- Email: [email protected]
Teratogenic and anti-metamorphic effects of bisphenol A on embryonic and larval Xenopus laevis
GENERAL AND COMPARATIVE
ENDOCRINOLOGY General and Comparative Endocrinology 133 (2003) 189–198 www.elsevier.com/locate/ygcen
Teratogenic and anti-metamorphic effects of bisphenol A on embryonic and larval Xenopus laevis Shawichi Iwamuro,a,* Michiaki Sakakibara,a Megumi Terao,a Akiko Ozawa,a Chizuko Kurobe,a Tomokuni Shigeura,a Mayuko Kato,a and Sakae Kikuyamab,c a
Department of Biology, Faculty of Science, Toho University, 2-2-1 Miyama, Funabashi, Chiba 274-8510, Japan b Department of Biology, School of Education, Waseda University, 1-6-1 Shinjuku, Tokyo 169-8050, Japan c CREST, Japan Science and Technology Corporation, 4-1-8 Honcho, Kawaguchi 332-0012, Japan Accepted 25 April 2003
Abstract Effects of bisphenol A (BPA) on embryonic and larval development were investigated. In Xenopus laevis blastulae treated with 2.5–3.0 105 M BPA or with 105 M 17b estradiol (E2 ), malformation of the head region, scoliosis (curved vertebrate), and suppression of organogenesis were observed. In addition, 105 –104 M BPA blocked tri-iodothyronine (T3 )-inducible resorption of the tail segments from premetamorphic (stage 52–54) larvae in vitro. When stage 52 tadpoles were immersed in 1.0–2.5 105 M BPA, deceleration of both spontaneous and thyroxin (T4 )-induced metamorphic changes occurred. Furthermore, BPA suppressed thyroid hormone receptor (TR) b gene expression both in vivo and in vitro. Thus, we concluded that BPA at the concentrations examined affects both embryonic development and larval metamorphosis. Ó 2003 Elsevier Science (USA). All rights reserved. Keywords: Endocrine disrupters; Amphibian; Development; Metamorphosis; Bisphenol A; Thyroid hormone receptor
1. Introduction The steroid hormone/thyroid hormone nuclear receptor (NR) super family proteins such as estrogen receptors (ERs), thyroid hormone (TH) receptors (TRs), retinoic acid (RA) receptors (RARs), and retinoid receptors (RXRs) exhibit a common domain structure with distinct regions responsible for ligand binding, dimer formation, DNA binding, and transcriptional activity (Kumar et al., 1987; Mangelsdorf et al., 1995). Since the transcriptional activity is dependent on the ligand binding, endocrine disrupting chemicals (EDCs) may mimic their ligand actions because of their structural resemblance to the ligands (McKinney, 1989; Moriyama et al., 2002; Rickenbacher et al., 1986). For the study of effects of EDCs via NRs, amphibian embryos and larvae are considered to be a good model. It has been well established that both amphibian em* Corresponding author. Fax: +81-47-472-5206. E-mail address: [email protected] (S. Iwamuro).
bryogenesis (see Nau and Blaner, 1999) and metamorphosis (see Shi, 2000) are under transcriptional control via ligand-dependent activation of NRs. Metamorphosis is regulated through the thyroid hormone (TH) via TRb, the expression of which is TH dependent (Tata, 1993; Tata et al., 1993). It is noteworthy that TRs assemble to form heterodimers with RXRs in developing embryos as well as in metamorphosing larvae. These TR–RXR heterodimers not only bind to thyroid hormone responsive elements (TREs) specifically but also regulate the transcription of TH-responsive genes (Machuca et al., 1995; Marks et al., 1992; Ulisse et al., 1997; Yu et al., 1991; Zhang et al., 1992). Thus, NR proteins are influenced by the dimerization partner to exert their function. In addition, the adrenal steroid hormones such as aldosterone and corticosterone are also involved in metamorphosis (Kikuyama et al., 1993). A synthetic glucocorticoid, dexamethasone (DEX) accelerates THdependent metamorphosis; it stimulates the mRNA expression of RXRc, a partner for the heterodimerization of TRb (Iwamuro and Tata, 1995).
0016-6480/$ - see front matter Ó 2003 Elsevier Science (USA). All rights reserved. doi:10.1016/S0016-6480(03)00188-6
190
S. Iwamuro et al. / General and Comparative Endocrinology 133 (2003) 189–198
Bisphenol A (4,40 isopropylidenediphenol or 2, 20 -bis (p-hydroxyphenyl propane)), BPA, is a monomer of polycarbonate plastics, and is one of the compounds derived from many consumer products, including the inner coating of food cans (Brotons et al., 1995), dental composites (Olea et al., 1996), baby-feeding bottles (Mountfort et al., 1997), and plastic waste samples (Yamamoto and Yasuhara, 1999). The carbonate linkages of polycarbonate plastics are normally resilient but can be hydrolyzed at high temperatures, in which case BPA can be released into the environment (Krishnan et al., 1993; Yamamoto and Yasuhara, 1999). BPA is known to be one of the most potent endocrine-disrupting chemicals, and it exhibits estrogen-like effects possibly through ER in several animal species both in vivo (Colerangle and Roy, 1997; Dodge et al., 1996; Milligan et al., 1998; Mosconi et al., 2002; Steinmetz et al., 1997, 1998) and in vitro (Bergeron et al., 1999; Dodge et al., 1996; Krishnan et al., 1993; Lutz and Kloas, 1999; Olea et al., 1996). Since BPA consists of 2 benzoic rings and has a structural resemblance to T3 and T4 , there is the possibility that BPA binds to TRa and TRb, to act as a TH-agonist or TH-antagonist, thus influencing TH-inducible metamorphosis in amphibians. The results of our present study broaden over knowledge about the effects of BPA, showing that BPA has lethal and teratogenic effects on amphibian embryos and anti-metamorphic effects on their larvae.
2. Materials and methods 2.1. Hormones and chemicals Thyroid hormones (L -thyroxin: T4 , and 3,30 , 5-triiodo-L -thyronine: T3 ) were purchased from Sigma (St. Louis, MO). The hormones were dissolved in dimethyl sulfoxide (DMSO) at 104 M as stock solutions and diluted in dechlorinated water or culture medium at appropriate concentrations. 17b-estradiol (E2 ) and BPA were purchased from Wako (Osaka, Japan). E2 and BPA were dissolved in ethanol at 102 M as stock solutions and diluted as in the case of thyroid hormones. In each experiment, care was taken so that both experimental and control solutions invariably contained equal amounts of DMSO and ethanol. After the experiments, the solutions containing BPA and the hormones were treated with dextran-coated charcoal to adsorb them before being discarded. 2.2. Eggs, embryos, and larvae Male Xenopus laevis were injected twice with 250 IU of human chorionic gonadotropin (hCG) (Teikoku Zoki, Tokyo) into the dorsal lymph for 2 successive days prior to mating. Female Xenopus received an in-
jection of 500 IU of the hCG one day before mating. Each pair of animals was kept in amphibian saline diluted to 20% with dechlorinated water at 23 °C overnight with continuous air-supply. Several hundreds of eggs were obtained from each pair on the next morning, and the eggs were transferred into dechlorinated water and kept at 23 °C during the experiments. Embryos and tadpoles were staged according to Niewkoop and Faber (1967). When examined after 16 h, about 80% of the eggs turned out to have been fertilized and had reached embryonic stage 7. The apparently unfertilized embryos were discarded, and the remaining embryos were immediately transferred into containers filled with 1 L of experimental solution or kept in dechlorinated water and fed until used for the experiments at advanced stages (stages 52–54). When relatively large number of individuals were necessary in one experiment, care was taken so that embryos or larvae belonging to different siblings were evenly distributed in each experimental groups. 2.3. Survival rate, morphological observation, and histology About 60–100 embryos at stage 7 were exposed for 72 h to dechlorinated water containing 105 , 2.0 105 , 2.5 105 , 3.0 105 , 5.0 105 , or 104 M BPA, or 106 or 105 M E2 , and then transferred to dechlorinated water. The number of surviving embryos was counted at 48, 96, and 120 h after the treatment. The survival rates at 96 and 120 h were expressed as a percent of the embryos that survived throughout the initial 48 h. The number of tadpoles except the 2.0 105 and 3.0 105 M BPA-treated ones, showing morphological abnormalities such as malformation of the head region and scoliosis was recorded 5–7 days after fertilization. At least three specimens from each group were fixed in BouinÕs solution, dehydrated in ethanol solutions, embedded in paraffin, sectioned at 8 lm, and stained with AzanÕs solution. 2.4. In vivo experiments Groups of 10–12 stage 52 Xenopus tadpoles were immersed in 1 L of dechlorinated water containing 107 M T4 , 105 or 2.5 105 M BPA or the combination of 107 M T4 and 105 or 2.5 105 M BPA for 22 days at 23 °C under 12L–12D illumination conditions. The water was changed every 2 days. The animals were monitored for their developmental stages every 3 days and photographed under a microscope Olympus SMZ10 (Olympus, Tokyo) equipped with an Olympus PM30 automatic photograph system on days 9, 15, and 21. On day 22, the animals were sacrificed; and the head, trunk, and tail regions were separately pooled for RNA extraction.
S. Iwamuro et al. / General and Comparative Endocrinology 133 (2003) 189–198
2.5. In vitro experiments Stage 52–54 Xenopus tadpoles were immersed for 24 h in modified 67% L15 medium (Gibco-BRL, MA) containing penicillin and streptomycin (Gibco-BRL) before removal of the tail. The tadpoles were anaesthetized with 0.01% MS222 (Sigma), and their tails were amputated just above the hind limb buds, as described previously (Iwamuro and Tata, 1995). Four tails about 23 mm in average length were placed in each well of a 6well culture plate (Becton–Dickinson, NJ) in 2 ml of 67% L15 medium containing the antibiotics and additives such as 107 M T3 and/or 105 M BPA or 107 M T3 and/or 104 M BPA at 23 °C. The medium was renewed every 48 h. The length of each tail segment was measured every 24 h over a millimeter grid (Tata, 1966). After 4 days of culture, tail segments in each well were pooled for RNA extraction. 2.6. RNA extraction Total RNA from 3 regions of the tadpole body and cultured tails was prepared by the acid phenol/guanidine thiocyanate procedure (Chomczynski and Sacchi, 1987). Concentrations and quality of the extracted RNA were estimated by measurement of the absorbance at 260 and 280 nm, and the samples were stored at )80 °C until used.
