene expression [5e7]. The influence of temperature on immune-related gene expression has also been investigated in fish upon exposure to pathogens, such as viruses and formalin-killed pathogenic bacteria, or treatment with pathogen-associated molecular patterns (PAMPs), such as molecule including poly (I:C) and lipopolysaccharides (LPS) [8e14]. Poly (I:C) has been widely used for mimic viral infection when studying is associated with immune responses to virus in several fish species, including the sevenband grouper (Epinephelus septemfasciatus), large yellow croaker (Pseudosciaena crocea), and Atlantic cod (Gadus morhua) [10,15e17]. Recently, Dios et al. [15]
* Corresponding author. E-mail address: [email protected] (H. Kondo). http://dx.doi.org/10.1016/j.fsi.2015.05.036 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
demonstrated that zebrafish (Danio rerio) treated with poly (I:C) have different expression profiles of immune-related genes such as Toll-like receptor 3 (TLR3), Mx, and interferon regulatory factor 3 (IRF3) between low (15 C) and high (28 C) temperatures. Interferon stimulatory gene 15 (ISG15) expression in Atlantic cod after poly (I:C) injection was higher at 16 C than 10 C at 6 hpi [9]. Likewise, we previously reported that Mx expression in sevenband grouper injected with poly (I:C) was regulated by temperature [10]. These discoveries indicated that temperature regulates immunerelated gene expression. However, gene expression changes in response to poly (I:C) and temperature changes in teleosts have not been comprehensively analyzed. Microarray analysis is a powerful tool that has been used to extensively study global gene expression in several organisms [9,16,18e20]. A number of genes were identified after stimulation with various stimuli [9,21e25]. This approach provides valuable information for understanding and discovering gene functions, gene expression patterns, and signal transduction pathways. Consequently, in this study, we performed microarray analysis on the gene expression in Japanese flounder treated with poly (I:C) and reared at 15 C or 25 C using a Japanese flounder oligomicroarray containing more than 13,000 unique probes developed in a recent study [25]. The microarray result was further validated by qPCR. This study will provide information on immune-relevant
836
K. Thanasaksiri et al. / Fish & Shellfish Immunology 45 (2015) 835e840
genes that responded to poly (I:C) treatment and elucidate how expression of immune genes are regulated and affected by temperature. 2. Material and methods 2.1. Fish specimens and poly (I:C) treatment Japanese flounder with an average size of 8 cm in total length were acclimated and reared at 15 C or 25 C for a week prior to the start of the experiment. Poly (I:C) was dissolved in DEPC-treated water and fish were intramuscularly injected with 100 mg/100 ml poly (I:C) or 100 ml DEPC-treated water as a negative control. At 3 and 24 hpi, spleen samples were collected for microarray (n ¼ 3) and qPCR (n ¼ 4) analyses as described below. 2.2. RNA extraction and cDNA synthesis Total RNA was extracted using RNAiso Plus (Takara Bio, Japan) and purified with an RNeasy® Mini Kit (Qiagen, USA). RNA quality was evaluated using a 2200 TapeStation (Agilent, USA). Qualified RNA (750 ng in a 20 ml reaction) was reverse transcribed using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA). All procedures were performed following the manufacturer's instructions.
responded to poly (I:C) and temperature and are shown in Table 2. At 25 C, a large number of the genes (174) were up-regulated at 3 hpi and then declined at 24 hpi, whereas eight genes remained highly expressed until 24 hpi (Fig. 1 and Table 2). The gene expression profile at 24 hpi was similar to that of the controls. However, among up-regulated genes at 15 C (62 genes at 3 hpi and 139 genes at 24 hpi; Table 2), clear clustering in the expression profiles was observed, and the expression profiles clustered into three groups (Fig. 1). The first group, whose expression levels were up-regulated at 3 hpi and dramatically decreased at 24 hpi, was considered early-responding genes. Several genes in this cluster were inhibitor of NF-kB signaling (IkB)-delta, granulocyte colonystimulating factor (GCSF), mitogen-activated protein kinase kinase kinase 8 (MAP3K8), and early growth response protein 1 (EGR1) (Table 3). The second group, whose expression levels were up-regulated at 3 hpi and remained relatively constant until 24 hpi, was considered early-to-late responding genes. The genes in the group included type I IFN-related genes such as Mx, IRF3, ISG15, DExD/H, interleukin 27 (IL-27) subunit beta-like, and IRF (Table 3). The third group, whose expression levels were only up-regulated at 24 hpi, was considered late-responding genes; the genes included suppressor of cytokine signaling 1 (SOCS1)-like, signal transducer and activator of transcription 1 (STAT1), ISG56, NLRC5-like, and interferon-induced very large GTPase 1-like (Table 3). 3.2. Verification of gene expression by qPCR
2.3. Microarray analysis The cDNA microarray used in this study contained more than 13,000 unique probes [25]. Microarray analysis was carried out using three samples in each group, and each sample was selected based on RNA quality. The cDNA was synthesized from 200 ng of qualified RNA and labeled with cyanine 3-CTP using a one-color microarray-based gene expression analysis following the manufacturer's instructions (Agilent, USA). The labeled cDNA was subsequently hybridized at 65 C for 17 h. Microarrays were scanned with an Agilent G2565CA Microarray Scanner, and the images obtained from scanning were analyzed with Feature Extraction Software v9.5.3.1 (Agilent, USA). The data were normalized and analyzed using GeneSpring GX v11.5.1 Software (Agilent, USA). The average intensity of each sample was normalized to the median intensity of all groups injected with DEPC-treated water. The data were subsequently filtered based on expression, flags, error, and fold increase. Genes with a fold change of at least 4.0 were considered being differentially expressed. The microarray data were deposited in the GEO database under accession number GSE66692. 2.4. Validation of the microarray result by qPCR analysis To confirm the microarray results, mRNA expression levels of the genes of interest were subsequently analyzed by qPCR. qPCR primers were designed based on Japanese flounder EST sequences that were obtained by next-generation sequencing and spotted onto microarray chips (Table 1). qPCR was carried out (n ¼ 4) using THUNDERBIRD SYBR qPCR mix (Toyobo, Japan). The expression of all examined genes was normalized to the EF-1a expression [26]. 3. Results 3.1. Microarray analysis of genes modulated by temperature and poly (I:C) Temperature influence on gene expression was studied in poly (I:C)-injected fish reared at 15 C and 25 C. A total of 253 genes
Two representative genes of each cluster with the same expression profile were selected for validation of microarray results by qPCR. IkB-delta and GCSF of the early-responding group had expression profiles similar to the heat map in the microarray result, which showed early up-regulation at 3 hpi and a dramatic reduction in expression at 15 C (Fig. 2). Likewise, the qPCR results of IRF3 and Mx (early-to-late group), as well as SOCS1-like and STAT1 (late group) were similar to the expression profiles obtained by microarray analysis (Table 3 and Fig. 2). 4. Discussion Immune-related gene expression modulated by temperature and pathogen infection or PAMPs stimulation has recently been studied in various fish species [8,9,12,14,15]. However, few studies have investigated the gene expression profiling after poly (I:C) stimulation and temperature modulation. In the present study, we investigated the global gene expression profile of poly (I:C)-injected Japanese flounder reared at either 15 C (low) or 25 C (high). The microarray result showed clear distinctive patterns of gene expression at 15 C, in which the genes were clustered into three groups; early-, early-to-late-, or late-responding genes. However, these genes did not cluster in the same pattern at 25 C. After poly (I:C) stimulation, a large number of genes from fish reared at 25 C were up-regulated at 3 hpi and dramatically declined at 24 hpi. The number of up-regulated genes at 3 hpi in the 15 C-reared group was lower than that in fish reared at 25 C (Fig. 1 and Table 2). High levels of gene expression at 25 C were detected at 3 hpi, while at 15 C, high levels of gene expression were clearly observed at 24 hpi (Fig. 1). These results are consistent with those of previously published data on the transcriptome response of the Atlantic cod, which showed that an earlier maximum response was observed at 16 C than at 10 C, where the maximum response was detected late [9]. Similar results were also observed in rainbow trout (Oncorhynchus mykiss) injected with Yersinia ruckeri bacterin, in which high levels of expression of immune-related genes such as IL-1b and IFN-g were detected earlier at 15 C or 25 C than at 5 C [12]. Collectively, these results indicate that higher temperatures
K. Thanasaksiri et al. / Fish & Shellfish Immunology 45 (2015) 835e840
837
Table 1 List of primers used for qPCR. Primer name
Sequence of oligonucleotides and direction 50 e30
Predicted genes
Acc no.
