Template-determined, variable rate of RNA chain elongation

Cell,

Vol. 15, 541-550,

October

1978, Copyright

6 1978 by MIT

Template-Determined, Chain Elongation

Variable

Donald R. Mills, Carl Dobkin and Fred Russell Kramer Institute of Cancer Research and Department of Human Genetics and Development Columbia University College of Physicians and Surgeons New York, New York 10032

Summary Qp replicase polymerizes MDV-1 RNA at a markedly variable rate. Electrophoretic analyses of partially synthesized strands showed that a few of the elongation intermediates are much more abundant than others, reflecting a variable rate of chain elongation. Our data suggest that at a relatively small number of specific sites in the sequence of this RNA, the progress of the replicase is temporarily Interrupted, and then resumes spontaneously, with a finite probability. Since the time spent between these pause sites is negligible compared with the time spent at pause sites, the mean time of chain elongation is well approximated by the sum of the mean times spent at each pause site. Nucleotide sequence analysis of the most prominent elongation intermediates indicated that they all have the potential to form a 3’ terminal hairpin structure. This suggests that the marked variability in the rate of chain elongation is due to the formation of terminal hairpins in the product strand, or the reformation of hairpins in the template strand. A survey of the literature shows that thls phenomenon occurs with most, if not all, nucleic acid polymerases. Structure-induced pauses may play a role In the regulation of nucleic acid synthesis. Introduction Midivariant RNA (MDV-1 RNA) consists of two complementary molecules (Kacian et al., 1972) whose only known activity is that they are accepted as templates in vitro by the RNA-directed RNA polymerase, Qp replicase (Haruna and Spiegelman, 1965a). MDV-1 RNA was originally isolated from a Qp replicase reaction that contained no added template RNA (Kacian et al., 1972). Although its biological origin and function are unknown, it serves as a model template for the study of the mechanism of replication in vitro. Either the (+) or the (-) strand of MDV-1 RNA is accepted as template for the synthesis of the complementary strand. Synthesis is initiated at the 3’ end of the template, and the product strand is synthesized processively in the 5’ to 3’ direction

Rate of RNA

(August et al., 1968). Both the template and the product are single-stranded. After the completion of chain elongation, the product, template and replicase all dissociate, leaving the replicase free to bind to a new template for the next replicative cycle (C. Dobkin, D. R. Mills, F. R. Kramer and S. Spiegelman, manuscript in preparation). Since product strands can serve as templates, synthesis is autocatalytic (Haruna and Spiegelman, 1965b). The complete nucleotide sequence of MDV-1 RNA (221 nucleotides long) has been determined (Mills, Kramer and Speigelman, 1973); using reagents that react specifically with nucleotides in a single-stranded conformation, we have observed a pattern of chemical modification that strongly supports the existence of an extensive secondary structure for this RNA (D. R. Mills, F. R. Kramer, C. Dobkin, T. Nishihara and P. E. Cole, manuscript in preparation). This paper concerns the process of chain elongation. Electrophoretic analyses of growing MDV-1 RNA chains indicated that chain elongation occurs at a markedly variable rate. Since the sequence and structure of MDV-1 RNA were known, it was possible to explore this phenomenon in detail.

Results Isolation of Partially Synthesized Product Strands To observe the growth of nascent MDV-1 RNA chains, a reaction was incubated at 37°C for 20 min and then pulse-labeled with w~~P-GTP. The 32PMDV-1 RNA product was isolated and the complementary (+) and (-) strand populations were separated from one another. Each RNA population was then analyzed by acrylamide gel electrophoresis in the presence of 7 M urea to separate the partially synthesized strands by length. The results are shown in Figure 1. Surprisingly, instead of there being 221 different bands in each track (one for each nucleotide added to the growing MDV-1 RNA chain), only a few fragments were detected. Some lengths of incomplete RNA were much more abundant than others in the reaction. The distribution of MDV-1 (+) strand fragments was different than the distribution of (-) strand fragments, indicating that the pattern was determined by the RNA template used.

Design of the Experiments To facilitate observation of growing chains, we used a two-stage reaction scheme (Billeter et al., 1969) in which only one of the two complementary strands was synthesized. In the first stage, pure (+) strand template was incubated at 37°C in the presence of GTP and ATP, permitting synthesis of. the (-) strand to proceed up to the sixth nucleo-

Cell 542

Figure 1. Electrophoretic MDV-1 (+) RNA Fragments RNA Fragments

Separation of Partially and Partially Synthesized

Synthesized MDV-1 (-)

tide, where the first pyrimidine was required. In the second stage, the reaction was incubated at 4°C and CTP and UTP were then added to remove the “elongation block.” Under these conditions, the rate of chain elongation is slowed down but the pattern of partially synthesized (-) strand RNA is the same as the pattern obtained at 37°C. Characterization of the Fragments A two-stage reaction was prepared in which only (-) strand was synthesized and in which all four ribonucleoside triphosphates were cu-32P-labeled at equal specific activities. To insure that all lengths of RNA would be obtained, samples were taken at various times during chain elongation. All the samples were pooled and the RNA fragments were isolated and analyzed by electrophoresis, as shown in Figure 2. The RNA from each gel band was recovered and its nucleotide sequence was determined. The sequence data, which are summarized in Figure 3, showed that the RNA obtained from each gel band was very homogeneous; all the fragments possessed the same 5’ end sequence, identical with the 5’ end sequence of MDV-1 (-) RNA.