191
thesized primers and expected lengths of amplified PCR products are shown in Table 1. Synthetic primers were purchased from Nippon Seifun (Atsugi, Japan). 2.8. Semi-quantitative analysis of PCR products RT-PCR products (10 ll aliquots) were separated on 2% agarose gel and stained with ethidium bromide. Fluorescent images of the amplified DNAs were captured and calculated semi-quantitatively with a Kodak digital image analyzer and a computer software EDAS290 system (Eastman Kodak, NY) by using Takara DNA ladder markers (100 ng/band) as a reference standard. The conditions for RT-PCR were determined by changing the initial amounts of total RNA and/or the number of PCR cycles. When the amount of template RNA was fixed at 100 ng, the relative unit of the band obtained from 28, 30, and 34 cycles of RT-PCR was within the linear range (Fig. 1A). Similarly, when the amount of template total RNA ranged from 25 to 200 ng, the relative unit of the band at 30 cycles was within the linear range (Fig. 1B). Accordingly, 100 ng of total RNA and 30 cycles were chosen as the RT-PCR conditions. Expression of Xenopus elongation factor 1a (EF1aÞ mRNA was detected in all samples to confirm the equal quantity of the RNA loaded (Nishimura et al., 1997). 2.9. Statistical analyses
2.7. Reverse transcriptase polymerase chain reaction (RT-PCR) RT-PCR was performed with specific primers by using a Qiagen One-Step RT-PCR kit (Qiagen, Chatswort, CA) according to the manufacturerÕs protocol. Briefly, 100 ng of total RNA and a set of specific primers were incubated at 50 °C for 30 min for the reversetranscription and then at 95 °C for 15 min for the degeneration of the reverse-transcriptase. Subsequently, PCR was performed with a Takara PCR Thermal Cycler (Ohtsu, Japan) under the following conditions: 30 s at 94 °C, 30 s at 60 °C, and 1 min at 72 °C for 28–34 cycles. Finally, the reaction mixtures were kept at 72 °C for complete extension of the DNA. Sequences of syn-
Statistic analyses for the survival rate and malformation frequencies were performed using v2 test and for the inhibition of metamorphosis was performed employing DuncanÕs new multiple range test.
3. Results 3.1. Survival rate Xenopus laevis blastulae were immersed in dechlorinated water containing the vehicle alone or 105 , 2.0 105 , 2.5 105 , 3.0 105 , 5.0 105 , or 104 M BPA, or 105 or 106 M E2 . The numbers of embryos
Table 1 PCR primers used for the detection of TRb and EF1a gene expressions Gene
GenBank Accession No.
TRb
M35359
EF1a
M25504
Position of 50 residue
Direction
Sequence (50 –30 )
Amplified length (bp)
348 510
Forward Reverse
TGTTCAGAAACCTGAACCCACACAA TCCACCCTCGGGCGCATTAA
163
1325 1571
Forward Reverse
ACATGAGGCAGACTGTTGCC TTCCTTCTGAAGCTCTTGCG
247
Numbers indicate the most 50 -end nucleotide of the primer corresponding to the sequence. TRb, thyroid hormone receptor b; EF1a, elongation factor 1a.
192
S. Iwamuro et al. / General and Comparative Endocrinology 133 (2003) 189–198
2.0 105 M BPA solutions survived for 120 h, more than 75% of the embryos kept in 2.5–3.0 105 M BPA died. Embryos immersed in 104 M BPA did not survive even for 48 h. The survival rates, calculated on the basis of the number of embryos that survived for the initial 48 h as 100%, are shown in Table 2. From these results the median lethal dose, LD50 , of BPA was estimated to be 2.1 105 M. 3.2. Morphological abnormalities
Fig. 1. Semi-quantification of Xenopus TRb mRNA by RT-PCR. Conditions for RT-PCR were selected by changing the number of PCR cycles with 100 ng total RNA as template (A) and the initial amounts of total RNA at 30 cycles for PCR (B). The PCR products were separated by 2.0% agarose gel electrophoresis followed by staining with ethidium bromide. The fluorescence image from the gel was captured by a Kodak EDAS system equipped with a digital camera system. The values of arbitrary densitometric units (ADU) of each band were calculated based on standard DNA loaded in the same electrophoresis gel. Means of duplicate values were plotted.
immersed in these solutions surviving at 48, 96, and 120 h after fertilization are shown in Table 2. While most of the embryos (about 90%) in the control and 1.0–
The ratios of embryos treated with vehicle, 105 or 2.0 105 M BPA or 106 or 105 M E2 exhibiting scoliosis (winding vertebrate) and malformation of the head region (shortened distance between the eyes) are shown in Table 3. No apparent abnormalities were detected in the specimens immersed in 105 M BPA for 7 days. In the specimens kept in 2.5 105 M BPA, the abnormalities were mainly observed in dead ones, but a few of surviving specimens also exhibited these morphological abnormalities. Although several tadpoles in the 105 and 2.5 105 M BPA groups exhibited abnormalities during the first 6 days, they could finally recover from the malformation and initiated normal development. In 105 M E2 -treated groups, 40 of the 48 surviving specimens exhibited head malformation and 16 out of the 48 had curved vertebrate. Histological study of the animals that had been treated with relatively high concentration of BPA revealed malformations such as winding vertebrae, swollen head and shortening of the distance between the eyes. In addition, suppression of organogenesis of digestive and nervous systems was also prominent. Similar developmental defects occurred in the specimens treated with 105 M E2 (Fig. 2). 3.3. Inhibition of metamorphosis by BPA Stage 52 larvae kept in dechlorinated water or 107 M T4 for 21 days reached stage 56 or 62, respectively. BPA exhibited a suppressive effect on both spontaneous and T4 -induced metamorphosis. Larvae immersed in BPA for 21 days showed a retardation of metamorphosis by 1–2 stages as compared with control tadpoles
Table 2 Effect of various concentrations of bisphenol A (BPA) or 17b estadiol (E2 ) on the survival rate of Xenopus embryos and larvae Hours
Cont
10 48 96 120
51 (100) 46 (90) 45 (88)
E2 (M)
BPA (M) 5
71 (100) 70 (99) 70 (99)
5
5
5
5
2.0 10
2.5 10
3.0 10
5.0 10
10
78 (100) 76 (97) 70 (90)
50 (100) 11 (22) 11 (22)
89 (100) 13 (15) 10 (11)
2 0 0
0 0 0
4
106
105
61 (100) 57 (93) 57 (93)
57 (100) 54 (95) 52 (91)
Each groups consisting of approximately 60–100 embryos at stage 7 was kept in an incubation container. After 48 h, the number of surviving embryos or larvae was counted. The numbers in parentheses represent the ratio (%) of the surviving embryos or larvae to the number of embryos that survived for the initial 48 h. * P < 0:001 vs control.
S. Iwamuro et al. / General and Comparative Endocrinology 133 (2003) 189–198
193
Table 3 Malformations in Xenopus larvae caused by BPA and E2 BPA (M) Days
E2 (M)
Cont
105
2.5 105
106
105
5
S V E
46 1 (2.1) 0 (0)
70 2 (2.9) 2 (2.9)
11 6 (55) 3 (27)
57 1 (1.8) 0 (0)
54 20 (37) 44 (81)
6
S V E
45 1 (2.2) 0 (0)
70 1 (1.4) 2 (2.9)
11 3 (27) 3(27)
57 0 (0) 0 (0)
52 19 (37) 41 (79)
7
S V E
45 1 (2.2) 0 (0)
70 0 (0) 0 (0)
11 3 (27) 4 (15)
57 0 (0) 0 (0)
48 16 (33) 40 (83)
Embryos immersed in dechlorinated water (control), 1.0 105 or 2.5 105 M BPA, or 106 or 105 M E2 indicated in Table 2 were observed under a microscope after they reached larval stages, and the numbers of abnormal animals were counted. S, the number of animals that survived. V and E indicate the number of animals exhibiting crooked vertebrate and a shortened distance between the eyes, respectively. The numbers in parentheses represent % incidence of V or E. * P < 0:01 vs control. ** P < 0:001 vs control.
Fig. 2. Teratogenic effects of BPA and E2 on Xenopus embryo. The embryos survived through 72 h-immersion in water (A), 3.0 105 M BPA (D) and 105 M E2 (G) were photographed and then fixed in BouinÕs solution. Cross-sections of the heads (B,E,H) and abdomens (C,F,I) were made and stained with AzanÕs solution. g, gut; n, notochord; s, somite; sc, spinal cord. Scale bars (in A,D,G) are 1 mm, other bars are 200 lm.
kept in dechlorinated water for 21 days. Similarly, the larvae kept in the water containing T4 and BPA exhibited the retardation of metamorphosis by 2–4 stages as
compared with the T4 -treated larvae. In both cases the effect of BPA was concentration-dependent (Figs. 3 and 4).
194
S. Iwamuro et al. / General and Comparative Endocrinology 133 (2003) 189–198
Fig. 3. Representative profiles of tadpoles kept in water (Cont), T4 , BPA or combinations of T4 and BPA. Groups of 10–12 tadpoles at stage 52 (0 day) were used for each treatment. Tadpoles at typical stages in each treatment were photographed under a binocular microscope. The photos were scanned by a scanner, and the images were prepared for publication by using Adobe Photoshop software. Other details are described in Section 2. T4 , 107 M; B, 105 M BPA; 2.5 B, 2.5 105 M BPA; T4 + B, 107 M T4 + 105 M BPA; and T4 + 2.5 B, 107 M T4 + 2.5 105 M BPA.
When the tail segments from stage 52–54 larvae were cultured for 4 days in the presence of 107 M T3 , the length of the tail segments was reduced to approximately 55% of the initial length. The addition of 105 or 104 M BPA blocked the T3 -induced shortening of the tail, and this effect was concentration dependent. Tail segments cultured in the medium containing BPA alone or no additives (control) exhibited a slight but not significant change after 4 days in culture (Figs. 5 and 6).
elevated the level of TRb mRNA. In turn, BPA counteracted the T4 to reduce the T4 -induced elevation of the TRb mRNA expression. Similarly, BPA suppressed TRb mRNA expression, possibly by counteracting the endogenous thyroid hormones (Fig. 7). As shown in Fig. 8, 107 M T3 also exerted a marked upregulation of TRb gene expression and BPA suppressed the action of T3 in a dose-dependent manner. Interestingly, BPA alone reduced TRb gene expression almost completely.