CUST11204-F CUST11204-R CUST13955-F CUST13955-R CUST33-F CUST33-R CUST4418-F CUST4418-R CUST98-F CUST98-R CUST7348-F CUST7348-R JF EF-1a-F JF EF-1a-R
CCAGAACCAACACTCGGTTT ACCCAGAGGTGACCAAGATG CAGAGACTTGCTGACCCACA GAACGAACGAAGCTGTGTCA AGCTGGTGGAGCAGTTCCTA GCCAGATTCCTTGTCCAAAA CGGGACAACCAGAGAACATT CACCAGGCTGATGGTTTCTT AGGAACCCAGAGGGACTGAT AGCTTTCTCCCGCTCCTTAC CCATCTCTGTTCGCTCTGCT TGCACGTCTGCTTCAGTTTC CTCGGGCATAGACTCGTGGT CATGGTCGTGACCTTCGCTC
IkB-delta
XP_008299282.1
GCSF
BAE16320.1
IRF3
ACY69212.1
Mx
BAC76769.1
STAT1
ABS19629.1
SOCS1-like
XP_008282620.1
EF-1a
[1]
Table 2 The numbers of spots showing differential gene expression levels modulated by poly (I:C) and temperature. Total number of spot expressed
15 C, poly (I:C) 3 hpi
253
25 C, poly (I:C) 24 hpi
3 hpi
24 hpi
Up
Down
Up
Down
Up
Down
Up
Down
62
191
139
114
174
79
8
245
induce earlier expression of immune-relevant genes than lower temperatures. Both IkB-delta and GCSF were shown to be up-regulated at 3 hpi when the fish were reared at both 15 C and 25 C, but expression dramatically decreased by 24 hpi when injected with the viral mimic, poly (I:C) (Figs. 1 and 2 and Table 3). IkB-delta is a group of atypical inhibitors of NF-kB (IkBs) [27]. Although the function of IkB-delta has not yet been characterized in fish species, it seems to
be involved in inflammatory responses in mice as an NF-kB modulator [28]. GCSF regulates neutrophilic granulocytes by mediating proliferation and functional activation of neutrophils [29]. In mammals, GCSF expression has been shown to be activated by poly (I:C) stimulation [30,31]. Stimulation of peripheral blood leukocytes (PBLs) of black rockfish Sebastes schlegelii with poly (I:C) up-regulated GCSF expression [32]. The differences in the expression profile of the selected inflammatory response genes at 15 C
Fig. 1. Heat-map of gene expression profiles at 3 and 24 hpi. The genes that are shown were more than four-fold differentially regulated by temperature and poly (I:C) injection. Horizontal and vertical lines represent genes and samples, respectively. Red and blue indicate up- and down-regulation, respectively. The individual sample is indicated by black bar. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
838
K. Thanasaksiri et al. / Fish & Shellfish Immunology 45 (2015) 835e840
Table 3 Group of genes responding to poly (I:C). The majority of response occurred at 15 C. Group
Early
Early-to-late
Late
BLASTx hit
GCSF (Paralichthys olivaceus) IkB-delta (Stegastes partitus) MAP3K8 (Larimichthys crocea) EGR1 (S. partitus) Mx (P. olivaceus) IRF3 (P. olivaceus) ISG15 (P. olivaceus) DExD/H (P. olivaceus) IL-27 subunit beta-like (Haplochromis burtoni) IRF (P. olivaceus) SOCS1-like (S. partitus) STAT1 (P. olivaceus) ISG56 (L. crocea) NLRC5-like (L. crocea) Interferon-induced very large GTPase 1-like (Neolamprologus brichardi)
Acc no.
BAE16320.1 XP_008299282.1 XP_010741473.1 XP_008282663.1 BAC76769.1 ACY69212.1 BAI48419.1 ADI75503.1 XP_005934422.1 BAA83468.1 XP_008282620.1 ABS19629.1 ABY55167.1 XP_010747527.1 XP_006809622.1
Fold change 15 C, poly (I:C)
15 C, control
25 C, poly (I:C)
25 C, control
3 hpi
24 hpi
3 hpi
24 hpi
3 hpi
24 hpi
3 hpi
24 hpi
3.16 4.34 2.82 2.97 2.45 2.87 5.00 2.23 7.65 2.81 0.52 0.03 0.96 0.17 0.49
0.69 0.60 0.69 0.87 5.96 3.76 6.13 6.18 3.13 3.26 4.11 3.06 5.48 3.64 3.19
0.15 0.98 0.43 1.11 0.79 0.12 0.69 0.35 0.08 0.36 0.10 0.13 0.53 0.72 0.31
0.82 0.97 0.09 0.39 0.45 0.96 1.02 0.80 1.35 0.01 0.11 0.81 1.02 0.16 0.33
6.57 3.26 2.58 0.55 4.97 4.64 6.89 6.11 5.97 3.89 3.50 3.07 4.71 3.22 2.99
0.37 0.39 0.30 0.05 1.43 0.76 1.86 1.67 0.29 0.35 1.14 0.90 2.12 0.18 1.26
0.33 0.66 0.15 0.16 0.29 0.20 0.40 0.27 1.00 0.09 0.38 0.20 0.71 0.06 0.37
0.93 0.29 0.27 0.34 0.63 0.12 0.14 0.07 0.20 0.13 0.22 0.08 0.04 0.50 0.63
Number indicates fold-change expression calculated by the average of three samples within each group, and boldface indicates gene up-regulation.
and 25 C were not observed in either the microarray or qPCR results (Table 3 and Fig. 2). These results suggest that inflammatory response genes are up-regulated early when fish is treated with poly (I:C), but they are not influenced by temperature.
Fig. 2. Validation of the microarray results by qPCR (n ¼ 4). A) GCSF; B) IkB-delta; C) Mx; D) IRF3; E) STAT1; F) SOCS1-like. The results were normalized to EF-1a expression, and gene expression is indicated by log10-transformed values. White boxes indicate fold-change between poly (I:C) and control groups determined by qPCR analysis.
IRF genes are key regulators of the IFN production and ISG expression such as Mx [33,34]. In the present study, IRF3 and Mx, which had been previously identified as poly (I:C)-responsive genes, in the Japanese flounder [35,36], were up-regulated at 3 and 24 hpi at 15 C but only at 3 hpi at 25 C (Table 3 and Fig. 2). Japanese flounder IRF3 regulates the transcription of type I IFN and laboratory of genetics and physiology 2 (LGP2) after viral infection or poly (I:C) treatment [37,38]. Hu et al. [35] demonstrated that IRF3 expression in Japanese flounder reared at 18 C and treated with poly (I:C) could be detected at 1e4 days post injection (dpi) and then declined at 5e7 dpi. The function of Mx in the inhibition of viral infection has been characterized in several fish species, including Japanese flounder [39e41]. Our qPCR and microarray results showed that Japanese flounder Mx expression at 3 and 24 hpi when the fish were reared at 15 C were consistent with those of previous studies in Atlantic salmon (Salmo salar) and sevenband grouper, which showed that low temperatures prolong Mx gene expression [10,42]. Likewise, poly (I:C)-injected Japanese flounder reared at 18 C exhibited high levels of Mx expression in the head kidneys and gills at day 3 and 4, in which it dramatically declined at 4e7 dpi and 5e7 dpi, respectively [35]. Based on these observations, it can be speculated that temperature influences expression profiles of interferon-related genes. In addition, previous reports showed that high levels of Mx expression could undergo a rapid decrease thereafter [10,41,43]. Consistent with these results, we observed a dramatic decrease of Mx expression at 24 hpi when the fish were reared at 25 C. SOCSs and STATs are critical components of the JAK-STAT signaling pathway, because they are involved in the production of interferon-stimulated genes (ISGs). After cytokine stimulation, JAKs are activated and then phosphorylate cytokine receptors, which facilitates STAT phosphorylation [44,45]. In mammals, SOCS proteins are involved in a part of the negative feedback-loop of IFN signaling, whereas STATs activate gene transcription in the JAKSTAT pathway. SOCS1 and STAT1 protein functions have been characterized in mammals and recently in teleosts [46e49]. Even though both SOCS1 and STAT1 have been shown to be poly (I:C)induced genes [47,49,50], few studies have examined SOCSs expression after poly (I:C) stimulation. In Atlantic cod, STAT1 was differentially up-regulated between at 10 C and at 16 C after poly (I:C) injection [9]. The expression of Atlantic cod STAT1 was detected at 6 hpi when the fish were reared at 16 C but not at 10 C. The higher level of STAT1 transcripts was
K. Thanasaksiri et al. / Fish & Shellfish Immunology 45 (2015) 835e840