Figure 2. Electrophoretic Separation 1 (-) RNA Elongation Intermediates The right-hand track shows the reaction was sampled during uniformly labeled ribonucleoside track shows the labeling pattern was sampled after an additional excess unlabeled ribonucleoside assigned a number. In subsequent used to identify bands containing

of Uniformly Labeled MDVbefore and after a Chase

labeling pattern obtained when a incubation in the presence of triphosphates. The left-hand obtained when the same reaction 5 min at 37°C in the presence of triphosphates. Each band was gels, the same numbers were RNA of the same length.

The Fragments Are Elongation Intermediates To determine whether the partially synthesized RNA fragments were reaction intermediates, a portion of the same reaction used to obtain RNA for sequence analysis was permitted to continue incubation in the presence of an excess of unlabeled ribonucleoside triphosphates. The RNA product of this reaction was also analyzed by electrophoresis on the gel shown in Figure 2. The radioactivity that initially appeared in partially synthesized fragments was chased into full-sized MDV-1 (-) RNA. These results show that the observed RNA fragments are intermediates in the process of chain elongation. Variable Rate of Chain Elongation If the rate of chain elongation were uniform, all 220 elongation intermediates of various lengths would be present in equal quantities in the gel. The presence of only a few bands in the gel indicates

Variable 543

Rate of RNA Chain

Elongation

that the rate of elongation is not uniform and that the replicase pauses during the process of chain elongation. The particular positions in the sequence where chain elongation is slower, the “pause sites,” are indicated by the 3’ ends of the elongation intermediates seen in the gel. The location of the pause sites was deduced from the data shown in Figure 3. The Process of Chain Elongation The following experiment gave a dynamic view of chain elongation. As before, a two-stage reaction was prepared in which only (-) strand was synthesized. Y-~*P-GTP was present during the first stage of the reaction to label exclusively the 5’ terminal nucleotide of the product chains. When the elongation block was removed, an excess of unlabeled GTP was added to insure that only those product chains begun in the first stage would be labeled. This initially synchronized reaction was sampled at various times as elongation proceeded during the second stage, and the partially synthesized product chains were isolated and analyzed by electrophoresis. The results are shown in Figure 4. The bands seen in each track of the slab gel contained the same elongation intermediates that were isolated in the previous experiments. Since the product strands were labeled only at their 5’ terminal nucleotide, the density of each band in the gel was proportional to the number of labeled product strands that had grown to that length. The growth of the product strands from one time point to the next is indicated by the shift in the distribution of label from smaller to larger intermediates. These results illustrate the markedly variable rate of chain elongation. The apparent stepwise shift of label from smaller to larger intermediates at successive time points shows that the time spent between pause sites is relatively short. Time Spent between Pause Sites The following experiment was designed to observe the rapidity of chain elongation between the pause sites. A two-stage reaction was prepared in which only (-) strands were synthesized. To insure that the second stage of the reaction contained a full spectrum of elongation intermediates, aliquots of the first stage reaction were added over a period of time to a second stage reaction mixture that contained CTP and UTP. This “stagger-started” synthesis was then pulse-labeled with (r-32P-ATP for 1 sec. The elongation intermediates were isolated and analyzed as before. Each elongation intermediate was recovered from the gel and its nucleotide sequence was determined. The fingerprint patterns showed that only a few oligonucleotides at the 3’ end of each elongation intermediate were labeled. Figure 5 compares the fingerprint pattern of one of

these pulse-labeled elongation intermediates with the fingerprint pattern of the same elongation intermediate that had been uniformly labeled. In all the pulse-labeled elongation intermediates that were examined, the densely labeled oligonucleotides were those located between the pause site at the 3’ end and the pause site just preceding it. These results, in conjunction with the results obtained in the previous experiment, indicate that the rate of chain elongation between pause sites is vastly greater than the rate of synthesis across the pause site barriers. Kinetics of Chain Elongation through Pause Sites Although the first kinetic experiment (Figure 4) demonstrated the growth of chains through the pause sites in a general way, it could not show kinetically the manner in which elongating chains surmount the pause site barriers. In that experiment, the amount of label in each gel band at the various time points was a measure of the number of chains present at each pause site. The rate at which chains actually grew out of a given pause site, however, could not be measured, since other labeled chains were growing into those pause sites at the same time. The design of the following experiment permitted the direct observation of the rate at which chains grow out of each pause site. As in the previous experiment, a two-stage reaction was prepared in which only (-) strands were synthesized, and the second stage was stagger-started to insure the presence of a full spectrum of elongation intermediates. The reaction was then pulse-labeled with CX-~*P-GTPand immediately chased with a 50 fold excess of GTP. Samples were taken at various times during the chase period. The elongation intermediates in each of the samples were isolated and analyzed by electrophoresis. The resulting gel is shown in Figure 6. The general shift of label to longer elongation intermediates shows that during the chase period synthesis continued and unlabeled nucleotides were added to the 3’ ends of growing chains. The RNA in every band in each track was recovered from the gel and sequenced. The resulting fingerprint patterns permitted measurement of the proportion of chains present in each gel band that had remained unelongated since the pulse-labeling period. These measurements were based on the following reasoning. During the pulse-labeling period, only the oligonucleotides at the 3’ end of each chain were labeled. During the chase period, unlabeled nucleotides were added to the 3’ end of growing chains, and the labeled oligonucleotides in these chains were no longer at their 3’ ends. As the reaction proceeded, each gel band contained both unelongated and elongated chains. The unelongated