3.4. Suppression of TRb mRNA expression by BPA
4. Discussion
Figs. 7 and 8 show the effect of BPA on the TRb mRNA expression. T4 at a concentration of 107 M
The results obtained by the present experiments clearly indicate that BPA at relatively high concentra-
S. Iwamuro et al. / General and Comparative Endocrinology 133 (2003) 189–198
195
Fig. 4. Dose- and time-dependent inhibition of spontaneous and the T4 -induced Xenopus tadpole metamorphosis by BPA. Each point and vertical bar in represent the mean and SEM. Tadpoles were staged according to Niewkoop and Faber (1967). The values with the same superscript do not differ significantly at the 5% level (DuncanÕs new multiple range test). Fig. 6. Changes in the length of tails cultured in T3 and/or BPA. The rate of tail regression in this figure was obtained from determination by daily measurements of the length. Each point and vertical bar represent the mean and SEM, respectively. The average length of tail segments at day 0 was 23 mm. The values with the same superscript do not differ significantly at the 5% level (DuncanÕs new multiple range test).
Fig. 5. Inhibitory-effect of BPA on T3 -induced regression of Xenopus tadpole tails in organ culture. Batches of 4 tails from stage 52–54 larvae were cultured in 6-well culture dishes with the additive being 107 M T3 or 105 or 104 M BPA or the 2 additives in different combinations. The tails were photographed 4 days after the start of culture Well A, control; well B, 107 M T3 ; well C, 104 M BPA; well D, 105 M BPA; well E, 107 M T3 + 104 M BPA; and well F, 107 M T3 + 105 M BPA.
tions affected both embryonic and larval development. In the embryo, BPA induced malformation, scoliosis and suppression of organogenesis in both digestive and nervous systems, causing embryonic death at higher concentrations. In larvae, BPA blocked not only spontaneous but also TH-induced metamorphosis both in vivo and in vitro. This is the first demonstration that BPA has an anti-thyroid hormone activity in amphibian larvae. The fact that BPA suppressed TRb mRNA expression that is known to be upregulated by TH (Iwamuro
and Tata, 1995) suggests that one of the BPA actions is exerted through the TH receptor. In fact, a very recent report by Moriyama et al. (2002) indicates that BPA (105 M) has a relatively weak binding activity to rat hepatic nuclear TRs with an inhibitory manner of binding of T3 . They also showed that BPA suppresses transcriptional activities mediated by TRs. Consistent with previous studies in birds (Berg et al., 2001), fishes (Honkanen et al., 2001; Pastva et al., 2001), and sponges (Hill et al., 2002), BPA induced morphological malformations and lethality in amphibian embryos. In the present experiment to assess the lethality of BPA, we immersed developing embryos in BPA solution without separating them from unfertilized eggs to avoid the elapse of time. Accordingly, we calculated the survival rate with respect to the number of embryos that survived the initial 48 h. According to our results, concentration of 2.0 105 M or less had no effect on the survival of embryos. Berg et al. (2001) reported the LD50 of BPA in quail and chicken embryos treated in ovo to range between 67 and 200 lg/g egg. In terms of molar concentrations, these values are comparable to 105 – 104 M, being in good agreement with those in Xenopus embryos. The lethal effect of BPA on a Xenopus cell line XTC-2 was also observed in the same concentration range (unpublished data). Previously, Nishimura et al. (1997) reported that in Xenopus embryos, pharmacological concentration (105 M) of E2 or diethylstilbesrol (DES), but not 17a-
196
S. Iwamuro et al. / General and Comparative Endocrinology 133 (2003) 189–198
Fig. 7. Effect of T4 and BPA on the steady-state levels of Xenopus TRb mRNA in various regions of Xenopus tadpoles treated for 22 days with 107 M T4 or 105 M or 2.5 105 M BPA separately or in combinations. At the end of this period, the tadpoles were separated into the head, trunk, and tail regions and pooled, and then total RNA was extracted from each pool. One hundred-nanogram of aliquots were subjected to the RT-PCR for semi-quantification of TRb mRNA and EF1a mRNA under the conditions established in Fig. 1 and according to Nishimura et al. (1997), respectively. The values of relative amounts of TRb in the figure are normalized with reference to the amount of EF1a. Each column represents the average value of duplicate determination. The figure shows the results 1 of the 2 independent experiments both of which gave identical results. C, control; B, 105 M BPA; 2.5 B, 2.5 105 M BPA; and T4 , 107 M T4 .
estradiol, 5a-dihydrotestosterone or progesterone, induced abnormalities and lethality similar to those observed in the present experiment. We confirmed that 105 M E2 affected the embryogenesis. In general, BPA is regarded to be 4–7 orders of magnitude less potent than E2 (Chun and Gorski, 2000; Krishnan et al., 1993). However, our results demonstrated that BPA at 2.5 times the effective concentration of E2 was sufficient to induce the teratogenesis and lethality. Recently, a number of test systems have proved the estrogenic activities of BPA acting through the ER, but not all of them could be attenuated by anti-estrogens (Papaconstantinou et al., 2001), suggesting the involvement of alternate pathways of BPA action that do not involve the ER but other NRs such as corticoid and androgen receptors, TRs, RARs, and RXRs. In fact, Shi and his co-leagues reported the relevance of TR and RXR gene expression to teratogenic effects (Puzianowska-Kunicka et al., 1997); and Minucci et al. (1996) also produced RXR selective ligand-induced malformations in Xenopus
Fig. 8. Effects of T3 and/or BPA on the gene expression of TRb. Total RNA was extracted from the pooled samples of the tail segments after 4 days in culture and 100 ng of the sample was amplified by the RTPCR. Other details are described in Fig. 7. The fluorescence image from electrophoresis gel was captured with a digital camera system and then visualized by using Adobe Photoshop software (inset). The bands on the lanes for 105 M and 104 M BPA were slightly detected by the digital camera but could not be regarded as signals by the EDAS system. The relative amounts of TRb were normalized with reference to the amount of ER1a in each sample. Each column represents the average value of duplicate determination. The figure shows the results of 1 of the 2 independent experiments, the other gave identical results. C, control; B, 105 M BPA; 10 B, 104 M BPA; and T3 , 107 M T3 .
embryos. It is noteworthy that concentrations of E2 and BPA in terms of inducing the lethality and teratogenecity were almost the same, ranging between 105 M and 104 M. Taking into consideration that the physiological dosage of E2 in vertebrates is 106 M or less, it would be difficult to conclude that the effects induced by E2 in Xenopus embryogenesis come from the authentic bioactivities of E2 itself. However, further analyses will be required to clarify whether the lethal and teratogenic effects of BPA and E2 are exerted through ER-dependent or ER-independent pathway. Xenopus tadpoles older than stage 52 seemed to be more resistant to the teratogenicity of BPA, because these animals treated with 2.5 105 M BPA showed neither apparent morphological abnormalities nor suppressed organogenesis of the digestive system when examined histologically (data not shown). Interestingly, when BPA-treatment was halted, these animals re-started metamorphosis normally and successfully developed into juvenile frogs. Such animals remained alive at least for 9 months (data not shown). The present experiments also demonstrated that BPA at concentrations similar to those that induced lethality and teratogenicity in Xenopus embryos blocked spontaneous and TH-inducible metamorphosis in Xenopus tadpoles. A similar result was obtained with the in vitro
S. Iwamuro et al. / General and Comparative Endocrinology 133 (2003) 189–198
experiment in which the tail segments were cultured in T3 and/or BPA. It is noteworthy that tissue-specific responsiveness to T4 was observed in the in vivo experiments. The head and trunk regions from 107 M T4 -treated tadpoles did not show the elevation of TRb mRNA, whereas the tail region subjected to the same concentration of T4 exhibited elevation of TRb mRNA expression to a level 1.7 times higher than the control one. Kawahara et al. (1999) reported that the profiles of TRb mRNA expression varied among organs such as brain, kidney, liver, hind limb, intestine, and tail. They demonstrated that the highest level of TRb mRNA was expressed at metamorphic climax (stage 62–64) in the tail, when the tail resorption occurred. The steady-state levels of TRb mRNA in the head and trunk regions were almost stable until stage 58. They also pointed out the stage- and organ-specific responsiveness of TRb gene expression to T3 and T4 . According to their results, the intestine and hind limbs of stage 54 Xenopus tadpoles responded to T4 immediately with elevation of their TRb mRNA levels, whereas the tail and liver did not respond to T4 during 3 days of treatment. Accordingly, the regional differences in responsiveness to T4 in terms of TRb mRNA expression as seen in our experiment may also be attributable to the difference in the metamorphic stages when examined. In our experiment, the tail responded to T4 to augment TRb mRNA, and BPA blocked this T4 induced elevation of TRb mRNA. Furthermore, BPA lowered the TRb mRNA levels in the tail presumably by counteracting endogenous TH. These results coincide with those obtained from the in vitro experiment. BPA suppressed, though partially, the elevation of T3 -induced TRb mRNA. Interestingly, however, even in the absence of T3 , BPA lowered TRb mRNA levels as compared with control tail segments cultured without T3 . This raises the possibility BPA can also act on the tail to diminish TRb mRNA expression without counteracting TH. In fact, in the in vivo experiment, we noticed that TRb mRNA levels in the head and trunk regions, which were not elevated by exogenous T4 , were lowered by BPA. It remains to be clarified whether BPA accelerates the degradation of TRb mRNA and/or suppresses mRNA synthesis occurring independently of T3 . Kloas et al. (1999) induced feminization of Xenopus by treating with a relatively low concentration (107 M) of BPA starting from stage 38–40 throughout metamorphosis. Interestingly, E2 levels during this period are much lower than those at embryonic stages, whereas E2 receptor mRNA levels in metamorphosing tadpoles are much higher than in embryos (Bogi et al., 2002). On the other hand, antimetamorphic effect of BPA became evident in metamorphosing tadpoles in which thyroid hormone titer (Leloup and Buscaglia, 1970) and thyroid hormone receptor mRNA levels (Yaoita and Brown, 1990; Yaoita et al., 1990) are elevating. These facts may
197
explain that moderate concentrations of BPA caused sexual differentiation while BPA could exert antimetamorphic effects only when relatively high concentrations of BPA were applied. Taken together, BPA may act as an antimetamorphic as well as an estrogenic agent in Xenopus larvae.
Acknowledgments We wish to thank Dr. Y. Habata and Miss M. Yamada of Toho University for their valuable advice and technical help during the course of experiment. Thanks are also extended to the members in our laboratory for the help in taking care of the animals.