observed at 24 hpi when the fish were reared at 10 C. In this study, we found that SOCS1-like and STAT1 were up-regulated at 24 hpi when the fish were reared at 15 C, while at 3 hpi they were upregulated at 25 C (Fig. 2 and Table 3). This suggests that the SOCS1-like and STAT1 genes are up-regulated late at low temperature. Furthermore, we observed that the expression level of Mx down-regulated from 3 hpi to 24 hpi at 25 C, whereas SOCS1-like was up-regulated at 3 hpi at 25 C. Thus, it is hypothesized that SOCS1-like gene will be up-regulated after high level of Mx expression and SOCS1-like might suppress Mx gene expression, resulting to down-regulation of Mx at 24 hpi at 25 C. It is supported by the conserved inhibitory function of SOCS1 on IFN signaling, as recently it was shown that over-expression of SOCS1 could suppress Mx expression in teleosts [47,50]. The type I IFN expression of poly (I:C)-treated grass carp Ctenopharyngodon idella was detected in spleen at 6, 12, 24, 48 and 72 hpi at room temperature [51]. Poly (I:C) treatment in Atlantic salmon induced significant up-regulation of IFNa transcripts at 14 to 72 hpi and of IFNc transcripts at 14 to 96 hpi [52]. The expression of type I IFN gene in Japanese flounder, however, was not detected from the analyzed microarray result. Hence, no significant expression of type I IFN gene was observed in this study, although, it is possible that there are other type I IFN genes in Japanese flounder. Several studies have been shown that teleost fish appear to have at least two type I IFN genes and the function of the different type I IFN genes has recently been characterized [53e55]. For example, IFN1 of turbot involved in antiviral activity, while IFN2 of turbot involved mainly in the inflammation process [54]. The different responses of type I IFN genes to poly (I:C) have also been observed in Atlantic salmon. IFNa, IFNb, IFNc and not IFNd responded to poly (I:C) [55]. It is, thus, hypothesized that other type I IFN genes might exist in Japanese flounder. In conclusion, the present results demonstrate that high temperatures (25 C) induced an earlier response of immune-related genes than low temperatures (15 C) after poly (I:C) stimulation. Moreover, based on the different expression profiles of type I IFN in Japanese flounder, we suggest that the effect of temperature on type I IFN gene responses might generally occur in other fish species, as observed in the Mx expression profiles of the sevenband grouper [10]. Future studies are needed to elucidate which inducer or suppressor molecules are involved in this temperaturedependent regulation. Acknowledgments This work was supported in part by grants from JSPS Grant-inAid for Young Scientists (B), JSPS Asian Core University Program, and a Japanese Government (Monbukagakusho: MEXT) Scholarship. References [1] M. Sano, T. Ito, T. Matsuyama, C. Nakayasu, J. Kurita, Effect of water temperature shifting on mortality of Japanese flounder Paralichthys olivaceus experimentally infected with viral hemorrhagic septicemia virus, Aquaculture 286 (2009) 254e258. [2] E.C. Grant, D.P. Philipp, K.R. Inendino, T.L. Goldberg, Effects of temperature on the susceptibility of largemouth bass to largemouth bass virus, J. Aquat. Anim. Health 15 (2003) 215e220. [3] J. Castric, P. de Kinkelin, Experimental study of the susceptibility of two marine fish species, sea bass (Dicentrarchus labrax) and turbot (Scophthalmus maximus), to viral haemorrhagic septicaemia, Aquaculture 41 (1984) 203e212. [4] D. Ndong, Y.Y. Chen, Y.H. Lin, B. Vaseeharan, J.C. Chen, The immune response of tilapia Oreochromis mossambicus and its susceptibility to Streptococcus iniae under stress in low and high temperatures, Fish Shellfish Immunol. 22 (2007) 686e694. rez-Casanova, M.L. Rise, B. Dixon, L.O.B. Afonso, J.R. Hall, S.C. Johnson, et [5] J.C. Pe al., The immune and stress responses of Atlantic cod to long-term increases in
839
water temperature, Fish Shellfish Immunol. 24 (2008) 600e609. [6] E.F. Pettersen, I. Bjørløw, T.J. Hagland, H.I. Wergeland, Effect of seawater temperature on leucocyte populations in Atlantic salmon post-smolts, Vet. Immunol. Immunopathol. 106 (2005) 65e76. [7] B. Magnadottir, H. Jonsdottir, S. Helgason, B. Bjornsson, T. Jorgensen, L. Pilstrom, Humoral immune parameters in Atlantic cod (Gadus morhua L.): I. The effects of environmental temperature, Comp. Biochem. Physiol. B Biochem. Mol. Biol. 122 (1999) 181e188. [8] S. Avunje, M.J. Oh, S.J. Jung, Impaired TLR2 and TLR7 response in olive flounder infected with viral haemorrhagic septicaemia virus at host susceptible 15 C but high at non-susceptible 20 C, Fish Shellfish Immunol. 34 (2013) 1236e1243. [9] T. Hori, A. Gamperl, M. Booman, G. Nash, M. Rise, A moderate increase in ambient temperature modulates the Atlantic cod (Gadus morhua) spleen transcriptome response to intraperitoneal viral mimic injection, BMC Genomics 13 (2012) 431. [10] K. Thanasaksiri, N. Sakai, H. Yamashita, I. Hirono, H. Kondo, Influence of temperature on Mx gene expression profiles and the protection of sevenband grouper, Epinephelus septemfasciatus, against red-spotted grouper nervous necrosis virus (RGNNV) infection after poly (I: C) injection, Fish Shellfish Immunol. 40 (2014) 441e445. [11] E. Lorenzen, K. Einer-Jensen, J.S. Rasmussen, T.E. Kjær, B. Collet, C.J. Secombes, et al., The protective mechanisms induced by a fish rhabdovirus DNA vaccine depend on temperature, Vaccine 27 (2009) 3870e3880. [12] M. Raida, K. Buchmann, Temperature-dependent expression of immunerelevant genes in rainbow trout following Yersinia ruckeri vaccination, Dis. Aquat. Organ 77 (2007) 41e52. [13] M. Polinski, A. Bridle, B. Nowak, Temperature-induced transcription of inflammatory mediators and the influence of Hsp70 following LPS stimulation of Southern bluefin tuna peripheral blood leukocytes and kidney homogenates, Fish Shellfish Immunol. 34 (2013) 1147e1157. [14] M. Raida, K. Buchmann, Bath vaccination of rainbow trout (Oncorhynchus mykiss) against Yersinia ruckeri: effects of temperature on protection and gene expression, Vaccine 26 (2008) 1050e1062. [15] S. Dios, A. Romero, R. Chamorro, A. Figueras, B. Novoa, Effect of the temperature during antiviral immune response ontogeny in teleosts, Fish Shellfish Immunol. 29 (2010) 1019e1027. [16] W. Zheng, G. Liu, J. Ao, X. Chen, Expression analysis of immune-relevant genes in the spleen of large yellow croaker (Pseudosciaena crocea) stimulated with poly I: C, Fish Shellfish Immunol. 21 (2006) 414e430. [17] M. Rise, J. Hall, M. Rise, T. Hori, A. Gamperl, J. Kimball, et al., Functional genomic analysis of the response of Atlantic cod (Gadus morhua) spleen to the viral mimic polyriboinosinic polyribocytidylic acid (pIC), Dev. Comp. Immunol. 32 (2008) 916e971. [18] J. Burnside, P. Neiman, J. Tang, R. Basom, R. Talbot, M. Aronszajn, et al., Development of a cDNA array for chicken gene expression analysis, BMC Genomics 6 (2005) 13. [19] K.M. MacKinnon, J.L. Burton, A.M. Zajac, D.R. Notter, Microarray analysis reveals difference in gene expression profiles of hair and wool sheep infected with Haemonchus contortus, Vet. Immunol. Immunopathol. 130 (2009) 210e220. [20] F.F. Fagutao, M.B.B. Maningas, H. Kondo, T. Aoki, I. Hirono, Transglutaminase regulates immune-related genes in shrimp, Fish Shellfish Immunol. 32 (2012) 711e715. [21] T. Kurobe, M. Yasuike, T. Kimura, I. Hirono, T. Aoki, Expression profiling of immune-related genes from Japanese flounder Paralichthys olivaceus kidney cells using cDNA microarrays, Dev. Comp. Immunol. 29 (2005) 515e523. [22] D. Darawiroj, H. Kondo, I. Hirono, T. Aoki, Immune-related gene expression profiling of yellowtail (Seriola quinqueradiata) kidney cells stimulated with ConA and LPS using microarray analysis, Fish Shellfish Immunol. 24 (2008) 260e266. [23] M. Yasuike, H. Kondo, I. Hirono, T. Aoki, Difference in Japanese flounder, Paralichthys olivaceus gene expression profile following hirame rhabdovirus (HIRRV) G and N protein DNA vaccination, Fish Shellfish Immunol. 23 (2007) 531e541. [24] Y. Dumrongphol, T. Hirota, H. Kondo, T. Aoki, I. Hirono, Identification of novel genes in Japanese flounder (Paralichthys olivaceus) head kidney up-regulated after vaccination with Streptococcus iniae formalin-killed cells, Fish Shellfish Immunol. 26 (2009) 197e200. [25] H. Kondo, Y. Kawana, Y. Suzuki, I. Hirono, Comprehensive gene expression profiling in Japanese flounder kidney after injection with two different formalin-killed pathogenic bacteria, Fish Shellfish Immunol. 41 (2014) 437e440. [26] T. Takano, H. Kondo, I. Hirono, M. Endo, T. Saito-Taki, T. Aoki, Molecular cloning and characterization of toll-like receptor 9 in Japanese flounder, Paralichthys olivaceus, Mol. Immunol. 44 (2007) 1845e1853. [27] M. Schuster, M. Annemann, C. Plaza-Sirvent, I. Schmitz, A typical IkappaB proteins-nuclear modulators of NF-kappaB signaling, Cell Commun. Signal 11 (2013) 23. [28] E. Fiorini, I. Schmitz, W.E. Marissen, S.L. Osborn, M. Touma, T. Sasada, et al., Peptide-induced negative selection of thymocytes activates transcription of an NF-kappa B inhibitor, Mol. Cell 9 (2002) 637e648. [29] A.D. Panopoulos, S.S. Watowich, Granulocyte colony-stimulating factor: molecular mechanisms of action during steady state and ‘emergency’ hematopoiesis, Cytokine 42 (2008) 277e288.