Cell 544

6

l-0 11 ,111 “,““-‘A--“----5~~~~~AACCCCCCUUCGGGGGUCACCUCGCGCAGCGGGCUGCGCGAAG~i~~

I

1 I

09

Itr

17

1 1 I 1 -0 r* 11,09W611!-21 “-,09”-,,,---, 5,~~~~AACCCCCCUUCGGGGGUCACCUCGCGCAGCGGGCUGCGCGAAGG~~~~

i6

5’

!O !l

5’-

9

5’-

!3

5’p

!4 5'!5 5'-

0 7

,, 07,o

,5CUCGCG&kGGG~CGCGh?iGGGCC~GCUGC,Gii$@JS+GC,GG7 -i--i07 09 1 1 2L7L ,,CGCG%CGGG=CGCG~GGGCC~GCUGC,G~“UGGCGGUU -7-Y 07 1 t , 09 ,,09, 1 07 ,,GC~CGCG~GGGCC~GCUGCGi%&G~UCUCGUG 09 08 1 I 081

I+,41

091

09-L

5 ‘yGC@E?iGCACGAAGGU 04 1

.

1

1

1

1

,,

1

,&II,

04

,,I

02

,,

11

,,

1

5’-

30

SpGCCUCUUCACGzGCGUCACCUGGG%i&GCG~~xUG,,,57

11

11

L

,

1-L

--.

lT,08,

1

)2b

5’~CGAAAGCGCUAGCCCGUGACUCG 139 08

I3

5’yCCGUGACUCGUCACGGUCGAACU

i4

5’~2UCACGGUCGAACUCCCGUAC~GCCCGCACCUCG -no 1

A

, 1 ,,07,,

00

0

c 0 0 0 --?.I-

Figure 4. Electrophoretic Separation of 5’ EndLabeled Elongation Intermediates Sampled at Different Times after the Removal of the Elongation Block

A

76

7

01 03

01 03 II

07

0

0

03 0 0

01

1

0

01 0

,

Figure MDV-1

0

02

1

002

-'& 05-r 0

,

08 (, , (,I,

09-T

09 .07,, 09 _)I ,,I, 1 1

00

II 1

01

62 0

,$GG~u,CACCUGG,~, 02 0 -I01

-II02

A'

5’~5CACGAGGCGUCACCUGGGAGAGCGCGAAAGCGCUAG~GACUCGUCA,~~ II 08 I -1s*

12a 5’pCGCGXnndCGCUAGCCCGUGACUCGU --E-

0

0 08

88CCGAAACGCACGAAGGUCGCGCCUCUUCACG~GC~Gi$-&,3, 11 09 1 1 1)

"L

0

00 02

01

,,ll,,OT,

!9b

0

Ts-0

07

!9a5 ‘,,,UC6~&A+CGCAC~AP.IGGUCGCGCGCCUCUUCAC~A~~~~GA,33 07 ,1

0

,a-

09

01

1 ,,II.,Oi,

0

000

10

&DP

0

0

02

43CG~GGGCC,UGCG~&&G&i?GCGGUUCUC~~AA92 T?5Pi%ros

0

-E-T’“i;

0 1

05

1

0 1

0

1

,,CGXAdGGGCCA&GCUGCG~&G=GCGG’~$j&G@~AAg2 17-77-1 1 1 111

I

04

ol-cFi7 1

08

,,CGCG=GGGCC~CUGCG~~CG~GCGG’~CG@~w T-77-7-09 1, 1

1

!6

1 ., I ,) 1 ,, 1 ,J,,l,,l,,

24CCUCGCGCAGCGGGCUGCGCGAAGGGGCCAC~U,Gp-~$%GUGGCG7 -i-T-i-as 7-F 1 1 06 1 I , 09 ,,oi,

5’

5’

