Terminal Intron Dinucleotide Sequences Do Not Distinguish between U2- and U12-Dependent Introns

Molecular Cell, Vol. 1, 151–160, December, 1997, Copyright 1997 by Cell Press

Terminal Intron Dinucleotide Sequences Do Not Distinguish between U2- and U12-Dependent Introns Rosemary C. Dietrich, Robert Incorvaia, and Richard A. Padgett* Department of Molecular Biology Lerner Research Institute Cleveland Clinic Foundation Cleveland, Ohio 44195

Summary Two types of eukaryotic nuclear introns are known: the common U2-dependent class with /GU and AG/ terminal intron dinucleotides, and the rare U12-dependent class with /AU and AC/ termini. Here we show that the U12-dependent splicing system can splice introns with /GU and AG/ termini and that such introns occur naturally. Further, U2-dependent introns with /AU and AC/ termini also occur naturally and are evolutionarily conserved. Thus, the sequence of the terminal dinucleotides does not determine which spliceosomal system removes an intron. Rather, the four classes of introns described here can be sorted into two mechanistic classes (U2- or U12-dependent) by inspection of the complete set of conserved splice site sequences. Introduction Recent investigations have identified a novel eukaryotic nuclear spliceosome that is responsible for removing a small class of introns present in a wide variety of genes (Hall and Padgett, 1994, 1996; Tarn and Steitz, 1996a and 1996b; Kolossova and Padgett, 1997). This spliceosome resembles the major class spliceosome in many respects. Among them is the involvement of five snRNAs in its formation and function. Only the U5 snRNA is common to the two types of spliceosome (Tarn and Steitz, 1996a). The other snRNAs in this rare class of spliceosome are U11, U12, U4atac, and U6atac. The functional roles of these snRNAs appear to be analogous to the roles of the snRNAs of the major class spliceosome. U1 and U11 both interact with the respective 59 splice sites by base pairing, and U2 and U12 also both interact with the respective branch site sequences by base pairing. U4 and U6 exist as a base-paired complex, as do U4atac and U6atac. Within the spliceosome, U2 and U6 interact, as do U12 and U6atac. In fact, the core sequences that form this structure are very highly conserved between the two spliceosomes (Tarn and Steitz, 1996b). Since the interaction of U2 or U12 snRNA with its respective branch site sequences appears to be one of the early steps in committing an intron to being spliced by one type of spliceosome or the other, and since U12 was the first snRNA shown to be required for splicing of the rare intron class (Hall and Padgett, 1996; Tarn and Steitz, 1996a), we will refer to the two types of

* To whom correspondence should be addressed.

introns and their associated spliceosomes as U2-dependent or U12-dependent. This nomenclature, we believe, captures the mechanistic differences between the two types of spliceosomes better than nomenclature based on consensus sequence features of the small set of U12dependent introns so far identified. Splicing of both U2- and U12-dependent introns depends on the recognition by snRNAs and other factors of conserved sequence motifs present at and near the exon-intron junctions or splice sites. Shortly after the discovery of pre-mRNA splicing, it was observed that one of the distinctive features of eukaryotic nuclear premRNA introns is the high conservation of the dinucleotides at their 59 and 39 termini. Among naturally occurring introns, the majority begin with /GU and end with AG/. The most common exceptions to this rule are GC–AG introns and AU–AC introns (Jackson, 1991). We have shown that the known AU–AC introns form a distinct group with a set of characteristics that differ from those of most GU–AG introns (Hall and Padgett, 1994). Recently, more extensive compilations of these introns have supported the generality of these characteristics (Tarn and Steitz, 1997; Wu and Krainer, 1997). One of the apparent reasons for the strong conservation of terminal dinucleotides of introns is that the first and last nucleotides appear to interact either with each other or with a common factor that is sensitive to the identities of the two nucleotides. Mutagenesis of these two positions has shown that alteration of either position alone drastically reduces correct splicing, while specific combinations of first and last nucleotide double mutations will restore a detectable level of splicing (Parker and Siliciano, 1993; Chanfreau et al., 1994; Scadden and Smith, 1995; Luukkonen and Seraphin, 1997). One interpretation of these results is that some combinations of terminal nucleotides can form non–Watson–Crick base pairs that are similar to the pair formed by the two Gs at the wild-type splice junctions (Parker and Siliciano, 1993; Scadden and Smith, 1995), although this idea has been questioned more recently (Luukkonen and Seraphin, 1997). The two combinations of terminal dinucleotides that work best in these assays are AU–AC and AU–AA. There is also a case in mammalian cells of in vivo selection of a suppressor of a 59 terminal G-to-A mutation, which yielded an active intron by a second site 39 terminal G-to-A mutation generating an AU–AA intron (Carothers et al., 1993). While the apparent differences in the terminal nucleotides between the U12- and U2-dependent introns is one of the more striking distinctions, several other differences may be more important in determining which splicing pathway an intron will follow (Hall and Padgett, 1994). A major difference between the classes is the sequence of the 59 splice site downstream of the conserved dinucleotide. The U12-dependent class has an almost invariant 59 splice site of /AUAUCCUU, while the U2-dependent class has a shorter and much looser consensus of /GURAGU. Another major difference between the two classes is the lack of a polypyrimidine tract upstream of the 39 splice junction in the U12-