References Berg, C., Halldin, K., Brunstrom, B., 2001. Effects of bisphenol A and tetrabromobisphenol A on sex organ development in quail and chicken embryos. Environ. Toxicol. Chem. 20, 2836–2840. Bergeron, R.M., Thompson, T.B., Leonard, L.S., Pluta, L., Gaido, K.W., 1999. Estrogenicity of bisphenol A in a human endometrial carcinoma cell line. Mol. Cell. Endocrinol. 150, 179–187. Bogi, C., Levy, G., Lutz, I., Kloas, W., 2002. Functional genomics and sexual differentiation in amphibians. Comp. Biochem. Biophys. B. 133, 559–570. Brotons, J.A., Olea-Serrano, M.F., Villalobos, M., Pedraza, V., Olea, N., 1995. Xenoestgogens released from lacquer coatings in food cans. Environ. Health Perspect. 103, 608–612. Chomczynski, P., Sacchi, N., 1987. Single-step of RNA isolation by acid guanidium thiocyanate–phenol–chlorofrom extraction. Anal. Chem. 162, 156–159. Chun, T.-Y., Gorski, J., 2000. High concentrations of bisphenol A induce cell growth and prolactin secretion in an estrogen-responsive pituitary tumor cell line. Toxicol. Appl. Pharmacol. 162, 161–165. Colerangle, J.B., Roy, D., 1997. Profound effects of the weak environmental estrogen-like chemical bisphenol A on the growth of the mammary gland of Noble rats. J. Steroid Biochem. Mol. Biol. 60, 153–160. Dodge, J.A., Glasebrook, A.L., Magee, D.E., Phillips, D.L., Sato, M., Short, L.L., Bryant, H.U., 1996. Environmental estrogens: effects on cholesterol lowering and bone in the ovariectomized rat. J. Steriod Biochem. Mol. Biol. 59, 155–161. Hill, M., Stavile, C., Steffen, L.K., Hill, A., 2002. Toxic effects of endocrine disrupters on freshwater sponges: common developmental abnormalities. Environ. Poll. 117, 295–300. Honkanen, J.O., Heinonen, J., Kukkonen, J.V.K., 2001. Toxicokinetics of waterborne bisphenol A in landlocked salmon (Salmo salar M. sebago) eggs at various temperatures. Environ. Toxicol. Chem. 20, 2296–2302. Iwamuro, S., Tata, J.R., 1995. Contrasting patterns of expression of thyroid hormone and retinoid X receptor genes during hormonal manipulation of Xenopus tadpole tail regression in culture. Mol. Cell. Endocrinol. 113, 235–243. Kawahara, A., Gohda, Y., Hikosaka, A., 1999. Role of type III iodothyronine 5-deiodinase gene expression in temporal regulation of Xenopus metamorphosis. Dev. Growth Differ. 41, 365–373. Kikuyama, S., Kawamura, K., Tanaka, S., Yamamoto, K., 1993. Aspects of amphibian metamorphosis: hormonal control. Int. Rev. Cytol. 145, 105–148.
198
S. Iwamuro et al. / General and Comparative Endocrinology 133 (2003) 189–198
Kloas, W., Lutz, I., Einspanier, R., 1999. Amphibians as a model to study endocrine disruptors: II. Estrogenic activity of environmental chemicals in vitro and in vivo. Sci. Total. Environ. 225, 59–68. Kumar, V., Gree, S., Stack, G., Berry, M., Jin, J.R., Chambon, P., 1987. Functional domains of the human estrogen receptor. Cell 51, 941–951. Krishnan, A.V., Stathis, P., Permuth, S.F., Tokes, L., Feldman, D., 1993. Bisphenol-A: an estrogenic substance is released from polycarbonate flasks during autoclaving. Endocrinology 132, 2279–2286. Leloup, J., Buscaglia, M., 1970. La triiodothyronine: hormone de la metamorphose des amphibiens. C. R. Acad. Sci. 284, 2261–2263. Lutz, I., Kloas, W., 1999. Amphibians as a model to study endocrine disruptors: I. Environmental pollution and estrogen receptor binding. Sci. Total Environ. 225, 49–57. Machuca, I., Esslemont, G., Fairclough, L., Tata, J.R., 1995. Analysis of structure and expression of the Xenopus thyroid hormone receptor-b gene to explain its autoinduction. Mol. Endocrinol. 9, 96–107. Mangelsdorf, D.J., Thummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P., Evans, R.M., 1995. The nuclear receptor superfamily: the second decade. Cell 83, 835–839. Marks, M.S., Hallenbeck, L., Nagata, T., Segars, J.H., Appella, E., Nikodem, V.M., Ozato, K., 1992. H-2RIIBP (RXR-bÞ heterodimerization provides a mechanism for combinatorial diversity in the regulation of retinoic acid and thyroid hormone responsive genes. EMBO J. 11, 1419–1432. McKinney, J.D., 1989. Multifunctional receptor model for dioxin and related compounds toxic action: possible thyroid hormone-responsive effector-linked site. Environ. Health Perspect. 82, 323–336. Milligan, S.R., Balasubramanian, A.V., Kalita, J.C., 1998. Relative potency of xenobiotic estrogens in an acute in vivo mammalian assay. Environ. Health Perspect 106, 23–26. Minucci, S., Saint-Jeannet, J.P., Toyama, R., Scita, G., DeLuca, L.M., Taira, M., Levins, A.A., Ozato, K., Dawid, I.B., 1996. Retinoid X receptor selective ligands produce malformations in Xenopus embryos. Proc. Natl. Acad. Sci. USA 93, 1803–1807. Moriyama, K., Tagami, T., Akamizu, T., Usui, T., Saijo, M., Kanamoto, N., Hayaya, Y., Shimatsu, A., Kuzuya, H., Nakao, K., 2002. Thyroid hormone action is disrupted by bisphenol A as an antagonist. J. Clin. Endocrinol. Metab. 87, 5185–5190. Mosconi, G., Carnevali, O., Franzoni, M.F., Cottone, E., Lutz, I., Kloas, W., Yamamoto, K., Kikuyama, S., Polzonetti-Magni, A.M., 2002. Environmental estrogens and reproductive biology in amphibians. Gen. Comp. Endocrinol. 126, 125–129. Mountfort, K.A., Kelly, J., Jickells, S.M., Castle, L., 1997. Investigations into the potential degradation of polycarbonate baby bottles during sterilization with consequent release of bisphenol A. Food Addit. Contam. 14, 737–740. Nau, H., Blaner, S. (Eds.), 1999. Retinoids; The Biochemical and Molecular Basis of Vitamin A and Retinoid Action. SpringerVerlag, Berlin. Niewkoop, P.D., Faber, J., 1967. Normal Table of Xenopus laevis (Daudin), second ed., North-Holland, Amsterdam. Nishimura, N., Fukazawa, Y., Uchiyama, H., Iguchi, T., 1997. Effects of estrogenic hormones on early development of Xenopus laevis. J. Exp. Zool. 278, 221–233.
Olea, N., Pulgar, T., Perez, P., Olea-Serrano, F., Rivas, A., NovilloFertell, A., Pedraza, V., Soto, A.M., Sonnenschein, C., 1996. Estrogenicity of resin-based composites and sealants used in dentisry, Environ. Health Perspect. 104 (1996) 298–305. Papaconstantinou, A.D., Umbreit, T.H., Fisher, B.R., Goering, P.L., Lappans, N.T., Brown, K.M., 2001. Bisphenol-A induced increase in uterine weight and alterations in uterine morphology in ovariectomized B6C3F1 mice: role of the estrogen receptor. Toxicol. Sci. 56, 332–339. Pastva, S.D., Villalobos, S.A., Kannan, K., Giesy, J.P., 2001. Morphological effects of bisphenol-A on the early life stages of medaka (Oryzias latipes). Chemosphere 45, 535–541. Puzianowska-Kunicka, M., Damjanovski, S., Shi, Y.-B., 1997. Both thyroid hormone and 9-cis retinoic acid receptors are required to efficiently mediate the effects of thyroid hormone on embryogenic development and specific gene regulation in Xenopus laevis. Mol. Cell. Biol. 17, 4738–4749. Rickenbacher, U., McKinney, J.D., Oatley, S.J., Blake, C.C.F., 1986. Structurally specific binding of halogenated bisphenols to thyroxin transport protein. J. Med. Chem. 29, 641–648. Shi, Y.-.B., 2000. Amphibian Metamorphosis from Morphology to Molecular Biology. Wiley-Liss, New York. Steinmetz, R., Brown, N.G., Allen, D.L., Bigsby, R.M., Ben-Jonathan, N., 1997. The environmental estrogen bisphenol A stimulates prolactin release in vitro and in vivo. Endocrinology 138, 1780– 1786. Steinmetz, R., Mitchner, N.A., Grant, A., Allen, D.L., Bigsby, R.M., Ben-Jonathan, N., 1998. The xenoestrogen bisphenol A induces growth, differentiation, and c-fos gene expression in the female reproductive tract. Endocrinology 139, 2741–2747. Tata, J.R., 1966. Requirement for RNA and protein synthesis for induced regression of the tadpole tail in organ culture. Dev. Biol. 13, 77–94. Tata, J.R., 1993. Gene expression during metamorphosis: an ideal model for post-embryonic development. BioEssays 15, 239–248. Tata, J.R., Baker, B.S., Machuca, I., Rabelo, E.M.L., Yamauchi, K., 1993. Autoinduction of nuclear receptor genes and its significance. J. Steroid Biochem. Mol. Biol. 46, 105–109. Ulisse, S., Iwamuro, S., Tata, J.R., 1997. Differential responses to ligands of overexpressed thyroid hormone and retinoid X receptors in a Xenopus cell line and in vivo. Mol. Cell. Endocrinol. 126, 17– 24. Yamamoto, T., Yasuhara, A., 1999. Quantities of bisphenol A leached from plastic waste samples. Chemosphere 38, 2569–2576. Yaoita, Y., Brown, D.D., 1990. A correlation of thyroid hormone receptor gene expression with amphibian metamorphosis. Genes Dev. 4, 1917–1924. Yaoita, Y., Shi, Y.B., Brown, D.D., 1990. Xenopus laevis a and b thyroid hormone receptors. Proc. Natl. Acad. Sci. USA 87, 7090–7094. Yu, Y.C., Delsert, C., Andersen, B., Holloway, J.M., Devary, O.V., Naar, M., Kim, S.Y., Boutin, Jo.M., Glass, C.K., Rosenfeld, M.G., 1991. RXRb: a coregulator that enhances binding of retinoic acid, thyroid hormone, and vitamin D receptors to their cognate response elements. Cell 67, 1251–1266. Zhang, X.K., Hoffman, B., Tran, P.B.V., Graupner, G., Pfahl, M., 1992. Retinoid X receptor is an auxiliary protein for thyroid hormone and retinoic acid receptors. Nature 355, 441–446.