1

It0 14 09”“--1It1wl1c29* -?.-,. ..--&UUCGGGGGUCACCUCGCGCAGCGGGCUGCGCGAAGGGG’m=CGA6 1 ,, 1 ,, 1 ,,I,,,,,

9

7-

.020

,

3. Nucleotide Sequence Analysis (-) RNA Elongation Intermediates.

of

the

The RNA recovered from each of the bands shown in Figure 2 was fingerprinted and compared with the sequence of MDV-1 (-) RNA. The sequences shown are not the sequences of each elongation intermediate, but rather the general regions of the sequence of MDV-1 (-) RNA in which the 3’ end of each elongation intermediate is located. The heavy box in each sequence region identifies the exact location of the 3’ end. The large number to the left of each sequence identifies the gel band. The brackets above each sequence identify RNAase T, oligonucleotides. and the brackets below identify RNAase A oligonucleotides. The small number associated with each bracket indicates the moles of that oligonucleotide that were actually seen in the fingerprint. The zeros associated with the brackets to the right of the boxed 3’ ends indicate that these oligonucleotides were not present in the elongation intermediate. To conserve space, the 5’ end of the longer intermediates is not shown. The numbers to the left and right of these sequences identify the first and last nucleotides of the region shown.

Variable 545

Rate of RNA Chain

Elongation

Figure 5. Comparison of Two Fingerprint Patterns of Elongation Intermediate 29 Prepared from Uniformly Labeled and PulseLabeled RNA The uniformly labeled RNA analyzed in fingerprint (A) was recovered from the gel shown in Figure 2, and the RNA analyzed in fingerprint (6) was recovered from a gel (not shown) in which pulse-labeled elongation intermediates were separated. The key oligonucleotides visible in each RNAase T, fingerprint are identified by number. The diagram below the fingerprint patterns represents the sequence of elongation intermediate 29, and shows the location of the oligonucleotides identified in the fingerprints. The oligonucleotides present in the pulse-labeled fingerprint occur at the growing 3’ end of the elongation intermediate (shaded rectangles in the diagram).

chains were those that had not grown out of a pause site since the pulse-labeling period, and it was only these chains that carried label at their 3’ ends. Finally, since there are unique oligonucleotides that serve as markers for the 3’ end of each elongation intermediate, the unelongated chains present in a given band could be distinguished by sequence analysis from the elongated chains. Figure 7 illustrates how the fingerprint patterns were used to distinguish elongated from unelongated strands after the pulse-labeling period. During the chase period, the number of unelongated chains remaining in each gel band decreased with time. Figure 8 illustrates the kinetics of disappearance of 3’ end-labeled elongation intermediates from representative bands in the gel. The linearity of the semilogarithmic plots of the fraction of unelongated chains remaining in each band with respect to time shows that the growth of an elongation intermediate out of a pause site is firstorder. Thus the number of chains growing out of a

Figure 6. Electrophoretic Separation of Pulse-Labeled MDV-1 (-) RNA Elongation Intermediates Sampled at Different Times after Incubation in the Presence of Excess Unlabeled Ribonucleoside Triphosphates

pause site at a given instant in time is directly proportional to the number of chains present at the pause site. These results imply that further elongation of a chain at a pause site is independent of prior events and occurs spontaneously, with a finite probability.

Discussion Qp replicase polymerizes MDV-1 RNA at a markedly variable rate. There are a relatively small number of specific sites in the sequence of the RNA at which chain elongation halts. Once such a pause site is encountered by the replicase, there is a finite probability with respect to time that elongation will spontaneously continue. Although in these experiments we were not able to determine quantitatively the rate of chain elongation in different regions, we feel that the rate of synthesis between pause sites is at least 100 fold greater than the rate of synthesis at a pause site.

Cell 546

Time

Figure 6. Disappearance diates from Representative

(minutes)

of 3’ End-Labeled Gel Bands

Elongation

Interme-

Cause of the Variable Rate of Chain Elongation

Figure 7. RNAase T, Fingerprint Patterns of Elongation Intermediate 29 Sampled at Different Times during the Chase Period Oligonucleotides 3, 5, 6. 16 and 39 are located at the 3’ end of elongation intermediate 29 (see Figure 5). Their disappearance from the fingerprint patterns is due to the elongation of these pulse-labeled chains during the chase period. The new oligonucleotides that appear in the later fingerprint patterns come from chains that grew to the size of elongation intermediate 29 during the chase period.

Overall Process of Chain Elongation by Q/3 Replicase The probability that elongation will be resumed is inversely related to the mean time the replicase spends at a pause site. Since the time spent between pause sites is negligible compared with the time spent at pause sites, the mean time of chain elongation is well approximated by the sum of the mean times spent at each pause site. We view chain elongation as a series of steps, each of which has a characteristic probability of occurring, and the probabilities associated with these steps are independent of one another. In mathematical terms, chain elongation is a Markov process.

To gain some insight into what causes the slowing of elongation at the pause sites, we examined the nucleotide sequence at the 3’ ends of the ten most prominent elongation intermediates (seen in the 4 min track of Figure 4). Most of the 3’ end sequences were different from one another. In addition, the sequences at the 3’ ends of these elongation intermediates were present elsewhere in the sequence of MDV-1 RNA where no pause site occurs. They all have a pair of complementary sequences at their 3’ end, however. Thus these major pause sites occur at points at which the product strand can form a terminal hairpin. The location of the 3’ ends of these prominent elongation intermediates is indicated in Figure 9. It is surprising that the progress of the replicase along the template RNA slows at the end of a hairpin region, rather than at the beginning of one. This suggests that the marked variability in the rate of chain elongation is primarily due to the formation of terminal hairpins in the product strand, or the reformation of hairpins in the template strand. In general, the kinetics of chain elongation for different template RNAs should depend upon the secondary structures they form.