Molecular Cell 152

dependent class. This has been shown to be an important 39 splice site element in mammalian U2-dependent introns (Reed, 1989), and its absence in U12-dependent introns probably provides a major discriminating feature. Finally, in vivo analysis of mutations in the U12dependent branch site sequence has shown that base pairing to U12 snRNA is an important step in splice site selection (Hall and Padgett, 1996), whereas this interaction between U2 snRNA and U2-dependent intron branch sites appears to be less important (Padgett et al., 1985; Ruskin et al., 1985). The finding that U2-dependent introns can function with AU and AC termini and the knowledge that there are multiple features that distinguish the two intron classes in addition to the terminal sequences, led us to investigate whether U12-dependent introns could function with /GU and AG/ termini. We therefore mutated the first and last intron nucleotides of a U12-dependent intron to G and tested the resulting single and double mutants for correct splicing in vivo and in vitro and determined the type of spliceosome used in vitro. In addition, during searches for additional examples of U12-dependent introns, we found examples of introns with /AU and AC/ terminal dinucleotides but with all the other features of U2-dependent introns, as well as introns with /GU and AG/ termini that otherwise conform to the U12-dependent consensus. Representative introns of each class were tested to determine which spliceosomal system splices each type of intron.

Results A Mutant U12-Dependent Intron Can Splice with /GU and AG/ Terminal Dinucleotides Previous work has shown that intron F of the human nucleolar P120 gene is spliced in vivo and in vitro via the U12-dependent spliceosomal pathway (Hall and Padgett, 1996; Tarn and Steitz, 1996a and 1996b; Kolossova and Padgett, 1997). To determine whether this intron could function with /GU and AG/ terminal dinucleotides, the 59 terminal A residue was changed to G and the 39 C residue was changed to G in the four-exon minigene construct described previously (Hall and Padgett, 1996; Kolossova and Padgett, 1997). Expression constructs containing the individual mutations and the double mutation were transfected into CHO cells, and the pattern of spliced RNA products from the transfected mini-genes was determined using reverse transcription followed by polymerase chain reaction (PCR) amplification (Hall and Padgett, 1996). Figure 1A shows the pattern of spliced RNAs produced by the wild type and each of the mutated introns. To determine the splice sites used in each case, the individual bands were isolated and sequenced. The results of the sequencing are diagrammed in Figure 1B. These results show that the wild-type intron splices almost exclusively between the normal U12-dependent /AU and AC/ splice sites (Figure 1B, pattern 4). A very small amount of splicing (pattern 1) is also observed between a /GC 59 splice site located 13 nucleotides into the intron (113 site) and an AG/ 39 splice site located 6 nucleotides upstream of the AC/

Figure 1. Products of In Vivo Splicing of the Wild-Type and Mutant Human P120 Intron F (A) Spliced RNA products were detected by RT-PCR analysis. The various products are identified by number and keyed to the corresponding splicing patterns shown in (B). Lane 1 is the PCR product of the transvected DNA as a marker for unspliced RNA. The other lanes are products from cells transvected with wild type (AU-AC, lane 2), the A-to-G mutation at the 59 splice site (GU-AC, lane 3), the C-to-G mutation at the 39 splice site (AU-AG, lane 4), the double mutation (GU-AG, lane 5), and the double mutation plus the C to G mutation at position 5 of the 59 splice site (GU-AG1C5G, lane 6). (B) The various spliced products observed. The numbers refer to the bands shown in (A). Arrows, the locations of the normal U12dependent splice junctions; underlining, mutant positions; and bold, terminal nucleotides of the splice junctions used in each product. Some of the products could be due to splicing in frames alternate to those shown. The sites shown preserve the /XU and AX/ dinucleotide pattern and minimize the number of sites used for the various products.