840
K. Thanasaksiri et al. / Fish & Shellfish Immunology 45 (2015) 835e840
[30] M.D. Santos, M. Yasuike, I. Hirono, T. Aoki, The granulocyte colony-stimulating factors (CSF3s) of fish and chicken, Immunogenetics 58 (2006) 422e432. [31] Y. Liu, K. Kimura, R. Yanai, T. Chikama, T. Nishida, Cytokine, chemokine, and adhesion molecule expression mediated by MAPKs in human corneal fibroblasts exposed to poly(I: C), Invest Ophthalmol. Vis. Sci. 49 (2008) 3336e3344. [32] N. Stowell, J. Seideman, H. Raymond, K. Smalley, R. Lamb, D. Egenolf, et al., Long-term activation of TLR3 by poly(I: C) induces inflammation and impairs lung function in mice, Respir. Res. 10 (2009) 43. [33] K. Honda, A. Takaoka, T. Taniguchi, Type I inteferon gene induction by the interferon regulatory factor family of transcription factors, Immunity 25 (2006) 349e360. [34] F. Sun, Y.B. Zhang, T.K. Liu, L. Gan, F.F. Yu, Y. Liu, et al., Characterization of fish IRF3 as an IFN-inducible protein reveals evolving regulation of IFN response in vertebrates, J. Immunol. 185 (2010) 7573e7582. [35] G. Hu, X. Yin, H. Lou, J. Xia, X. Dong, J. Zhang, et al., Interferon regulatory factor 3 (IRF-3) in Japanese flounder, Paralichthys olivaceus: sequencing, limited tissue distribution, inducible expression and induction of fish type I interferon promoter, Dev. Comp. Immunol. 35 (2011) 164e173. [36] O.E. Lin, T. Ohira, I. Hirono, T. Saito-Taki, T. Aoki, Immunoanalysis of antiviral Mx protein expression in Japanese flounder (Paralichthys olivaceus) cells, Dev. Comp. Immunol. 29 (2005) 443e455. [37] J.I. Hikima, M.K. Yi, M. Ohtani, C.Y. Jung, Y.K. Kim, J.Y. Mun, et al., LGP2 expression is enhanced by interferon regulatory factor 3 in olive flounder, Paralichthys olivaceus, PLoS One 7 (2012) e51522. [38] M. Ohtani, J.I. Hikima, S.D. Hwang, T. Morita, Y. Suzuki, G. Kato, et al., Transcriptional regulation of type I interferon gene expression by interferon regulatory factor-3 in Japanese flounder, Paralichthys olivaceus, Dev. Comp. Immunol. 36 (2012) 697e706. [39] C.M.A. Caipang, I. Hirono, T. Aoki, In vitro inhibition of fish rhabdoviruses by Japanese flounder, Paralichthys olivaceus Mx, Virology 317 (2003) 373e382. [40] C.H. Lin, J.A. Christopher John, C.H. Lin, C.Y. Chang, Inhibition of nervous necrosis virus propagation by fish Mx proteins, Biochem. Biophys. Res. Commun. 351 (2006) 534e539. [41] A. Fernandez-Trujillo, P. Ferro, E. Garcia-Rosado, C. Infante, M.C. Alonso, J. Bejar, et al., Poly I: C induces Mx transcription and promotes an antiviral state against sole aquabirnavirus in the flatfish Senegalese sole (Solea senegalensis Kaup), Fish Shellfish Immunol. 24 (2008) 279e285. [42] I. Salinas, K. Lockhart, T.J. Bowden, B. Collet, C.J. Secombes, A.E. Ellis, An assessment of immunostimulants as Mx inducers in Atlantic salmon (Salmo salar L.) parr and the effect of temperature on the kinetics of Mx responses,
Fish Shellfish Immunol. 17 (2004) 159e170. [43] W. Cheng, R.T. Tsai, C.C. Chang, Dietary sodium alginate administration enhances Mx gene expression of the tiger grouper, Epinephelus fuscoguttatus receiving poly I: C, Aquaculture 324e325 (2012) 201e208. [44] J.S. Rawlings, K.M. Rosler, D.A. Harrison, The JAK/STAT signaling pathway, J. Cell Sci. 117 (2004) 1281e1283. [45] P.J. Murray, The JAK-STAT signaling pathway: input and output integration, J. Immunol. 178 (2007) 2623e2629. [46] A. Yoshimura, T. Naka, M. Kubo, SOCS proteins, cytokine signalling and immune regulation, Nat. Rev. Immunol. 7 (2007) 454e465. [47] A. Skjesol, T. Liebe, D.B. Iliev, E.I.S. Thomassen, L.G. Tollersrud, M. Sobhkhez, et al., Functional conservation of suppressors of cytokine signaling proteins between teleosts and mammals: Atlantic salmon SOCS1 binds to JAK/STAT family members and suppresses type I and II IFN signaling, Dev. Comp. Immunol. 45 (2014) 177e189. [48] E.M. Park, J.H. Kang, J. Seo, G. Kim, J. Chung, T.J. Choi, Molecular cloning and expression analysis of the STAT1 gene from olive flounder, Paralichthys olivaceus, BMC Immunol. 9 (2008) 31. [49] F.F. Yu, Y.B. Zhang, T.K. Liu, Y. Liu, F. Sun, J. Jiang, et al., Fish virus-induced interferon exerts antiviral function through Stat1 pathway, Mol. Immunol. 47 (2010) 2330e2341. [50] L. Nie, R. Xiong, Y.S. Zhang, L.Y. Zhu, J.Z. Shao, L.X. Xiang, Conserved inhibitory role of teleost SOCS-1s in IFN signaling pathways, Dev. Comp. Immunol. 43 (2014) 23e29. [51] D. Li, W. Tan, M. Ma, X. Yu, Q. Lai, Z. Wu, et al., Molecular characterization and transcription regulation analysis of type I IFN gene in grass carp (Ctenopharyngodon idella), Gene 504 (2012) 31e40. [52] B. Sun, B. Robertsen, Z. Wang, B. Liu, Identification of an Atlantic salmon IFN multigene cluster encoding three IFN subtypes with very different expression properties, Dev. Comp. Immunol. 33 (2009) 547e558. [53] J. Zou, C.J. Secombes, Teleost fish interferons and their role in immunity, Dev. Comp. Immunol. 35 (2011) 1376e1387. [54] P. Pereiro, M.M. Costa, P. Díaz-Rosales, S. Dios, A. Figueras, B. Novoa, The first characterization of two type I interferons in turbot (Scophthalmus maximus) reveals their differential role, expression pattern and gene induction, Dev. Comp. Immunol. 45 (2014) 233e244. [55] T. Svingerud, T. Solstad, B. Sun, M.L. Nyrud, O. Kileng, L. Greiner-Tollersrud, et al., Atlantic salmon type I IFN subtypes show differences in antiviral activity and cell-dependent expression: evidence for high IFNb/IFNc-producing cells in fish lymphoid tissues, J. Immunol. 189 (2012) 5912e5923.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Temperature-dependent regulation of gene expression in poly (I:C)-treated Japanese flounder, Paralichthys olivaceus Kittipong Thanasaksiri, Ikuo Hirono, Hidehiro Kondo* Laboratory of Genome Science, Graduate School of Tokyo University of Marine Science and Technology, Konan 4-5-7, Minato-ku, Tokyo 108-8477, Japan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 24 March 2015 Received in revised form 21 May 2015 Accepted 28 May 2015 Available online 4 June 2015
Gene expression profiling of poly (I:C)-treated Japanese flounder, Paralichthys olivaceus, under different temperatures was investigated using microarray analysis. The response was analyzed in spleen tissue at 3 and 24 h post injection (hpi) at 15 C and 25 C. A large number of genes in fish treated with poly (I:C) at 25 C were expressed at 3 hpi, whereas the expression profiles at 24 hpi appeared to be similar to those of the controls. Cluster analysis of the different expression profiles showed three distinct groups of upregulated genes in fish reared at 15 C. These were early (3 hpi), early-to-late (3 and 24 hpi), and late (24 hpi) up-regulated genes. These genes included type I IFN-related genes and inflammatory genes. Among the up-regulated genes, most of the type I IFN-related genes played early-to-late- and lateresponding genes at 15 C but early-responding genes at 25 C. Thus, several up-regulated genes in these groups from the microarray result were further verified by qPCR. These results indicate that the type I IFN gene expressions of P. olivaceus treated with poly (I:C) can be regulated in a temperaturedependent manner. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Temperature Poly (I:C) Japanese flounder Microarray
1. Introduction Temperature is an environmental factor that affects productivity in fish aquaculture. Several studies have addressed the relationship between temperature modulation and susceptibility of fish to pathogens [1e4]. For example, rearing Japanese flounder at 20 C reduces the mortality caused by viral hemorrhagic septicemia virus (VHSV) compared with those reared at 14 C [1]. Temperature changes have been shown to modulate immune-related gene expression [5e7]. The influence of temperature on immune-related gene expression has also been investigated in fish upon exposure to pathogens, such as viruses and formalin-killed pathogenic bacteria, or treatment with pathogen-associated molecular patterns (PAMPs), such as molecule including poly (I:C) and lipopolysaccharides (LPS) [8e14]. Poly (I:C) has been widely used for mimic viral infection when studying is associated with immune responses to virus in several fish species, including the sevenband grouper (Epinephelus septemfasciatus), large yellow croaker (Pseudosciaena crocea), and Atlantic cod (Gadus morhua) [10,15e17]. Recently, Dios et al. [15]
* Corresponding author. E-mail address: [email protected] (H. Kondo). http://dx.doi.org/10.1016/j.fsi.2015.05.036 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