Evolution of Secondary Structure Since secondary structures slow down the rate of MDV-1 RNA polymerization, they are disadvantageous and should not have evolved. The secondary structure present in MDV-1 RNA must therefore confer a selective advantage that outweighs the negative effect of its presence on the rate of synthesis. We believe that these structures are present because they are required for specific biological functions.

Variable Rate of Chaln Elongation Polymerases

with Other

Other investigators working with other polymerases have made observations similar to those we have just described. Only a few discrete bands were seen in electrophoretic separations of elon-

Variable

Rate of RNA Chain

Elongation

547

UcA uCGc UA

60 GAA

IIOCGIN

$2 2

loCGM4 EE-5

CUCG ‘U

CG70

uucc z?lo

2

AC

cc2 zoo,C G

‘2

E +29b

5o.CQ22

cGMb

160

31mCG

P~~GGGGAAUCACCUAAGGGGCGGUUCu~uGGGAGAUAGCCGUCGAACUCCCGU

~A~~UCCCCA~+ 150

cQ14 :$I3

170

ii%

SO::-

UA

30GC CG40 AU

la0

CG

220

zi

2:

140 GA AA

%

CzEG 190

Figure

9. Location

of the Major

Pause

Sites That Affect

the Elongation

The location of the sites was determined by examining the Chain growth is from left to right (5’ to 3’). These elongation Elongation intermediate 31 can form a strong terminal hairpin located at nucleotides 130-132.

of MDV-1

(-)

RNA

nucleotide sequence at the 3’ ends of prominent elongation intermediates. intermediates (arrows indicate their 3’ ends) can form 3’ terminal hairpins. by pairing its 3’ terminal cytidines (nucleotides 151-153) with the guanosines

gating chains isolated from DNA-directed RNA syntheses (Maizels, 1973; Rosenberg et al., 1978), RNA-directed DNA syntheses (Efstratiadis et al., 1975; Haseltine et al., 1976) and DNA-directed DNA syntheses (Sherman and Gefter, 1976). The bands seen in electrophoretic separations of the products from RNA polymerase reactions (Maizels, 1973) contained homogeneous fragments, and since the radioactivity in each band could be chased into larger (and in some cases full-length) transcripts, these RNA fragments were elongation intermediates. The location of the bands seen in electrophoretie separations of the products from reverse transcriptase reactions (Efstratiadis et al., 1975; Haseltine et al., 1976) and DNA polymerase reactions (Sherman and Gefter, 1976) depended upon the template used, and not upon the conditions under which each synthesis was performed. Furthermore, many of the elongation intermediates that occurred during reverse transcription possessed 3’ terminal hairpin structures (Efstratiadis et al., 1976). Finally, and perhaps most significantly, many of the elongation intermediates that occurred during transcription also possessed 3’ terminal hairpin structures (Lee and Yanofsky, 1977; Rosenberg et al., 1978; Schwarz et al., 1978). All these results are consistent with the observations and conclusions drawn from our experiments with Op replicase. It is therefore our belief that in all processive nucleic acid polymerase reactions, chain elongation occurs at a markedly variable rate and that the kinetics of polymerization are determined by the nature of the template.

Biological Implications during Chain Elongation

of Structure

Formation

Nucleic acid structure provides a topological basis for specific interactions with proteins. Our results also suggest other ways in which the formation of structures may be biologically significant. It appears that structures form as chain elongation occurs. This coordinate formation of secondary structures probably prevents the reassociation of the product and template strands. Thus structure formation may be an integral part of the strand separation mechanism. The variability in the rate of synthesis induced by the formation of structure may influence the fidelity of nucleotide insertion. Finally, the correlation between the rate of synthesis and the formation of structures suggests that structures may exist specifically to slow down synthesis in order to markedly increase the probability that a biologically significant event will occur at a particular site. For instance, a pause in chain elongation may be a necessary aspect of attenuation and termination of synthesis during transcription. Rosenberg and his colleagues (1978) have shown that termination of transcription at the tR1 site of phage h is accompanied by a pause in chain elongation, and that this pause occurs during synthesis of a region in the RNA transcript that can form a hairpin structure. When the same experiment was performed with the cnc mutants of phage A which are unable to form this structure, termination did not occur at the t,, site and an analysis of the RNA transcripts showed that a pause did not occur there. Thus the structure at the tR1 site may

Cell 548

exist so that its formation will slow down synthesis and enable termination to occur. Indeed, structureinduced pauses may be a necessary aspect of the biological events that regulate nucleic acid synthesis. Experlmental