ENDOCRINOLOGY General and Comparative Endocrinology 133 (2003) 189–198 www.elsevier.com/locate/ygcen
Teratogenic and anti-metamorphic effects of bisphenol A on embryonic and larval Xenopus laevis Shawichi Iwamuro,a,* Michiaki Sakakibara,a Megumi Terao,a Akiko Ozawa,a Chizuko Kurobe,a Tomokuni Shigeura,a Mayuko Kato,a and Sakae Kikuyamab,c a
Department of Biology, Faculty of Science, Toho University, 2-2-1 Miyama, Funabashi, Chiba 274-8510, Japan b Department of Biology, School of Education, Waseda University, 1-6-1 Shinjuku, Tokyo 169-8050, Japan c CREST, Japan Science and Technology Corporation, 4-1-8 Honcho, Kawaguchi 332-0012, Japan Accepted 25 April 2003
Abstract Effects of bisphenol A (BPA) on embryonic and larval development were investigated. In Xenopus laevis blastulae treated with 2.5–3.0 105 M BPA or with 105 M 17b estradiol (E2 ), malformation of the head region, scoliosis (curved vertebrate), and suppression of organogenesis were observed. In addition, 105 –104 M BPA blocked tri-iodothyronine (T3 )-inducible resorption of the tail segments from premetamorphic (stage 52–54) larvae in vitro. When stage 52 tadpoles were immersed in 1.0–2.5 105 M BPA, deceleration of both spontaneous and thyroxin (T4 )-induced metamorphic changes occurred. Furthermore, BPA suppressed thyroid hormone receptor (TR) b gene expression both in vivo and in vitro. Thus, we concluded that BPA at the concentrations examined affects both embryonic development and larval metamorphosis. Ó 2003 Elsevier Science (USA). All rights reserved. Keywords: Endocrine disrupters; Amphibian; Development; Metamorphosis; Bisphenol A; Thyroid hormone receptor
1. Introduction The steroid hormone/thyroid hormone nuclear receptor (NR) super family proteins such as estrogen receptors (ERs), thyroid hormone (TH) receptors (TRs), retinoic acid (RA) receptors (RARs), and retinoid receptors (RXRs) exhibit a common domain structure with distinct regions responsible for ligand binding, dimer formation, DNA binding, and transcriptional activity (Kumar et al., 1987; Mangelsdorf et al., 1995). Since the transcriptional activity is dependent on the ligand binding, endocrine disrupting chemicals (EDCs) may mimic their ligand actions because of their structural resemblance to the ligands (McKinney, 1989; Moriyama et al., 2002; Rickenbacher et al., 1986). For the study of effects of EDCs via NRs, amphibian embryos and larvae are considered to be a good model. It has been well established that both amphibian em* Corresponding author. Fax: +81-47-472-5206. E-mail address: [email protected] (S. Iwamuro).
bryogenesis (see Nau and Blaner, 1999) and metamorphosis (see Shi, 2000) are under transcriptional control via ligand-dependent activation of NRs. Metamorphosis is regulated through the thyroid hormone (TH) via TRb, the expression of which is TH dependent (Tata, 1993; Tata et al., 1993). It is noteworthy that TRs assemble to form heterodimers with RXRs in developing embryos as well as in metamorphosing larvae. These TR–RXR heterodimers not only bind to thyroid hormone responsive elements (TREs) specifically but also regulate the transcription of TH-responsive genes (Machuca et al., 1995; Marks et al., 1992; Ulisse et al., 1997; Yu et al., 1991; Zhang et al., 1992). Thus, NR proteins are influenced by the dimerization partner to exert their function. In addition, the adrenal steroid hormones such as aldosterone and corticosterone are also involved in metamorphosis (Kikuyama et al., 1993). A synthetic glucocorticoid, dexamethasone (DEX) accelerates THdependent metamorphosis; it stimulates the mRNA expression of RXRc, a partner for the heterodimerization of TRb (Iwamuro and Tata, 1995).
0016-6480/$ - see front matter Ó 2003 Elsevier Science (USA). All rights reserved. doi:10.1016/S0016-6480(03)00188-6
190
S. Iwamuro et al. / General and Comparative Endocrinology 133 (2003) 189–198
Bisphenol A (4,40 isopropylidenediphenol or 2, 20 -bis (p-hydroxyphenyl propane)), BPA, is a monomer of polycarbonate plastics, and is one of the compounds derived from many consumer products, including the inner coating of food cans (Brotons et al., 1995), dental composites (Olea et al., 1996), baby-feeding bottles (Mountfort et al., 1997), and plastic waste samples (Yamamoto and Yasuhara, 1999). The carbonate linkages of polycarbonate plastics are normally resilient but can be hydrolyzed at high temperatures, in which case BPA can be released into the environment (Krishnan et al., 1993; Yamamoto and Yasuhara, 1999). BPA is known to be one of the most potent endocrine-disrupting chemicals, and it exhibits estrogen-like effects possibly through ER in several animal species both in vivo (Colerangle and Roy, 1997; Dodge et al., 1996; Milligan et al., 1998; Mosconi et al., 2002; Steinmetz et al., 1997, 1998) and in vitro (Bergeron et al., 1999; Dodge et al., 1996; Krishnan et al., 1993; Lutz and Kloas, 1999; Olea et al., 1996). Since BPA consists of 2 benzoic rings and has a structural resemblance to T3 and T4 , there is the possibility that BPA binds to TRa and TRb, to act as a TH-agonist or TH-antagonist, thus influencing TH-inducible metamorphosis in amphibians. The results of our present study broaden over knowledge about the effects of BPA, showing that BPA has lethal and teratogenic effects on amphibian embryos and anti-metamorphic effects on their larvae.
2. Materials and methods 2.1. Hormones and chemicals Thyroid hormones (L -thyroxin: T4 , and 3,30 , 5-triiodo-L -thyronine: T3 ) were purchased from Sigma (St. Louis, MO). The hormones were dissolved in dimethyl sulfoxide (DMSO) at 104 M as stock solutions and diluted in dechlorinated water or culture medium at appropriate concentrations. 17b-estradiol (E2 ) and BPA were purchased from Wako (Osaka, Japan). E2 and BPA were dissolved in ethanol at 102 M as stock solutions and diluted as in the case of thyroid hormones. In each experiment, care was taken so that both experimental and control solutions invariably contained equal amounts of DMSO and ethanol. After the experiments, the solutions containing BPA and the hormones were treated with dextran-coated charcoal to adsorb them before being discarded. 2.2. Eggs, embryos, and larvae Male Xenopus laevis were injected twice with 250 IU of human chorionic gonadotropin (hCG) (Teikoku Zoki, Tokyo) into the dorsal lymph for 2 successive days prior to mating. Female Xenopus received an in-
jection of 500 IU of the hCG one day before mating. Each pair of animals was kept in amphibian saline diluted to 20% with dechlorinated water at 23 °C overnight with continuous air-supply. Several hundreds of eggs were obtained from each pair on the next morning, and the eggs were transferred into dechlorinated water and kept at 23 °C during the experiments. Embryos and tadpoles were staged according to Niewkoop and Faber (1967). When examined after 16 h, about 80% of the eggs turned out to have been fertilized and had reached embryonic stage 7. The apparently unfertilized embryos were discarded, and the remaining embryos were immediately transferred into containers filled with 1 L of experimental solution or kept in dechlorinated water and fed until used for the experiments at advanced stages (stages 52–54). When relatively large number of individuals were necessary in one experiment, care was taken so that embryos or larvae belonging to different siblings were evenly distributed in each experimental groups. 2.3. Survival rate, morphological observation, and histology About 60–100 embryos at stage 7 were exposed for 72 h to dechlorinated water containing 105 , 2.0 105 , 2.5 105 , 3.0 105 , 5.0 105 , or 104 M BPA, or 106 or 105 M E2 , and then transferred to dechlorinated water. The number of surviving embryos was counted at 48, 96, and 120 h after the treatment. The survival rates at 96 and 120 h were expressed as a percent of the embryos that survived throughout the initial 48 h. The number of tadpoles except the 2.0 105 and 3.0 105 M BPA-treated ones, showing morphological abnormalities such as malformation of the head region and scoliosis was recorded 5–7 days after fertilization. At least three specimens from each group were fixed in BouinÕs solution, dehydrated in ethanol solutions, embedded in paraffin, sectioned at 8 lm, and stained with AzanÕs solution. 2.4. In vivo experiments Groups of 10–12 stage 52 Xenopus tadpoles were immersed in 1 L of dechlorinated water containing 107 M T4 , 105 or 2.5 105 M BPA or the combination of 107 M T4 and 105 or 2.5 105 M BPA for 22 days at 23 °C under 12L–12D illumination conditions. The water was changed every 2 days. The animals were monitored for their developmental stages every 3 days and photographed under a microscope Olympus SMZ10 (Olympus, Tokyo) equipped with an Olympus PM30 automatic photograph system on days 9, 15, and 21. On day 22, the animals were sacrificed; and the head, trunk, and tail regions were separately pooled for RNA extraction.
S. Iwamuro et al. / General and Comparative Endocrinology 133 (2003) 189–198
2.5. In vitro experiments Stage 52–54 Xenopus tadpoles were immersed for 24 h in modified 67% L15 medium (Gibco-BRL, MA) containing penicillin and streptomycin (Gibco-BRL) before removal of the tail. The tadpoles were anaesthetized with 0.01% MS222 (Sigma), and their tails were amputated just above the hind limb buds, as described previously (Iwamuro and Tata, 1995). Four tails about 23 mm in average length were placed in each well of a 6well culture plate (Becton–Dickinson, NJ) in 2 ml of 67% L15 medium containing the antibiotics and additives such as 107 M T3 and/or 105 M BPA or 107 M T3 and/or 104 M BPA at 23 °C. The medium was renewed every 48 h. The length of each tail segment was measured every 24 h over a millimeter grid (Tata, 1966). After 4 days of culture, tail segments in each well were pooled for RNA extraction. 2.6. RNA extraction Total RNA from 3 regions of the tadpole body and cultured tails was prepared by the acid phenol/guanidine thiocyanate procedure (Chomczynski and Sacchi, 1987). Concentrations and quality of the extracted RNA were estimated by measurement of the absorbance at 260 and 280 nm, and the samples were stored at )80 °C until used.