demonstrated that zebrafish (Danio rerio) treated with poly (I:C) have different expression profiles of immune-related genes such as Toll-like receptor 3 (TLR3), Mx, and interferon regulatory factor 3 (IRF3) between low (15 C) and high (28 C) temperatures. Interferon stimulatory gene 15 (ISG15) expression in Atlantic cod after poly (I:C) injection was higher at 16 C than 10 C at 6 hpi [9]. Likewise, we previously reported that Mx expression in sevenband grouper injected with poly (I:C) was regulated by temperature [10]. These discoveries indicated that temperature regulates immunerelated gene expression. However, gene expression changes in response to poly (I:C) and temperature changes in teleosts have not been comprehensively analyzed. Microarray analysis is a powerful tool that has been used to extensively study global gene expression in several organisms [9,16,18e20]. A number of genes were identified after stimulation with various stimuli [9,21e25]. This approach provides valuable information for understanding and discovering gene functions, gene expression patterns, and signal transduction pathways. Consequently, in this study, we performed microarray analysis on the gene expression in Japanese flounder treated with poly (I:C) and reared at 15 C or 25 C using a Japanese flounder oligomicroarray containing more than 13,000 unique probes developed in a recent study [25]. The microarray result was further validated by qPCR. This study will provide information on immune-relevant
836
K. Thanasaksiri et al. / Fish & Shellfish Immunology 45 (2015) 835e840
genes that responded to poly (I:C) treatment and elucidate how expression of immune genes are regulated and affected by temperature. 2. Material and methods 2.1. Fish specimens and poly (I:C) treatment Japanese flounder with an average size of 8 cm in total length were acclimated and reared at 15 C or 25 C for a week prior to the start of the experiment. Poly (I:C) was dissolved in DEPC-treated water and fish were intramuscularly injected with 100 mg/100 ml poly (I:C) or 100 ml DEPC-treated water as a negative control. At 3 and 24 hpi, spleen samples were collected for microarray (n ¼ 3) and qPCR (n ¼ 4) analyses as described below. 2.2. RNA extraction and cDNA synthesis Total RNA was extracted using RNAiso Plus (Takara Bio, Japan) and purified with an RNeasy® Mini Kit (Qiagen, USA). RNA quality was evaluated using a 2200 TapeStation (Agilent, USA). Qualified RNA (750 ng in a 20 ml reaction) was reverse transcribed using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA). All procedures were performed following the manufacturer's instructions.
responded to poly (I:C) and temperature and are shown in Table 2. At 25 C, a large number of the genes (174) were up-regulated at 3 hpi and then declined at 24 hpi, whereas eight genes remained highly expressed until 24 hpi (Fig. 1 and Table 2). The gene expression profile at 24 hpi was similar to that of the controls. However, among up-regulated genes at 15 C (62 genes at 3 hpi and 139 genes at 24 hpi; Table 2), clear clustering in the expression profiles was observed, and the expression profiles clustered into three groups (Fig. 1). The first group, whose expression levels were up-regulated at 3 hpi and dramatically decreased at 24 hpi, was considered early-responding genes. Several genes in this cluster were inhibitor of NF-kB signaling (IkB)-delta, granulocyte colonystimulating factor (GCSF), mitogen-activated protein kinase kinase kinase 8 (MAP3K8), and early growth response protein 1 (EGR1) (Table 3). The second group, whose expression levels were up-regulated at 3 hpi and remained relatively constant until 24 hpi, was considered early-to-late responding genes. The genes in the group included type I IFN-related genes such as Mx, IRF3, ISG15, DExD/H, interleukin 27 (IL-27) subunit beta-like, and IRF (Table 3). The third group, whose expression levels were only up-regulated at 24 hpi, was considered late-responding genes; the genes included suppressor of cytokine signaling 1 (SOCS1)-like, signal transducer and activator of transcription 1 (STAT1), ISG56, NLRC5-like, and interferon-induced very large GTPase 1-like (Table 3). 3.2. Verification of gene expression by qPCR
2.3. Microarray analysis The cDNA microarray used in this study contained more than 13,000 unique probes [25]. Microarray analysis was carried out using three samples in each group, and each sample was selected based on RNA quality. The cDNA was synthesized from 200 ng of qualified RNA and labeled with cyanine 3-CTP using a one-color microarray-based gene expression analysis following the manufacturer's instructions (Agilent, USA). The labeled cDNA was subsequently hybridized at 65 C for 17 h. Microarrays were scanned with an Agilent G2565CA Microarray Scanner, and the images obtained from scanning were analyzed with Feature Extraction Software v9.5.3.1 (Agilent, USA). The data were normalized and analyzed using GeneSpring GX v11.5.1 Software (Agilent, USA). The average intensity of each sample was normalized to the median intensity of all groups injected with DEPC-treated water. The data were subsequently filtered based on expression, flags, error, and fold increase. Genes with a fold change of at least 4.0 were considered being differentially expressed. The microarray data were deposited in the GEO database under accession number GSE66692. 2.4. Validation of the microarray result by qPCR analysis To confirm the microarray results, mRNA expression levels of the genes of interest were subsequently analyzed by qPCR. qPCR primers were designed based on Japanese flounder EST sequences that were obtained by next-generation sequencing and spotted onto microarray chips (Table 1). qPCR was carried out (n ¼ 4) using THUNDERBIRD SYBR qPCR mix (Toyobo, Japan). The expression of all examined genes was normalized to the EF-1a expression [26]. 3. Results 3.1. Microarray analysis of genes modulated by temperature and poly (I:C) Temperature influence on gene expression was studied in poly (I:C)-injected fish reared at 15 C and 25 C. A total of 253 genes
Two representative genes of each cluster with the same expression profile were selected for validation of microarray results by qPCR. IkB-delta and GCSF of the early-responding group had expression profiles similar to the heat map in the microarray result, which showed early up-regulation at 3 hpi and a dramatic reduction in expression at 15 C (Fig. 2). Likewise, the qPCR results of IRF3 and Mx (early-to-late group), as well as SOCS1-like and STAT1 (late group) were similar to the expression profiles obtained by microarray analysis (Table 3 and Fig. 2). 4. Discussion Immune-related gene expression modulated by temperature and pathogen infection or PAMPs stimulation has recently been studied in various fish species [8,9,12,14,15]. However, few studies have investigated the gene expression profiling after poly (I:C) stimulation and temperature modulation. In the present study, we investigated the global gene expression profile of poly (I:C)-injected Japanese flounder reared at either 15 C (low) or 25 C (high). The microarray result showed clear distinctive patterns of gene expression at 15 C, in which the genes were clustered into three groups; early-, early-to-late-, or late-responding genes. However, these genes did not cluster in the same pattern at 25 C. After poly (I:C) stimulation, a large number of genes from fish reared at 25 C were up-regulated at 3 hpi and dramatically declined at 24 hpi. The number of up-regulated genes at 3 hpi in the 15 C-reared group was lower than that in fish reared at 25 C (Fig. 1 and Table 2). High levels of gene expression at 25 C were detected at 3 hpi, while at 15 C, high levels of gene expression were clearly observed at 24 hpi (Fig. 1). These results are consistent with those of previously published data on the transcriptome response of the Atlantic cod, which showed that an earlier maximum response was observed at 16 C than at 10 C, where the maximum response was detected late [9]. Similar results were also observed in rainbow trout (Oncorhynchus mykiss) injected with Yersinia ruckeri bacterin, in which high levels of expression of immune-related genes such as IL-1b and IFN-g were detected earlier at 15 C or 25 C than at 5 C [12]. Collectively, these results indicate that higher temperatures
K. Thanasaksiri et al. / Fish & Shellfish Immunology 45 (2015) 835e840
837
Table 1 List of primers used for qPCR. Primer name
Sequence of oligonucleotides and direction 50 e30
Predicted genes
Acc no.