39 splice site (-6 site). This minor product was previously observed in vitro, where it was shown to be U2-dependent (Tarn and Steitz, 1996a), and it is the major in vivo splicing product when the U12-dependent 59 splice site is mutated (Kolossova and Padgett, 1997). Mutation of the 59 splice site from /AU to /GU alters the splicing pattern in several ways. First, no splicing is observed to the AC/ 39 splice site. Instead, the /GU 59 splice site is joined to five different 39 splice sites. The major product is due to splicing to an AU/ 39 splice site at 12 (pattern 5). Four AG/ 39 splice sites are also used at 217, 26, 18, and 115 (patterns 2, 3, 6, and 7). Second,

Intron Termini and Spliceosome Site 153

use of the 113 cryptic 59 splice site is reduced, and all observed products use the mutant /GU 59 splice site. Mutation of the U12-dependent 39 splice junction from AC/ to AG/ allows for mostly correct splicing. However, two other products are also visible. The larger product corresponds to the 113 to 26 U2-dependent splice (pattern 1), while the smaller product results from splicing of the /AU 59 splice site to an AG/ 39 splice site at 18 (pattern 6). When both terminal intron nucleotides are mutated to G, the major change in the pattern of spliced products relative to the single 59 splice site mutation is to restore splicing to the normal 39 splice site position at the expense of the splice to the AU/ at 12. Use of the downstream AG/ 39 splice sites is also reduced, while the use of the upstream AG/ 39 splice sites is slightly increased. Note that for both the single 59 splice site mutant and the double mutant, all of the spliced products use the 59 splice site at the wild-type position; none uses the 59 splice site at 113. These results show that splicing can take place between several pairs of terminal dinucleotides, including AU–AC, AU–AG, GU–AU, and GU–AG. However, it is not clear from this in vivo analysis which of these spliced products are due to splicing via the U12-dependent or the U2-dependent spliceosomal pathway. This is a particular problem with respect to the GU–AG splices seen in the 59 splice site and double mutations. We therefore examined the splice site usage in RNA transcripts of each of these mutant introns in an in vitro splicing system where the two pathways can be distinguished by their sensitivities to blockage by specific anti-sense oligonucleotides. Figure 2A shows that the wild-type intron and all three mutant RNAs can splice in vitro under conditions where the U2-dependent spliceosomal pathway is blocked by the inclusion of an anti-U2 29-O-methyl oligonucleotide. Little or no splicing was observed in the presence of an anti-U12 oligonucleotide or in the presence of both the anti-U2 and anti-U12 oligonucleotides. The efficiency of the splicing of mutant introns is reduced relative to the wild type, and the double mutant intron is the least efficient. In addition, the lariat product seen in the 59 splice site A to G mutant (lane 5) migrates more slowly than the lariats produced by the other pre-mRNAs. To determine the sites of splicing used in each of these reactions, the region of the spliced exon product RNAs was excised from each lane of the gel, reverse transcribed, and amplified by PCR. Figure 2B compares Figure 2. In Vitro Splicing Patterns of P120 Intron Mutants (A) The P120 intron F wild type, A1G and C99G single mutant, and the A1G/C99G double mutant were transcribed, and the RNA was spliced in vitro in the presence of antisense 29-O-methyl oligonucleotides directed against either U2, U12 snRNAs, or both. The RNAs are diagrammed on the left and from top to bottom are precursor, spliced exon product, 59 exon intermediate, and lariat intron product. The band (*) between the spliced exons and the free 59 exon intermediate is a degradation product, which comigrates with the lariat intron 39 exon intermediate. Lanes 1–3, wild-type intron; lanes 4–6, A1G mutant intron; lanes 7–9, C99G mutant intron; lanes 10–12, A1G/C99G double mutant intron. Lanes 1, 3, 4, 6, 7, 9, 10, and 12 contained 2 mM anti-U12 oligo, while lanes 2, 3, 5, 6, 8, 9, 11, and 12 contained 8 mM anti-U2 oligo. Lanes 1, 4, 7, and 10 also contained