191
thesized primers and expected lengths of amplified PCR products are shown in Table 1. Synthetic primers were purchased from Nippon Seifun (Atsugi, Japan). 2.8. Semi-quantitative analysis of PCR products RT-PCR products (10 ll aliquots) were separated on 2% agarose gel and stained with ethidium bromide. Fluorescent images of the amplified DNAs were captured and calculated semi-quantitatively with a Kodak digital image analyzer and a computer software EDAS290 system (Eastman Kodak, NY) by using Takara DNA ladder markers (100 ng/band) as a reference standard. The conditions for RT-PCR were determined by changing the initial amounts of total RNA and/or the number of PCR cycles. When the amount of template RNA was fixed at 100 ng, the relative unit of the band obtained from 28, 30, and 34 cycles of RT-PCR was within the linear range (Fig. 1A). Similarly, when the amount of template total RNA ranged from 25 to 200 ng, the relative unit of the band at 30 cycles was within the linear range (Fig. 1B). Accordingly, 100 ng of total RNA and 30 cycles were chosen as the RT-PCR conditions. Expression of Xenopus elongation factor 1a (EF1aÞ mRNA was detected in all samples to confirm the equal quantity of the RNA loaded (Nishimura et al., 1997). 2.9. Statistical analyses
2.7. Reverse transcriptase polymerase chain reaction (RT-PCR) RT-PCR was performed with specific primers by using a Qiagen One-Step RT-PCR kit (Qiagen, Chatswort, CA) according to the manufacturerÕs protocol. Briefly, 100 ng of total RNA and a set of specific primers were incubated at 50 °C for 30 min for the reversetranscription and then at 95 °C for 15 min for the degeneration of the reverse-transcriptase. Subsequently, PCR was performed with a Takara PCR Thermal Cycler (Ohtsu, Japan) under the following conditions: 30 s at 94 °C, 30 s at 60 °C, and 1 min at 72 °C for 28–34 cycles. Finally, the reaction mixtures were kept at 72 °C for complete extension of the DNA. Sequences of syn-
Statistic analyses for the survival rate and malformation frequencies were performed using v2 test and for the inhibition of metamorphosis was performed employing DuncanÕs new multiple range test.
3. Results 3.1. Survival rate Xenopus laevis blastulae were immersed in dechlorinated water containing the vehicle alone or 105 , 2.0 105 , 2.5 105 , 3.0 105 , 5.0 105 , or 104 M BPA, or 105 or 106 M E2 . The numbers of embryos
Table 1 PCR primers used for the detection of TRb and EF1a gene expressions Gene
GenBank Accession No.
TRb
M35359
EF1a
M25504
Position of 50 residue
Direction
Sequence (50 –30 )
Amplified length (bp)
348 510
Forward Reverse
TGTTCAGAAACCTGAACCCACACAA TCCACCCTCGGGCGCATTAA
163
1325 1571
Forward Reverse
ACATGAGGCAGACTGTTGCC TTCCTTCTGAAGCTCTTGCG
247
Numbers indicate the most 50 -end nucleotide of the primer corresponding to the sequence. TRb, thyroid hormone receptor b; EF1a, elongation factor 1a.
192
S. Iwamuro et al. / General and Comparative Endocrinology 133 (2003) 189–198
2.0 105 M BPA solutions survived for 120 h, more than 75% of the embryos kept in 2.5–3.0 105 M BPA died. Embryos immersed in 104 M BPA did not survive even for 48 h. The survival rates, calculated on the basis of the number of embryos that survived for the initial 48 h as 100%, are shown in Table 2. From these results the median lethal dose, LD50 , of BPA was estimated to be 2.1 105 M. 3.2. Morphological abnormalities
Fig. 1. Semi-quantification of Xenopus TRb mRNA by RT-PCR. Conditions for RT-PCR were selected by changing the number of PCR cycles with 100 ng total RNA as template (A) and the initial amounts of total RNA at 30 cycles for PCR (B). The PCR products were separated by 2.0% agarose gel electrophoresis followed by staining with ethidium bromide. The fluorescence image from the gel was captured by a Kodak EDAS system equipped with a digital camera system. The values of arbitrary densitometric units (ADU) of each band were calculated based on standard DNA loaded in the same electrophoresis gel. Means of duplicate values were plotted.
immersed in these solutions surviving at 48, 96, and 120 h after fertilization are shown in Table 2. While most of the embryos (about 90%) in the control and 1.0–
The ratios of embryos treated with vehicle, 105 or 2.0 105 M BPA or 106 or 105 M E2 exhibiting scoliosis (winding vertebrate) and malformation of the head region (shortened distance between the eyes) are shown in Table 3. No apparent abnormalities were detected in the specimens immersed in 105 M BPA for 7 days. In the specimens kept in 2.5 105 M BPA, the abnormalities were mainly observed in dead ones, but a few of surviving specimens also exhibited these morphological abnormalities. Although several tadpoles in the 105 and 2.5 105 M BPA groups exhibited abnormalities during the first 6 days, they could finally recover from the malformation and initiated normal development. In 105 M E2 -treated groups, 40 of the 48 surviving specimens exhibited head malformation and 16 out of the 48 had curved vertebrate. Histological study of the animals that had been treated with relatively high concentration of BPA revealed malformations such as winding vertebrae, swollen head and shortening of the distance between the eyes. In addition, suppression of organogenesis of digestive and nervous systems was also prominent. Similar developmental defects occurred in the specimens treated with 105 M E2 (Fig. 2). 3.3. Inhibition of metamorphosis by BPA Stage 52 larvae kept in dechlorinated water or 107 M T4 for 21 days reached stage 56 or 62, respectively. BPA exhibited a suppressive effect on both spontaneous and T4 -induced metamorphosis. Larvae immersed in BPA for 21 days showed a retardation of metamorphosis by 1–2 stages as compared with control tadpoles
Table 2 Effect of various concentrations of bisphenol A (BPA) or 17b estadiol (E2 ) on the survival rate of Xenopus embryos and larvae Hours
Cont
10 48 96 120
51 (100) 46 (90) 45 (88)
E2 (M)
BPA (M) 5
71 (100) 70 (99) 70 (99)
5
5
5
5
2.0 10
2.5 10
3.0 10
5.0 10
10
78 (100) 76 (97) 70 (90)
50 (100) 11 (22) 11 (22)
89 (100) 13 (15) 10 (11)
2 0 0
0 0 0
4
106
105
61 (100) 57 (93) 57 (93)
57 (100) 54 (95) 52 (91)
Each groups consisting of approximately 60–100 embryos at stage 7 was kept in an incubation container. After 48 h, the number of surviving embryos or larvae was counted. The numbers in parentheses represent the ratio (%) of the surviving embryos or larvae to the number of embryos that survived for the initial 48 h. * P < 0:001 vs control.
S. Iwamuro et al. / General and Comparative Endocrinology 133 (2003) 189–198
193
Table 3 Malformations in Xenopus larvae caused by BPA and E2 BPA (M) Days
E2 (M)
Cont
105
2.5 105
106
105
5
S V E
46 1 (2.1) 0 (0)
70 2 (2.9) 2 (2.9)
11 6 (55) 3 (27)
57 1 (1.8) 0 (0)
54 20 (37) 44 (81)
6
S V E
45 1 (2.2) 0 (0)
70 1 (1.4) 2 (2.9)
11 3 (27) 3(27)
57 0 (0) 0 (0)
52 19 (37) 41 (79)
7
S V E
45 1 (2.2) 0 (0)
70 0 (0) 0 (0)
11 3 (27) 4 (15)
57 0 (0) 0 (0)
48 16 (33) 40 (83)
Embryos immersed in dechlorinated water (control), 1.0 105 or 2.5 105 M BPA, or 106 or 105 M E2 indicated in Table 2 were observed under a microscope after they reached larval stages, and the numbers of abnormal animals were counted. S, the number of animals that survived. V and E indicate the number of animals exhibiting crooked vertebrate and a shortened distance between the eyes, respectively. The numbers in parentheses represent % incidence of V or E. * P < 0:01 vs control. ** P < 0:001 vs control.
Fig. 2. Teratogenic effects of BPA and E2 on Xenopus embryo. The embryos survived through 72 h-immersion in water (A), 3.0 105 M BPA (D) and 105 M E2 (G) were photographed and then fixed in BouinÕs solution. Cross-sections of the heads (B,E,H) and abdomens (C,F,I) were made and stained with AzanÕs solution. g, gut; n, notochord; s, somite; sc, spinal cord. Scale bars (in A,D,G) are 1 mm, other bars are 200 lm.
kept in dechlorinated water for 21 days. Similarly, the larvae kept in the water containing T4 and BPA exhibited the retardation of metamorphosis by 2–4 stages as
compared with the T4 -treated larvae. In both cases the effect of BPA was concentration-dependent (Figs. 3 and 4).
194
S. Iwamuro et al. / General and Comparative Endocrinology 133 (2003) 189–198
Fig. 3. Representative profiles of tadpoles kept in water (Cont), T4 , BPA or combinations of T4 and BPA. Groups of 10–12 tadpoles at stage 52 (0 day) were used for each treatment. Tadpoles at typical stages in each treatment were photographed under a binocular microscope. The photos were scanned by a scanner, and the images were prepared for publication by using Adobe Photoshop software. Other details are described in Section 2. T4 , 107 M; B, 105 M BPA; 2.5 B, 2.5 105 M BPA; T4 + B, 107 M T4 + 105 M BPA; and T4 + 2.5 B, 107 M T4 + 2.5 105 M BPA.
When the tail segments from stage 52–54 larvae were cultured for 4 days in the presence of 107 M T3 , the length of the tail segments was reduced to approximately 55% of the initial length. The addition of 105 or 104 M BPA blocked the T3 -induced shortening of the tail, and this effect was concentration dependent. Tail segments cultured in the medium containing BPA alone or no additives (control) exhibited a slight but not significant change after 4 days in culture (Figs. 5 and 6).
elevated the level of TRb mRNA. In turn, BPA counteracted the T4 to reduce the T4 -induced elevation of the TRb mRNA expression. Similarly, BPA suppressed TRb mRNA expression, possibly by counteracting the endogenous thyroid hormones (Fig. 7). As shown in Fig. 8, 107 M T3 also exerted a marked upregulation of TRb gene expression and BPA suppressed the action of T3 in a dose-dependent manner. Interestingly, BPA alone reduced TRb gene expression almost completely.