Procedures

Meterlals Q8 replicase was isolated from Qp bacteriophage-infected Escherichia coli Q13 by the procedure of Eoyang and August (1971) with the hydroxylapatite step omitted. Pancreatic ribonuclease A was purchased from Worthington Biochemical Corp. (Freehold, New Jersey), ribonuclease T, was purchased from Calbiochem (La Jolla, California) and snP ribonucleoside triphosphates were obtained from International Chemical and Nuclear Corp. (Irvine, California). Synthesls of MDV-1 RNA Template MDV-1 RNA was synthesized in 1 ml reactions in which the final concentrations of the components were: 12 mM MgCI,, 84 mM Tris-HCI (pH 7.4). 400 NM (each) ribonucleoside triphosphates (one or more of which was isotopically labeled), 5&500 pg/ml MDV-1 RNA and 40-180 pg/ml ($3 replicase. Reactions were incubated at 37°C for 2 hr, and the IO&250 pg of MDV-1 RNA that were synthesized were isolated as described previously (Kramer et al., 1974). Separation of MDV-1 (+) and (-) RNA W-209 pg of MDV-1 RNA (labeled with at least 10’ dpm of 3*P) were melted in 309 ~1 5 mM Tris-borate (pH 8.3) containing 7 M urea and 200 fig/ml xylene cyanol (Eastman Organic Chemicals, Rochester, New York) at 1M)“C for 1 min, after which the solution was chilled to (PC. The solution was layered over a 10 x 0.2 cm slot at the cathode end of a 12 x 40 x 0.3 cm 8% polyacrylamide slab gel run and cast in 80 mM Tris-borate (pH 8.3) containing 1 mM MgCI,. Electrophoresis was carried out at 400 V until the dye had migrated 35 cm into the gel. MDV-1 RNA migrates approximately half as fast as the dye. The (-) strand migrates 7% faster than the (+) strand. The presence of Mg++ ions in the gel apparently induces small conformational differences in the two complementary strands that lead to their separation. The separated strands were located by autoradiography and the portions of the gel containing each strand were excised. Each portion was broken into l-2 mms pieces, and the RNA they contained was eluted twice with 10 ml 400 mM NaCI. 3 mM EDTA, 10 mM TrisHCI (pH 7.5) overnight in a 20 ml glass scintillation vial. The eluants from the two extractions were drawn off through glass wool and precipitated with 2 vol of ethanol. The total RNA recovered was 3050% of the amount applied to the gel. Pofyacrylamlde Gel Electrophorerlr under Denatudng Condltbns Partially synthesized MDV-1 RNA was fractionated on 10% polyacrylamide slab gels containing 7 M urea (Maniatis, Jeffrey and van deSande, 1975). The RNA was suspended in IO-30 ~1 98% formamide, melted at lo(pC for 2 min and quickly chilled to 0°C. 200 pg/ml xylene cyanol and 200 pg/ml bromophenol blue were added, and the RNA was layered over a 2.3 x 0.2 cm slot at the cathode end of a 12 x 40 x 0.3 cm gel. Electrophoresis was carried out at 250 V until the xylene cyanol had migrated 20 cm into the gel. The separated bands were located by autoradiography and the RNA was recovered from the gel as described above. Nucleotlde Sequence Analyrlr SzP-MDV-l RNA fragments were sequenced by twodimensional high voltage electrophoresis of their RNAase T, and RNAase A digestion products (Sanger, Brownlee and Barrell, 1985). The first-dimension buffer was 400 mM ammonium-formate (pH 3.5),