CUST11204-F CUST11204-R CUST13955-F CUST13955-R CUST33-F CUST33-R CUST4418-F CUST4418-R CUST98-F CUST98-R CUST7348-F CUST7348-R JF EF-1a-F JF EF-1a-R
CCAGAACCAACACTCGGTTT ACCCAGAGGTGACCAAGATG CAGAGACTTGCTGACCCACA GAACGAACGAAGCTGTGTCA AGCTGGTGGAGCAGTTCCTA GCCAGATTCCTTGTCCAAAA CGGGACAACCAGAGAACATT CACCAGGCTGATGGTTTCTT AGGAACCCAGAGGGACTGAT AGCTTTCTCCCGCTCCTTAC CCATCTCTGTTCGCTCTGCT TGCACGTCTGCTTCAGTTTC CTCGGGCATAGACTCGTGGT CATGGTCGTGACCTTCGCTC
IkB-delta
XP_008299282.1
GCSF
BAE16320.1
IRF3
ACY69212.1
Mx
BAC76769.1
STAT1
ABS19629.1
SOCS1-like
XP_008282620.1
EF-1a
[1]
Table 2 The numbers of spots showing differential gene expression levels modulated by poly (I:C) and temperature. Total number of spot expressed
15 C, poly (I:C) 3 hpi
253
25 C, poly (I:C) 24 hpi
3 hpi
24 hpi
Up
Down
Up
Down
Up
Down
Up
Down
62
191
139
114
174
79
8
245
induce earlier expression of immune-relevant genes than lower temperatures. Both IkB-delta and GCSF were shown to be up-regulated at 3 hpi when the fish were reared at both 15 C and 25 C, but expression dramatically decreased by 24 hpi when injected with the viral mimic, poly (I:C) (Figs. 1 and 2 and Table 3). IkB-delta is a group of atypical inhibitors of NF-kB (IkBs) [27]. Although the function of IkB-delta has not yet been characterized in fish species, it seems to
be involved in inflammatory responses in mice as an NF-kB modulator [28]. GCSF regulates neutrophilic granulocytes by mediating proliferation and functional activation of neutrophils [29]. In mammals, GCSF expression has been shown to be activated by poly (I:C) stimulation [30,31]. Stimulation of peripheral blood leukocytes (PBLs) of black rockfish Sebastes schlegelii with poly (I:C) up-regulated GCSF expression [32]. The differences in the expression profile of the selected inflammatory response genes at 15 C
Fig. 1. Heat-map of gene expression profiles at 3 and 24 hpi. The genes that are shown were more than four-fold differentially regulated by temperature and poly (I:C) injection. Horizontal and vertical lines represent genes and samples, respectively. Red and blue indicate up- and down-regulation, respectively. The individual sample is indicated by black bar. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
838
K. Thanasaksiri et al. / Fish & Shellfish Immunology 45 (2015) 835e840
Table 3 Group of genes responding to poly (I:C). The majority of response occurred at 15 C. Group
Early
Early-to-late
Late
BLASTx hit
GCSF (Paralichthys olivaceus) IkB-delta (Stegastes partitus) MAP3K8 (Larimichthys crocea) EGR1 (S. partitus) Mx (P. olivaceus) IRF3 (P. olivaceus) ISG15 (P. olivaceus) DExD/H (P. olivaceus) IL-27 subunit beta-like (Haplochromis burtoni) IRF (P. olivaceus) SOCS1-like (S. partitus) STAT1 (P. olivaceus) ISG56 (L. crocea) NLRC5-like (L. crocea) Interferon-induced very large GTPase 1-like (Neolamprologus brichardi)
Acc no.
BAE16320.1 XP_008299282.1 XP_010741473.1 XP_008282663.1 BAC76769.1 ACY69212.1 BAI48419.1 ADI75503.1 XP_005934422.1 BAA83468.1 XP_008282620.1 ABS19629.1 ABY55167.1 XP_010747527.1 XP_006809622.1
Fold change 15 C, poly (I:C)
15 C, control
25 C, poly (I:C)
25 C, control
3 hpi
24 hpi
3 hpi
24 hpi
3 hpi
24 hpi
3 hpi
24 hpi
3.16 4.34 2.82 2.97 2.45 2.87 5.00 2.23 7.65 2.81 0.52 0.03 0.96 0.17 0.49
0.69 0.60 0.69 0.87 5.96 3.76 6.13 6.18 3.13 3.26 4.11 3.06 5.48 3.64 3.19
0.15 0.98 0.43 1.11 0.79 0.12 0.69 0.35 0.08 0.36 0.10 0.13 0.53 0.72 0.31
0.82 0.97 0.09 0.39 0.45 0.96 1.02 0.80 1.35 0.01 0.11 0.81 1.02 0.16 0.33
6.57 3.26 2.58 0.55 4.97 4.64 6.89 6.11 5.97 3.89 3.50 3.07 4.71 3.22 2.99
0.37 0.39 0.30 0.05 1.43 0.76 1.86 1.67 0.29 0.35 1.14 0.90 2.12 0.18 1.26
0.33 0.66 0.15 0.16 0.29 0.20 0.40 0.27 1.00 0.09 0.38 0.20 0.71 0.06 0.37
0.93 0.29 0.27 0.34 0.63 0.12 0.14 0.07 0.20 0.13 0.22 0.08 0.04 0.50 0.63
Number indicates fold-change expression calculated by the average of three samples within each group, and boldface indicates gene up-regulation.
and 25 C were not observed in either the microarray or qPCR results (Table 3 and Fig. 2). These results suggest that inflammatory response genes are up-regulated early when fish is treated with poly (I:C), but they are not influenced by temperature.
Fig. 2. Validation of the microarray results by qPCR (n ¼ 4). A) GCSF; B) IkB-delta; C) Mx; D) IRF3; E) STAT1; F) SOCS1-like. The results were normalized to EF-1a expression, and gene expression is indicated by log10-transformed values. White boxes indicate fold-change between poly (I:C) and control groups determined by qPCR analysis.