3.4. Suppression of TRb mRNA expression by BPA
4. Discussion
Figs. 7 and 8 show the effect of BPA on the TRb mRNA expression. T4 at a concentration of 107 M
The results obtained by the present experiments clearly indicate that BPA at relatively high concentra-
S. Iwamuro et al. / General and Comparative Endocrinology 133 (2003) 189–198
195
Fig. 4. Dose- and time-dependent inhibition of spontaneous and the T4 -induced Xenopus tadpole metamorphosis by BPA. Each point and vertical bar in represent the mean and SEM. Tadpoles were staged according to Niewkoop and Faber (1967). The values with the same superscript do not differ significantly at the 5% level (DuncanÕs new multiple range test). Fig. 6. Changes in the length of tails cultured in T3 and/or BPA. The rate of tail regression in this figure was obtained from determination by daily measurements of the length. Each point and vertical bar represent the mean and SEM, respectively. The average length of tail segments at day 0 was 23 mm. The values with the same superscript do not differ significantly at the 5% level (DuncanÕs new multiple range test).
Fig. 5. Inhibitory-effect of BPA on T3 -induced regression of Xenopus tadpole tails in organ culture. Batches of 4 tails from stage 52–54 larvae were cultured in 6-well culture dishes with the additive being 107 M T3 or 105 or 104 M BPA or the 2 additives in different combinations. The tails were photographed 4 days after the start of culture Well A, control; well B, 107 M T3 ; well C, 104 M BPA; well D, 105 M BPA; well E, 107 M T3 + 104 M BPA; and well F, 107 M T3 + 105 M BPA.
tions affected both embryonic and larval development. In the embryo, BPA induced malformation, scoliosis and suppression of organogenesis in both digestive and nervous systems, causing embryonic death at higher concentrations. In larvae, BPA blocked not only spontaneous but also TH-induced metamorphosis both in vivo and in vitro. This is the first demonstration that BPA has an anti-thyroid hormone activity in amphibian larvae. The fact that BPA suppressed TRb mRNA expression that is known to be upregulated by TH (Iwamuro
and Tata, 1995) suggests that one of the BPA actions is exerted through the TH receptor. In fact, a very recent report by Moriyama et al. (2002) indicates that BPA (105 M) has a relatively weak binding activity to rat hepatic nuclear TRs with an inhibitory manner of binding of T3 . They also showed that BPA suppresses transcriptional activities mediated by TRs. Consistent with previous studies in birds (Berg et al., 2001), fishes (Honkanen et al., 2001; Pastva et al., 2001), and sponges (Hill et al., 2002), BPA induced morphological malformations and lethality in amphibian embryos. In the present experiment to assess the lethality of BPA, we immersed developing embryos in BPA solution without separating them from unfertilized eggs to avoid the elapse of time. Accordingly, we calculated the survival rate with respect to the number of embryos that survived the initial 48 h. According to our results, concentration of 2.0 105 M or less had no effect on the survival of embryos. Berg et al. (2001) reported the LD50 of BPA in quail and chicken embryos treated in ovo to range between 67 and 200 lg/g egg. In terms of molar concentrations, these values are comparable to 105 – 104 M, being in good agreement with those in Xenopus embryos. The lethal effect of BPA on a Xenopus cell line XTC-2 was also observed in the same concentration range (unpublished data). Previously, Nishimura et al. (1997) reported that in Xenopus embryos, pharmacological concentration (105 M) of E2 or diethylstilbesrol (DES), but not 17a-
196
S. Iwamuro et al. / General and Comparative Endocrinology 133 (2003) 189–198
Fig. 7. Effect of T4 and BPA on the steady-state levels of Xenopus TRb mRNA in various regions of Xenopus tadpoles treated for 22 days with 107 M T4 or 105 M or 2.5 105 M BPA separately or in combinations. At the end of this period, the tadpoles were separated into the head, trunk, and tail regions and pooled, and then total RNA was extracted from each pool. One hundred-nanogram of aliquots were subjected to the RT-PCR for semi-quantification of TRb mRNA and EF1a mRNA under the conditions established in Fig. 1 and according to Nishimura et al. (1997), respectively. The values of relative amounts of TRb in the figure are normalized with reference to the amount of EF1a. Each column represents the average value of duplicate determination. The figure shows the results 1 of the 2 independent experiments both of which gave identical results. C, control; B, 105 M BPA; 2.5 B, 2.5 105 M BPA; and T4 , 107 M T4 .
estradiol, 5a-dihydrotestosterone or progesterone, induced abnormalities and lethality similar to those observed in the present experiment. We confirmed that 105 M E2 affected the embryogenesis. In general, BPA is regarded to be 4–7 orders of magnitude less potent than E2 (Chun and Gorski, 2000; Krishnan et al., 1993). However, our results demonstrated that BPA at 2.5 times the effective concentration of E2 was sufficient to induce the teratogenesis and lethality. Recently, a number of test systems have proved the estrogenic activities of BPA acting through the ER, but not all of them could be attenuated by anti-estrogens (Papaconstantinou et al., 2001), suggesting the involvement of alternate pathways of BPA action that do not involve the ER but other NRs such as corticoid and androgen receptors, TRs, RARs, and RXRs. In fact, Shi and his co-leagues reported the relevance of TR and RXR gene expression to teratogenic effects (Puzianowska-Kunicka et al., 1997); and Minucci et al. (1996) also produced RXR selective ligand-induced malformations in Xenopus
Fig. 8. Effects of T3 and/or BPA on the gene expression of TRb. Total RNA was extracted from the pooled samples of the tail segments after 4 days in culture and 100 ng of the sample was amplified by the RTPCR. Other details are described in Fig. 7. The fluorescence image from electrophoresis gel was captured with a digital camera system and then visualized by using Adobe Photoshop software (inset). The bands on the lanes for 105 M and 104 M BPA were slightly detected by the digital camera but could not be regarded as signals by the EDAS system. The relative amounts of TRb were normalized with reference to the amount of ER1a in each sample. Each column represents the average value of duplicate determination. The figure shows the results of 1 of the 2 independent experiments, the other gave identical results. C, control; B, 105 M BPA; 10 B, 104 M BPA; and T3 , 107 M T3 .
embryos. It is noteworthy that concentrations of E2 and BPA in terms of inducing the lethality and teratogenecity were almost the same, ranging between 105 M and 104 M. Taking into consideration that the physiological dosage of E2 in vertebrates is 106 M or less, it would be difficult to conclude that the effects induced by E2 in Xenopus embryogenesis come from the authentic bioactivities of E2 itself. However, further analyses will be required to clarify whether the lethal and teratogenic effects of BPA and E2 are exerted through ER-dependent or ER-independent pathway. Xenopus tadpoles older than stage 52 seemed to be more resistant to the teratogenicity of BPA, because these animals treated with 2.5 105 M BPA showed neither apparent morphological abnormalities nor suppressed organogenesis of the digestive system when examined histologically (data not shown). Interestingly, when BPA-treatment was halted, these animals re-started metamorphosis normally and successfully developed into juvenile frogs. Such animals remained alive at least for 9 months (data not shown). The present experiments also demonstrated that BPA at concentrations similar to those that induced lethality and teratogenicity in Xenopus embryos blocked spontaneous and TH-inducible metamorphosis in Xenopus tadpoles. A similar result was obtained with the in vitro
S. Iwamuro et al. / General and Comparative Endocrinology 133 (2003) 189–198
experiment in which the tail segments were cultured in T3 and/or BPA. It is noteworthy that tissue-specific responsiveness to T4 was observed in the in vivo experiments. The head and trunk regions from 107 M T4 -treated tadpoles did not show the elevation of TRb mRNA, whereas the tail region subjected to the same concentration of T4 exhibited elevation of TRb mRNA expression to a level 1.7 times higher than the control one. Kawahara et al. (1999) reported that the profiles of TRb mRNA expression varied among organs such as brain, kidney, liver, hind limb, intestine, and tail. They demonstrated that the highest level of TRb mRNA was expressed at metamorphic climax (stage 62–64) in the tail, when the tail resorption occurred. The steady-state levels of TRb mRNA in the head and trunk regions were almost stable until stage 58. They also pointed out the stage- and organ-specific responsiveness of TRb gene expression to T3 and T4 . According to their results, the intestine and hind limbs of stage 54 Xenopus tadpoles responded to T4 immediately with elevation of their TRb mRNA levels, whereas the tail and liver did not respond to T4 during 3 days of treatment. Accordingly, the regional differences in responsiveness to T4 in terms of TRb mRNA expression as seen in our experiment may also be attributable to the difference in the metamorphic stages when examined. In our experiment, the tail responded to T4 to augment TRb mRNA, and BPA blocked this T4 induced elevation of TRb mRNA. Furthermore, BPA lowered the TRb mRNA levels in the tail presumably by counteracting endogenous TH. These results coincide with those obtained from the in vitro experiment. BPA suppressed, though partially, the elevation of T3 -induced TRb mRNA. Interestingly, however, even in the absence of T3 , BPA lowered TRb mRNA levels as compared with control tail segments cultured without T3 . This raises the possibility BPA can also act on the tail to diminish TRb mRNA expression without counteracting TH. In fact, in the in vivo experiment, we noticed that TRb mRNA levels in the head and trunk regions, which were not elevated by exogenous T4 , were lowered by BPA. It remains to be clarified whether BPA accelerates the degradation of TRb mRNA and/or suppresses mRNA synthesis occurring independently of T3 . Kloas et al. (1999) induced feminization of Xenopus by treating with a relatively low concentration (107 M) of BPA starting from stage 38–40 throughout metamorphosis. Interestingly, E2 levels during this period are much lower than those at embryonic stages, whereas E2 receptor mRNA levels in metamorphosing tadpoles are much higher than in embryos (Bogi et al., 2002). On the other hand, antimetamorphic effect of BPA became evident in metamorphosing tadpoles in which thyroid hormone titer (Leloup and Buscaglia, 1970) and thyroid hormone receptor mRNA levels (Yaoita and Brown, 1990; Yaoita et al., 1990) are elevating. These facts may
197
explain that moderate concentrations of BPA caused sexual differentiation while BPA could exert antimetamorphic effects only when relatively high concentrations of BPA were applied. Taken together, BPA may act as an antimetamorphic as well as an estrogenic agent in Xenopus larvae.
Acknowledgments We wish to thank Dr. Y. Habata and Miss M. Yamada of Toho University for their valuable advice and technical help during the course of experiment. Thanks are also extended to the members in our laboratory for the help in taking care of the animals.