3 mM EDTA, and the cellulose acetate strips were soaked in the same buffer containing 7 M urea (C. Woese, personal communication). The number of moles of an oligonucleotide present per mole of RNA examined was determined by comparing the radioactivity of that oligonucleotide with the average radioactivity of a group of oligonucleotides known to be present in the RNA being sequenced. When an oligonucleotide occurred more than once in an RNA, those oligoncleotides nearest the 5’ end were assumed to be recovered as 1 mole. If identical oligonucleotides occurred adjacent to one another, no assignment of molar yield was made among them (this is indicated by arrows in Figure 3). As longer elongation intermediates were sequenced, some oligonucleotides occurred more often in the RNA and could not be used as reliable indicators of the 3’ terminal sequence. A few oligonucleotides are known to occur in regions that become structured if the RNA is at least a certain length, resulting in a reduction in the molar yield of these oligonucleotides (Mills et al., 1973). This reduction was taken into account in assigning molar yields in Figure 3. Observatlon of PaHlally Synthesized Fragments under Standard Reaction Condltbns A 250 ~1 reaction containing 10 ng MDV-1 (+) RNA template, 15 fig Qp replicase, 400 PM (each) GTP, ATP, CTP and UTP, 84 mM Tris-HCI (pH 7.5) and 12 mM MgCI, was incubated at 37°C for 20 min (approximately 40 cycles of replication). 3 mCi &*P-GTP (200 Ci/mmole) were added and the reaction was immediately terminated by the addition of 500 +I of a solution containing 100 mM EDTA, 400 mM NaCl and 1 mg/ml SDS. The RNA product was isolated from the reaction (Kramer et al., 1974) dissolved in 209 ~1 1 mM EDTA-NaOH (pH 7) containing 10 pg unlabeled MDV-1 (+) RNA (a 10 fold excess) and melted at 100°C for 1 min. NaCl was added to a final concentration of 150 mM and the RNA was annealed in a sealed tube at 85°C for 30 min. The temperature was then allowed to fall 1” per min to 25°C. The hybrids were separated from the single strands by electrophoresis on cylindrical 4.8% polyacrylamide gels (Bishop, Claybrook and Spiegelman,1987). The 52P-MDV-1 (-) RNA fragments were present as hybrids, and the 3aP-MDV-l (+) RNA fragments were present as single strands. Both populations were recovered from the gel by elution, as described above, and were then analyzed by electrophoresis under denaturing conditions. Two-Stage Reectbn Scheme All the experiments to be described used the following two-stage reaction scheme. In the first stage of each reaction, MDV-1 (+) RNA template and 06 replicase were incubated at 37°C for 3 min in 250 ~1 containing 84 mM Tris-HCI (pH 7.5) 12 mM MgCI,, and GTP and ATP. In the second stage, each reaction was chilled to 4°C to slow chain elongation and CTP and UTP were added. No MDV-1 (+) RNA product was detected under these conditions. Uniformly Labeled Fragments for Sequence Analysis This two-stage reaction contained 3 Fg MDV-1 (+) RNA template and 15 pg Cl,9 replicase. The concentration of each ribonucleoside triphosphate was 120 PM, and the specific activity of each was 70 Ci/mmole. During the second stage of the reaction, 30 PI samples were drawn at 0.5, 1, 2, 3, 4. 5 and 7 min. 200 ~1 of a solution containing 100 mM EDTA and 5 mg/ml SDS were added to each sample to terminate synthesis. These samples were then pooled. The RNA was isolated from the pool and analyzed by electrophoresis under denaturing conditions. The RNA in each gel band was recovered by elution and sequenced. Two of the bands (29 and 32) were each resolved into two separate bands by repeating the electrophoretic separation for a longer period of time. Growth of Labeled Fragments Unlabeled ribonucleoside triphosphates were maining 40 ~1 of the uniformly labeled reaction

added to the reat 7 min, bringing

Variable 549

Rate of RNA Chain

Elongation

the concentration of each nucleotide to 800 PM. This chased portion of the reaction was incubated for an additional 5 min at 37°C. The RNA was then isolated from the reaction and analyzed under denaturing conditions by electrophoresis on the same gel used to fractionate the pooled RNA (Figure 2). Mew of Chain Elongatbn wlth the AM of a 5’ Terminal Label The first stage of this reaction contained 3 pg MDV-1 (+) RNA template, 10 fig Q6 replicase, 200 PM ATP and 40 @l Y-~~P-GTP (1,500 Cilmmole). All four ribonucleoside triphosphates were present at a concentration of 800 FM each during the second stage of the reaction. 50 ~1 samples were drawn at 0.5,1,2,3 and 4 min. The RNA in each sample was isolated and analyzed by electrophoresis under denaturing conditions. Fragments Pulse-Labeled at the 3’ End The first stage of this reaction contained 3 pg MDV-1 (+) RNA template, 15 pg Q6 replicase and 200 &M (each) GTP and ATP. Five aliquots of this reaction were added at 1 min intervals to a tube containing CTP and UTP. The final concentration of each ribonucleoside triphosphate in the second stage was 200 PM. 10 ~1 143 PM &*P-ATP (1,050 Cilmmole) were then added and the reaction was terminated 1 set later by the addition of 250 ~1 of a solution containing 300 mM EDTA, 400 mM NaCl and 2 mg/ml SDS. The RNA was isolated from the reaction and analyzed by electrophoresis under denaturing conditions. RNA in each gel band was recovered by elution and sequenced. Klnetlca of Chaln Elongatbn through a Pause Slte The first stage of this reaction contained 4 pg MDV-1 (+) RNA template, 15 fig Qp replicase. 200 FM ATP and 80 PM GTP. The second stage of the reaction was stagger-started, as described in the 3’ end-labeling experiment above. The growing RNA in the reaction was then pulse-labeled by the addition of u-~~P-GTP, bringing the GTP concentration to 120 PM and the specific activity to 170 Cilmmole. 1 set later, the entire 250 ~1 reaction was added to a 750 ~1 solution containing 84 mM Tris-HCI (pH 7.5). 12 mM MgCI, and 2,000 PM (each) ribonucleoside triphosphate, and incubation was continued at 4°C. This resulted in a 50 fold decrease in the specific activity of the GTP during the chase period. A 200 +I sample was drawn immediately after the chase period was begun (0 min) and at 0.5, 1 and 2 min. The RNA in each sample was isolated and analyzed by electrophoresis under denaturing conditions. The radioactivity of the RNA in each gel band was determined by Cerenkov counting, and the RNA in each gel band was recovered by elution and sequenced. For each elongation intermediate followed, a marker oligonucleotide was selected that occurs at its 3’ end and nowhere else in the sequence of MDV-1 (-) RNA. The radioactivity in each gel band attributable to a particular marker oligonucleotide was determined by multiplying the Cerenkov counts found in the band by the fraction of the counts in that band due to the presence of the oligonucleotide, as determined by an analysis of its fingerprint pattern. As chain elongation proceeded during the chase period, marker olignucleotides were found in bands containing longer RNA fragments. The fraction of strands remaining unelongated at each time point was determined by dividing the radioactivity attributable to the marker oligonucleotide present in the “shortest” band (in which the marker was located at the 3’ end of the fragment) by the total radioactivity attributable to the marker oligonucleotide found in all the bands in the gel track.