IRF genes are key regulators of the IFN production and ISG expression such as Mx [33,34]. In the present study, IRF3 and Mx, which had been previously identified as poly (I:C)-responsive genes, in the Japanese flounder [35,36], were up-regulated at 3 and 24 hpi at 15 C but only at 3 hpi at 25 C (Table 3 and Fig. 2). Japanese flounder IRF3 regulates the transcription of type I IFN and laboratory of genetics and physiology 2 (LGP2) after viral infection or poly (I:C) treatment [37,38]. Hu et al. [35] demonstrated that IRF3 expression in Japanese flounder reared at 18 C and treated with poly (I:C) could be detected at 1e4 days post injection (dpi) and then declined at 5e7 dpi. The function of Mx in the inhibition of viral infection has been characterized in several fish species, including Japanese flounder [39e41]. Our qPCR and microarray results showed that Japanese flounder Mx expression at 3 and 24 hpi when the fish were reared at 15 C were consistent with those of previous studies in Atlantic salmon (Salmo salar) and sevenband grouper, which showed that low temperatures prolong Mx gene expression [10,42]. Likewise, poly (I:C)-injected Japanese flounder reared at 18 C exhibited high levels of Mx expression in the head kidneys and gills at day 3 and 4, in which it dramatically declined at 4e7 dpi and 5e7 dpi, respectively [35]. Based on these observations, it can be speculated that temperature influences expression profiles of interferon-related genes. In addition, previous reports showed that high levels of Mx expression could undergo a rapid decrease thereafter [10,41,43]. Consistent with these results, we observed a dramatic decrease of Mx expression at 24 hpi when the fish were reared at 25 C. SOCSs and STATs are critical components of the JAK-STAT signaling pathway, because they are involved in the production of interferon-stimulated genes (ISGs). After cytokine stimulation, JAKs are activated and then phosphorylate cytokine receptors, which facilitates STAT phosphorylation [44,45]. In mammals, SOCS proteins are involved in a part of the negative feedback-loop of IFN signaling, whereas STATs activate gene transcription in the JAKSTAT pathway. SOCS1 and STAT1 protein functions have been characterized in mammals and recently in teleosts [46e49]. Even though both SOCS1 and STAT1 have been shown to be poly (I:C)induced genes [47,49,50], few studies have examined SOCSs expression after poly (I:C) stimulation. In Atlantic cod, STAT1 was differentially up-regulated between at 10 C and at 16 C after poly (I:C) injection [9]. The expression of Atlantic cod STAT1 was detected at 6 hpi when the fish were reared at 16 C but not at 10 C. The higher level of STAT1 transcripts was
K. Thanasaksiri et al. / Fish & Shellfish Immunology 45 (2015) 835e840
observed at 24 hpi when the fish were reared at 10 C. In this study, we found that SOCS1-like and STAT1 were up-regulated at 24 hpi when the fish were reared at 15 C, while at 3 hpi they were upregulated at 25 C (Fig. 2 and Table 3). This suggests that the SOCS1-like and STAT1 genes are up-regulated late at low temperature. Furthermore, we observed that the expression level of Mx down-regulated from 3 hpi to 24 hpi at 25 C, whereas SOCS1-like was up-regulated at 3 hpi at 25 C. Thus, it is hypothesized that SOCS1-like gene will be up-regulated after high level of Mx expression and SOCS1-like might suppress Mx gene expression, resulting to down-regulation of Mx at 24 hpi at 25 C. It is supported by the conserved inhibitory function of SOCS1 on IFN signaling, as recently it was shown that over-expression of SOCS1 could suppress Mx expression in teleosts [47,50]. The type I IFN expression of poly (I:C)-treated grass carp Ctenopharyngodon idella was detected in spleen at 6, 12, 24, 48 and 72 hpi at room temperature [51]. Poly (I:C) treatment in Atlantic salmon induced significant up-regulation of IFNa transcripts at 14 to 72 hpi and of IFNc transcripts at 14 to 96 hpi [52]. The expression of type I IFN gene in Japanese flounder, however, was not detected from the analyzed microarray result. Hence, no significant expression of type I IFN gene was observed in this study, although, it is possible that there are other type I IFN genes in Japanese flounder. Several studies have been shown that teleost fish appear to have at least two type I IFN genes and the function of the different type I IFN genes has recently been characterized [53e55]. For example, IFN1 of turbot involved in antiviral activity, while IFN2 of turbot involved mainly in the inflammation process [54]. The different responses of type I IFN genes to poly (I:C) have also been observed in Atlantic salmon. IFNa, IFNb, IFNc and not IFNd responded to poly (I:C) [55]. It is, thus, hypothesized that other type I IFN genes might exist in Japanese flounder. In conclusion, the present results demonstrate that high temperatures (25 C) induced an earlier response of immune-related genes than low temperatures (15 C) after poly (I:C) stimulation. Moreover, based on the different expression profiles of type I IFN in Japanese flounder, we suggest that the effect of temperature on type I IFN gene responses might generally occur in other fish species, as observed in the Mx expression profiles of the sevenband grouper [10]. Future studies are needed to elucidate which inducer or suppressor molecules are involved in this temperaturedependent regulation. Acknowledgments This work was supported in part by grants from JSPS Grant-inAid for Young Scientists (B), JSPS Asian Core University Program, and a Japanese Government (Monbukagakusho: MEXT) Scholarship. References [1] M. Sano, T. Ito, T. Matsuyama, C. Nakayasu, J. Kurita, Effect of water temperature shifting on mortality of Japanese flounder Paralichthys olivaceus experimentally infected with viral hemorrhagic septicemia virus, Aquaculture 286 (2009) 254e258. [2] E.C. Grant, D.P. Philipp, K.R. Inendino, T.L. Goldberg, Effects of temperature on the susceptibility of largemouth bass to largemouth bass virus, J. Aquat. Anim. Health 15 (2003) 215e220. [3] J. Castric, P. de Kinkelin, Experimental study of the susceptibility of two marine fish species, sea bass (Dicentrarchus labrax) and turbot (Scophthalmus maximus), to viral haemorrhagic septicaemia, Aquaculture 41 (1984) 203e212. [4] D. Ndong, Y.Y. Chen, Y.H. Lin, B. Vaseeharan, J.C. Chen, The immune response of tilapia Oreochromis mossambicus and its susceptibility to Streptococcus iniae under stress in low and high temperatures, Fish Shellfish Immunol. 22 (2007) 686e694. rez-Casanova, M.L. Rise, B. Dixon, L.O.B. Afonso, J.R. Hall, S.C. Johnson, et [5] J.C. Pe al., The immune and stress responses of Atlantic cod to long-term increases in
839
water temperature, Fish Shellfish Immunol. 24 (2008) 600e609. [6] E.F. Pettersen, I. Bjørløw, T.J. Hagland, H.I. Wergeland, Effect of seawater temperature on leucocyte populations in Atlantic salmon post-smolts, Vet. Immunol. Immunopathol. 106 (2005) 65e76. [7] B. Magnadottir, H. Jonsdottir, S. Helgason, B. Bjornsson, T. Jorgensen, L. Pilstrom, Humoral immune parameters in Atlantic cod (Gadus morhua L.): I. The effects of environmental temperature, Comp. Biochem. Physiol. B Biochem. Mol. Biol. 122 (1999) 181e188. [8] S. Avunje, M.J. Oh, S.J. Jung, Impaired TLR2 and TLR7 response in olive flounder infected with viral haemorrhagic septicaemia virus at host susceptible 15 C but high at non-susceptible 20 C, Fish Shellfish Immunol. 34 (2013) 1236e1243. [9] T. Hori, A. Gamperl, M. Booman, G. Nash, M. Rise, A moderate increase in ambient temperature modulates the Atlantic cod (Gadus morhua) spleen transcriptome response to intraperitoneal viral mimic injection, BMC Genomics 13 (2012) 431. [10] K. Thanasaksiri, N. Sakai, H. Yamashita, I. Hirono, H. Kondo, Influence of temperature on Mx gene expression profiles and the protection of sevenband grouper, Epinephelus septemfasciatus, against red-spotted grouper nervous necrosis virus (RGNNV) infection after poly (I: C) injection, Fish Shellfish Immunol. 40 (2014) 441e445. [11] E. Lorenzen, K. Einer-Jensen, J.S. Rasmussen, T.E. Kjær, B. Collet, C.J. Secombes, et al., The protective mechanisms induced by a fish rhabdovirus DNA vaccine depend on temperature, Vaccine 27 (2009) 3870e3880. [12] M. Raida, K. Buchmann, Temperature-dependent expression of immunerelevant genes in rainbow trout following Yersinia ruckeri vaccination, Dis. Aquat. Organ 77 (2007) 41e52. [13] M. Polinski, A. Bridle, B. Nowak, Temperature-induced transcription of inflammatory mediators and the influence of Hsp70 following LPS stimulation of Southern bluefin tuna peripheral blood leukocytes and kidney homogenates, Fish Shellfish Immunol. 34 (2013) 1147e1157. [14] M. Raida, K. Buchmann, Bath vaccination of rainbow trout (Oncorhynchus mykiss) against Yersinia ruckeri: effects of temperature on protection and gene expression, Vaccine 26 (2008) 1050e1062. [15] S. Dios, A. Romero, R. Chamorro, A. Figueras, B. Novoa, Effect of the temperature during antiviral immune response ontogeny in teleosts, Fish Shellfish Immunol. 29 (2010) 1019e1027. [16] W. Zheng, G. Liu, J. Ao, X. Chen, Expression analysis of immune-relevant genes in the spleen of large yellow croaker (Pseudosciaena crocea) stimulated with poly I: C, Fish Shellfish Immunol. 21 (2006) 414e430. [17] M. Rise, J. Hall, M. Rise, T. Hori, A. Gamperl, J. Kimball, et al., Functional genomic analysis of the response of Atlantic cod (Gadus morhua) spleen to the viral mimic polyriboinosinic polyribocytidylic acid (pIC), Dev. Comp. Immunol. 32 (2008) 916e971. [18] J. Burnside, P. Neiman, J. Tang, R. Basom, R. Talbot, M. Aronszajn, et al., Development of a cDNA array for chicken gene expression analysis, BMC Genomics 6 (2005) 13. [19] K.M. MacKinnon, J.L. Burton, A.M. Zajac, D.R. Notter, Microarray analysis reveals difference in gene expression profiles of hair and wool sheep infected with Haemonchus contortus, Vet. Immunol. Immunopathol. 130 (2009) 210e220. [20] F.F. Fagutao, M.B.B. Maningas, H. Kondo, T. Aoki, I. Hirono, Transglutaminase regulates immune-related genes in shrimp, Fish Shellfish Immunol. 32 (2012) 711e715. [21] T. Kurobe, M. Yasuike, T. Kimura, I. Hirono, T. Aoki, Expression profiling of immune-related genes from Japanese flounder Paralichthys olivaceus kidney cells using cDNA microarrays, Dev. Comp. Immunol. 29 (2005) 515e523. [22] D. Darawiroj, H. Kondo, I. Hirono, T. Aoki, Immune-related gene expression profiling of yellowtail (Seriola quinqueradiata) kidney cells stimulated with ConA and LPS using microarray analysis, Fish Shellfish Immunol. 24 (2008) 260e266. [23] M. Yasuike, H. Kondo, I. Hirono, T. Aoki, Difference in Japanese flounder, Paralichthys olivaceus gene expression profile following hirame rhabdovirus (HIRRV) G and N protein DNA vaccination, Fish Shellfish Immunol. 23 (2007) 531e541. [24] Y. Dumrongphol, T. Hirota, H. Kondo, T. Aoki, I. Hirono, Identification of novel genes in Japanese flounder (Paralichthys olivaceus) head kidney up-regulated after vaccination with Streptococcus iniae formalin-killed cells, Fish Shellfish Immunol. 26 (2009) 197e200. [25] H. Kondo, Y. Kawana, Y. Suzuki, I. Hirono, Comprehensive gene expression profiling in Japanese flounder kidney after injection with two different formalin-killed pathogenic bacteria, Fish Shellfish Immunol. 41 (2014) 437e440. [26] T. Takano, H. Kondo, I. Hirono, M. Endo, T. Saito-Taki, T. Aoki, Molecular cloning and characterization of toll-like receptor 9 in Japanese flounder, Paralichthys olivaceus, Mol. Immunol. 44 (2007) 1845e1853. [27] M. Schuster, M. Annemann, C. Plaza-Sirvent, I. Schmitz, A typical IkappaB proteins-nuclear modulators of NF-kappaB signaling, Cell Commun. Signal 11 (2013) 23. [28] E. Fiorini, I. Schmitz, W.E. Marissen, S.L. Osborn, M. Touma, T. Sasada, et al., Peptide-induced negative selection of thymocytes activates transcription of an NF-kappa B inhibitor, Mol. Cell 9 (2002) 637e648. [29] A.D. Panopoulos, S.S. Watowich, Granulocyte colony-stimulating factor: molecular mechanisms of action during steady state and ‘emergency’ hematopoiesis, Cytokine 42 (2008) 277e288.