References Berg, C., Halldin, K., Brunstrom, B., 2001. Effects of bisphenol A and tetrabromobisphenol A on sex organ development in quail and chicken embryos. Environ. Toxicol. Chem. 20, 2836–2840. Bergeron, R.M., Thompson, T.B., Leonard, L.S., Pluta, L., Gaido, K.W., 1999. Estrogenicity of bisphenol A in a human endometrial carcinoma cell line. Mol. Cell. Endocrinol. 150, 179–187. Bogi, C., Levy, G., Lutz, I., Kloas, W., 2002. Functional genomics and sexual differentiation in amphibians. Comp. Biochem. Biophys. B. 133, 559–570. Brotons, J.A., Olea-Serrano, M.F., Villalobos, M., Pedraza, V., Olea, N., 1995. Xenoestgogens released from lacquer coatings in food cans. Environ. Health Perspect. 103, 608–612. Chomczynski, P., Sacchi, N., 1987. Single-step of RNA isolation by acid guanidium thiocyanate–phenol–chlorofrom extraction. Anal. Chem. 162, 156–159. Chun, T.-Y., Gorski, J., 2000. High concentrations of bisphenol A induce cell growth and prolactin secretion in an estrogen-responsive pituitary tumor cell line. Toxicol. Appl. Pharmacol. 162, 161–165. Colerangle, J.B., Roy, D., 1997. Profound effects of the weak environmental estrogen-like chemical bisphenol A on the growth of the mammary gland of Noble rats. J. Steroid Biochem. Mol. Biol. 60, 153–160. Dodge, J.A., Glasebrook, A.L., Magee, D.E., Phillips, D.L., Sato, M., Short, L.L., Bryant, H.U., 1996. Environmental estrogens: effects on cholesterol lowering and bone in the ovariectomized rat. J. Steriod Biochem. Mol. Biol. 59, 155–161. Hill, M., Stavile, C., Steffen, L.K., Hill, A., 2002. Toxic effects of endocrine disrupters on freshwater sponges: common developmental abnormalities. Environ. Poll. 117, 295–300. Honkanen, J.O., Heinonen, J., Kukkonen, J.V.K., 2001. Toxicokinetics of waterborne bisphenol A in landlocked salmon (Salmo salar M. sebago) eggs at various temperatures. Environ. Toxicol. Chem. 20, 2296–2302. Iwamuro, S., Tata, J.R., 1995. Contrasting patterns of expression of thyroid hormone and retinoid X receptor genes during hormonal manipulation of Xenopus tadpole tail regression in culture. Mol. Cell. Endocrinol. 113, 235–243. Kawahara, A., Gohda, Y., Hikosaka, A., 1999. Role of type III iodothyronine 5-deiodinase gene expression in temporal regulation of Xenopus metamorphosis. Dev. Growth Differ. 41, 365–373. Kikuyama, S., Kawamura, K., Tanaka, S., Yamamoto, K., 1993. Aspects of amphibian metamorphosis: hormonal control. Int. Rev. Cytol. 145, 105–148.
198
S. Iwamuro et al. / General and Comparative Endocrinology 133 (2003) 189–198
Kloas, W., Lutz, I., Einspanier, R., 1999. Amphibians as a model to study endocrine disruptors: II. Estrogenic activity of environmental chemicals in vitro and in vivo. Sci. Total. Environ. 225, 59–68. Kumar, V., Gree, S., Stack, G., Berry, M., Jin, J.R., Chambon, P., 1987. Functional domains of the human estrogen receptor. Cell 51, 941–951. Krishnan, A.V., Stathis, P., Permuth, S.F., Tokes, L., Feldman, D., 1993. Bisphenol-A: an estrogenic substance is released from polycarbonate flasks during autoclaving. Endocrinology 132, 2279–2286. Leloup, J., Buscaglia, M., 1970. La triiodothyronine: hormone de la metamorphose des amphibiens. C. R. Acad. Sci. 284, 2261–2263. Lutz, I., Kloas, W., 1999. Amphibians as a model to study endocrine disruptors: I. Environmental pollution and estrogen receptor binding. Sci. Total Environ. 225, 49–57. Machuca, I., Esslemont, G., Fairclough, L., Tata, J.R., 1995. Analysis of structure and expression of the Xenopus thyroid hormone receptor-b gene to explain its autoinduction. Mol. Endocrinol. 9, 96–107. Mangelsdorf, D.J., Thummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P., Evans, R.M., 1995. The nuclear receptor superfamily: the second decade. Cell 83, 835–839. Marks, M.S., Hallenbeck, L., Nagata, T., Segars, J.H., Appella, E., Nikodem, V.M., Ozato, K., 1992. H-2RIIBP (RXR-bÞ heterodimerization provides a mechanism for combinatorial diversity in the regulation of retinoic acid and thyroid hormone responsive genes. EMBO J. 11, 1419–1432. McKinney, J.D., 1989. Multifunctional receptor model for dioxin and related compounds toxic action: possible thyroid hormone-responsive effector-linked site. Environ. Health Perspect. 82, 323–336. Milligan, S.R., Balasubramanian, A.V., Kalita, J.C., 1998. Relative potency of xenobiotic estrogens in an acute in vivo mammalian assay. Environ. Health Perspect 106, 23–26. Minucci, S., Saint-Jeannet, J.P., Toyama, R., Scita, G., DeLuca, L.M., Taira, M., Levins, A.A., Ozato, K., Dawid, I.B., 1996. Retinoid X receptor selective ligands produce malformations in Xenopus embryos. Proc. Natl. Acad. Sci. USA 93, 1803–1807. Moriyama, K., Tagami, T., Akamizu, T., Usui, T., Saijo, M., Kanamoto, N., Hayaya, Y., Shimatsu, A., Kuzuya, H., Nakao, K., 2002. Thyroid hormone action is disrupted by bisphenol A as an antagonist. J. Clin. Endocrinol. Metab. 87, 5185–5190. Mosconi, G., Carnevali, O., Franzoni, M.F., Cottone, E., Lutz, I., Kloas, W., Yamamoto, K., Kikuyama, S., Polzonetti-Magni, A.M., 2002. Environmental estrogens and reproductive biology in amphibians. Gen. Comp. Endocrinol. 126, 125–129. Mountfort, K.A., Kelly, J., Jickells, S.M., Castle, L., 1997. Investigations into the potential degradation of polycarbonate baby bottles during sterilization with consequent release of bisphenol A. Food Addit. Contam. 14, 737–740. Nau, H., Blaner, S. (Eds.), 1999. Retinoids; The Biochemical and Molecular Basis of Vitamin A and Retinoid Action. SpringerVerlag, Berlin. Niewkoop, P.D., Faber, J., 1967. Normal Table of Xenopus laevis (Daudin), second ed., North-Holland, Amsterdam. Nishimura, N., Fukazawa, Y., Uchiyama, H., Iguchi, T., 1997. Effects of estrogenic hormones on early development of Xenopus laevis. J. Exp. Zool. 278, 221–233.
Olea, N., Pulgar, T., Perez, P., Olea-Serrano, F., Rivas, A., NovilloFertell, A., Pedraza, V., Soto, A.M., Sonnenschein, C., 1996. Estrogenicity of resin-based composites and sealants used in dentisry, Environ. Health Perspect. 104 (1996) 298–305. Papaconstantinou, A.D., Umbreit, T.H., Fisher, B.R., Goering, P.L., Lappans, N.T., Brown, K.M., 2001. Bisphenol-A induced increase in uterine weight and alterations in uterine morphology in ovariectomized B6C3F1 mice: role of the estrogen receptor. Toxicol. Sci. 56, 332–339. Pastva, S.D., Villalobos, S.A., Kannan, K., Giesy, J.P., 2001. Morphological effects of bisphenol-A on the early life stages of medaka (Oryzias latipes). Chemosphere 45, 535–541. Puzianowska-Kunicka, M., Damjanovski, S., Shi, Y.-B., 1997. Both thyroid hormone and 9-cis retinoic acid receptors are required to efficiently mediate the effects of thyroid hormone on embryogenic development and specific gene regulation in Xenopus laevis. Mol. Cell. Biol. 17, 4738–4749. Rickenbacher, U., McKinney, J.D., Oatley, S.J., Blake, C.C.F., 1986. Structurally specific binding of halogenated bisphenols to thyroxin transport protein. J. Med. Chem. 29, 641–648. Shi, Y.-.B., 2000. Amphibian Metamorphosis from Morphology to Molecular Biology. Wiley-Liss, New York. Steinmetz, R., Brown, N.G., Allen, D.L., Bigsby, R.M., Ben-Jonathan, N., 1997. The environmental estrogen bisphenol A stimulates prolactin release in vitro and in vivo. Endocrinology 138, 1780– 1786. Steinmetz, R., Mitchner, N.A., Grant, A., Allen, D.L., Bigsby, R.M., Ben-Jonathan, N., 1998. The xenoestrogen bisphenol A induces growth, differentiation, and c-fos gene expression in the female reproductive tract. Endocrinology 139, 2741–2747. Tata, J.R., 1966. Requirement for RNA and protein synthesis for induced regression of the tadpole tail in organ culture. Dev. Biol. 13, 77–94. Tata, J.R., 1993. Gene expression during metamorphosis: an ideal model for post-embryonic development. BioEssays 15, 239–248. Tata, J.R., Baker, B.S., Machuca, I., Rabelo, E.M.L., Yamauchi, K., 1993. Autoinduction of nuclear receptor genes and its significance. J. Steroid Biochem. Mol. Biol. 46, 105–109. Ulisse, S., Iwamuro, S., Tata, J.R., 1997. Differential responses to ligands of overexpressed thyroid hormone and retinoid X receptors in a Xenopus cell line and in vivo. Mol. Cell. Endocrinol. 126, 17– 24. Yamamoto, T., Yasuhara, A., 1999. Quantities of bisphenol A leached from plastic waste samples. Chemosphere 38, 2569–2576. Yaoita, Y., Brown, D.D., 1990. A correlation of thyroid hormone receptor gene expression with amphibian metamorphosis. Genes Dev. 4, 1917–1924. Yaoita, Y., Shi, Y.B., Brown, D.D., 1990. Xenopus laevis a and b thyroid hormone receptors. Proc. Natl. Acad. Sci. USA 87, 7090–7094. Yu, Y.C., Delsert, C., Andersen, B., Holloway, J.M., Devary, O.V., Naar, M., Kim, S.Y., Boutin, Jo.M., Glass, C.K., Rosenfeld, M.G., 1991. RXRb: a coregulator that enhances binding of retinoic acid, thyroid hormone, and vitamin D receptors to their cognate response elements. Cell 67, 1251–1266. Zhang, X.K., Hoffman, B., Tran, P.B.V., Graupner, G., Pfahl, M., 1992. Retinoid X receptor is an auxiliary protein for thyroid hormone and retinoic acid receptors. Nature 355, 441–446.