We wish to thank Professor Sol Spiegelman for helpful suggestions and support. We also thank Professor Michael Olinick for stimulating mathematical discussions, Ed Hajjar and John Mack for careful preparation of the illustrations, and Fred Andrea of the International Chemical and Nuclear Corporation for the custom synthesis of very high specific activity ribonucleoside triphos-

phates. This work was supported by grants from the NSF, the American Cancer Society and the NIH. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Received

June 8, 1978; revised

July 24,1978

References August, J. T., Banerjee, A. K., Eoyang, L., Franze de Fernandez, M. T., Hori, K., Kuo, C. H., Rensing, U. and Shapiro, L. (1988). Synthesis of bacteriophage 06 RNA. Cold Spring Harbor Symp. Quant. Biol. 33, 73-81. Billeter. M. A., Dahlberg, J. E., Goodman, H. M., Hindley, J. and Weissmann, C. (1969). Sequence of the first 175 nucleotides from the 5’ terminus of 06 RNA synthesized in vitro. Nature 224, 1083 1088. Bishop, D. H. L., Claybrook, J. R. and Spiegelman, S. (1987). Electrophoretic separation of viral nucleic acids on polyacrylamide gels. J. Mol. Biol. 26, 373-387. Efstratiadis, A., Maniatis, T., Kafatos, F. C., Jeffrey, A. and Vournakis, J. N. (1975). Full length and discrete partial reverse transcripts of globin and chorion mRNAs. Cell 4, 387-378. Efstratiadis, A., Kafatos, F. C., Maxam, A. M. and Maniatis, T. (1978). Enzymatic in vitro synthesis of globin genes. Cell 7, 279 288. Eoyang, L. and August, J. T. (1971). Q6 RNA polymerase from phage Q&infected E. coli. In Procedures in Nucleic Acid Research, 2, G. L. Cantoni and D. R. Davies, eds. (New York: Harper and Row), pp. 829-839. Haruna, I. and Spiegelman, S. (1985a). Specific template requirements of RNA replicases. Proc. Nat. Acad. Sci. USA54 579-587. Haruna, I. and Spiegelman, S. (1985b). Autocatalytic synthesis of a viral RNA in vitro. Science 150, 884-888. Haseltine, W. A., Kleid, D. G., Panet, A., Rothenberg, E. and Baltimore, D. (1978). Ordered transcription of RNA tumor virus genomes. J. Mol. Biol. 706, 109-131. Kacian, D. L., Mills, D. R., Kramer, F. R. and Spiegelman, S. (1972). A replicating RNA molecule suitable for a detailed analysis of extracellular evolution and replication. Proc. Nat. Acad. Sci. USA 69, 3038-3042. Kramer, F. R., Mills, D. R., Cole, P. E., Nishihara, T. and Spiegelman, S. (1974). Evolution in vitro: sequence and phenotype of a mutant RNA resistant to ethidium bromide. J. Mol. Biol. 89, 719 736. Lee, F. and Yanofsky, C. (1977). Transcription termination at the trp operon attenuators of Escherichia coli and Salmonella typhimurium: RNA secondary structure and regulation of termination. Proc. Nat. Acad. Sci. USA 74, 4385-4389. Maizels, N. M. (1973). The nucleotide sequence of the lactose messenger ribonucleic acid transcribed from the UV5 promoter mutant of Escherichia coli. Proc. Nat. Acad. Sci. USA 70, 35853589. Maniatis, T., Jeffrey, A. and van dedande, H. (1975). Chain length determination of small double- and single-stranded DNA molecules by polyactylamide gel electrophoresis. Biochemistry 14, 3787-3794. Mills, D. R., Kramer, F. R. and Spiegelman, S. (1973). Complete nucleotide sequence of a replicating RNA molecule. Science 780, 918-927. Rosenberg, M., Court, D., Shimatake, H. and Brady, C. (1978). The relationship between function and DNA sequence in an intercistronic regulatory region in phage A. Nature 272, 414-423. Sanger, F., Brownlee. G. G. and Barrell. 8. G. (1985). A twodimensional fractionation procedure for radioactive nucleotides.

cell 550

J. Mol. Biol. 73, 373-396. Schwarz, E., Scherer, G., Hobom, G. and K&s& Ii. (1978). Nucleotide sequence of cro, cl/ and part of the 0 gene in phage A DNA. Nature 272, 41 O-41 4. Sherman, L. A. and Gefter, M. L. (1976). Studies on the mechanism of enzymatic DNA elongation by Escherichia coli DNA polymerase II. J. Mol. Biol. 703, 61-76.