840
K. Thanasaksiri et al. / Fish & Shellfish Immunology 45 (2015) 835e840
[30] M.D. Santos, M. Yasuike, I. Hirono, T. Aoki, The granulocyte colony-stimulating factors (CSF3s) of fish and chicken, Immunogenetics 58 (2006) 422e432. [31] Y. Liu, K. Kimura, R. Yanai, T. Chikama, T. Nishida, Cytokine, chemokine, and adhesion molecule expression mediated by MAPKs in human corneal fibroblasts exposed to poly(I: C), Invest Ophthalmol. Vis. Sci. 49 (2008) 3336e3344. [32] N. Stowell, J. Seideman, H. Raymond, K. Smalley, R. Lamb, D. Egenolf, et al., Long-term activation of TLR3 by poly(I: C) induces inflammation and impairs lung function in mice, Respir. Res. 10 (2009) 43. [33] K. Honda, A. Takaoka, T. Taniguchi, Type I inteferon gene induction by the interferon regulatory factor family of transcription factors, Immunity 25 (2006) 349e360. [34] F. Sun, Y.B. Zhang, T.K. Liu, L. Gan, F.F. Yu, Y. Liu, et al., Characterization of fish IRF3 as an IFN-inducible protein reveals evolving regulation of IFN response in vertebrates, J. Immunol. 185 (2010) 7573e7582. [35] G. Hu, X. Yin, H. Lou, J. Xia, X. Dong, J. Zhang, et al., Interferon regulatory factor 3 (IRF-3) in Japanese flounder, Paralichthys olivaceus: sequencing, limited tissue distribution, inducible expression and induction of fish type I interferon promoter, Dev. Comp. Immunol. 35 (2011) 164e173. [36] O.E. Lin, T. Ohira, I. Hirono, T. Saito-Taki, T. Aoki, Immunoanalysis of antiviral Mx protein expression in Japanese flounder (Paralichthys olivaceus) cells, Dev. Comp. Immunol. 29 (2005) 443e455. [37] J.I. Hikima, M.K. Yi, M. Ohtani, C.Y. Jung, Y.K. Kim, J.Y. Mun, et al., LGP2 expression is enhanced by interferon regulatory factor 3 in olive flounder, Paralichthys olivaceus, PLoS One 7 (2012) e51522. [38] M. Ohtani, J.I. Hikima, S.D. Hwang, T. Morita, Y. Suzuki, G. Kato, et al., Transcriptional regulation of type I interferon gene expression by interferon regulatory factor-3 in Japanese flounder, Paralichthys olivaceus, Dev. Comp. Immunol. 36 (2012) 697e706. [39] C.M.A. Caipang, I. Hirono, T. Aoki, In vitro inhibition of fish rhabdoviruses by Japanese flounder, Paralichthys olivaceus Mx, Virology 317 (2003) 373e382. [40] C.H. Lin, J.A. Christopher John, C.H. Lin, C.Y. Chang, Inhibition of nervous necrosis virus propagation by fish Mx proteins, Biochem. Biophys. Res. Commun. 351 (2006) 534e539. [41] A. Fernandez-Trujillo, P. Ferro, E. Garcia-Rosado, C. Infante, M.C. Alonso, J. Bejar, et al., Poly I: C induces Mx transcription and promotes an antiviral state against sole aquabirnavirus in the flatfish Senegalese sole (Solea senegalensis Kaup), Fish Shellfish Immunol. 24 (2008) 279e285. [42] I. Salinas, K. Lockhart, T.J. Bowden, B. Collet, C.J. Secombes, A.E. Ellis, An assessment of immunostimulants as Mx inducers in Atlantic salmon (Salmo salar L.) parr and the effect of temperature on the kinetics of Mx responses,
Fish Shellfish Immunol. 17 (2004) 159e170. [43] W. Cheng, R.T. Tsai, C.C. Chang, Dietary sodium alginate administration enhances Mx gene expression of the tiger grouper, Epinephelus fuscoguttatus receiving poly I: C, Aquaculture 324e325 (2012) 201e208. [44] J.S. Rawlings, K.M. Rosler, D.A. Harrison, The JAK/STAT signaling pathway, J. Cell Sci. 117 (2004) 1281e1283. [45] P.J. Murray, The JAK-STAT signaling pathway: input and output integration, J. Immunol. 178 (2007) 2623e2629. [46] A. Yoshimura, T. Naka, M. Kubo, SOCS proteins, cytokine signalling and immune regulation, Nat. Rev. Immunol. 7 (2007) 454e465. [47] A. Skjesol, T. Liebe, D.B. Iliev, E.I.S. Thomassen, L.G. Tollersrud, M. Sobhkhez, et al., Functional conservation of suppressors of cytokine signaling proteins between teleosts and mammals: Atlantic salmon SOCS1 binds to JAK/STAT family members and suppresses type I and II IFN signaling, Dev. Comp. Immunol. 45 (2014) 177e189. [48] E.M. Park, J.H. Kang, J. Seo, G. Kim, J. Chung, T.J. Choi, Molecular cloning and expression analysis of the STAT1 gene from olive flounder, Paralichthys olivaceus, BMC Immunol. 9 (2008) 31. [49] F.F. Yu, Y.B. Zhang, T.K. Liu, Y. Liu, F. Sun, J. Jiang, et al., Fish virus-induced interferon exerts antiviral function through Stat1 pathway, Mol. Immunol. 47 (2010) 2330e2341. [50] L. Nie, R. Xiong, Y.S. Zhang, L.Y. Zhu, J.Z. Shao, L.X. Xiang, Conserved inhibitory role of teleost SOCS-1s in IFN signaling pathways, Dev. Comp. Immunol. 43 (2014) 23e29. [51] D. Li, W. Tan, M. Ma, X. Yu, Q. Lai, Z. Wu, et al., Molecular characterization and transcription regulation analysis of type I IFN gene in grass carp (Ctenopharyngodon idella), Gene 504 (2012) 31e40. [52] B. Sun, B. Robertsen, Z. Wang, B. Liu, Identification of an Atlantic salmon IFN multigene cluster encoding three IFN subtypes with very different expression properties, Dev. Comp. Immunol. 33 (2009) 547e558. [53] J. Zou, C.J. Secombes, Teleost fish interferons and their role in immunity, Dev. Comp. Immunol. 35 (2011) 1376e1387. [54] P. Pereiro, M.M. Costa, P. Díaz-Rosales, S. Dios, A. Figueras, B. Novoa, The first characterization of two type I interferons in turbot (Scophthalmus maximus) reveals their differential role, expression pattern and gene induction, Dev. Comp. Immunol. 45 (2014) 233e244. [55] T. Svingerud, T. Solstad, B. Sun, M.L. Nyrud, O. Kileng, L. Greiner-Tollersrud, et al., Atlantic salmon type I IFN subtypes show differences in antiviral activity and cell-dependent expression: evidence for high IFNb/IFNc-producing cells in fish lymphoid tissues, J. Immunol. 189 (2012) 5912e5923.