20 mM of a random sequence DNA oligo (AGCGGATAACAATTTCAC ACAGGAATATCCTT), which suppressed nonspecific degradation of the RNA. (B) Comparison of the in vivo and the U12-dependent in vitro splicing products. RNA was extracted from the spliced product region of the gel from reactions containing the anti-U2 oligonucleotide, reverse transcribed, and amplified by PCR. The in vitro spliced products of the wild type and the three mutants were run next to the analogous in vivo spliced products. The numbering of the spliced products follows that used in Figure 1. (C) Comparison of the in vivo and the U2-dependent in vitro splicing products. Analysis was as in Figure 2B but using RNA from in vitro reactions containing the anti-U12 oligonucleotide.

Molecular Cell 154

Figure 3. Splice Site Sequences of Putative U12-Dependent Introns The distance listed in the right column of each entry is the number of nucleotides from the presumptive branch site adenosine residue to the 39 splice junction. Sequences are from the following: human SCN4A (George et al., 1993); human SCN5A (Wang, et al., 1996); human and mouse SCN8A (Kohrman et al., 1996); human CACNL1A4 (Ophoff et al., 1996); human CACNL1A1 (Soldatov, 1994); human CACNL1A2 (Yamada et al., 1995); human CACNL1A3 (Hogan et al., 1996); human Sm E protein (Stanford et al., 1988); human ADPRP (Auer et al., 1989 and this work); human c-raf-1 (Bonner et al., 1985).

the products of in vitro splicing reactions in the presence of the anti-U2 oligonucleotide with the in vivo products, while Figure 2C compares the products of in vitro splicing in the presence of the anti-U12 oligonucleotide to the in vivo products. The numbering system for the various products is the same as that in Figure 1B. The comparisons show that the 39 splice sites used under the two conditions differ in that the normal 39 splice site and the sites downstream from it are used by the U12-dependent system, while the 39 splice sites upstream of the normal site are used by the U2-dependent system (except for the 217 site; see below). In addition, the cryptic /GC 113 59 splice site is used only by the U2-dependent system, while the normal /AU 59 splice site is used only by the U12-dependent system. The mutant /GU 59 splice site, in contrast, is used by both systems but with mostly nonoverlapping sets of 39 splice sites. Thus, in Figure 1, splice patterns 1 and 3 are U2 dependent, while splice patterns 4, 5, 6, and 7 are U12 dependent. No spliced products were observed in reactions containing both the anti-U2 and anti-U12 oligonucleotides (data not shown). Splice pattern 2, which uses the 39 splice site at 217, is an exception in that it appears to be used by both the U12- and U2-dependent systems. Inspection of the sequence upstream of the 39 splice site reveals a putative U12-dependent branch site with the sequence GCC TTAGG, which matches the consensus (TCCTTAAC) in the central five positions. This cryptic 39 splice site is not used in the wild-type gene because it has an AG/ 39 splice junction. However, when the 59 splice site is changed to /GU, it is apparently recognized weakly by the U12-dependent system. It is also used by the U2dependent system when the 59 splice site is moved upstream from the cryptic site at 113, probably because of size limitations on the resulting intron (82 versus 69 nucleotides). Thus, we may conclude that both 59 and 39 splice sites can be found that use both the U2- and the U12-dependent splicing systems, at least when they have /GU and AG/ terminal dinucleotides. Two Mutations Are Sufficient to Convert a U12-Dependent 59 Splice Site to a U2-Dependent 59 Splice Site To address these issues further in the in vivo context, an additional mutation of the 59 splice site sequence

was introduced in the double mutant to try to make it specific for the U2-dependent spliceosomal system. Previous work has shown that mutations in the U12dependent 59 splice site at positions 4–7 can block usage of the splice site in vivo and lead to the activation of the U2-dependent cryptic splice sites (Kolossova and Padgett, 1997). In addition, other work has shown that position 5 of the U2-dependent 59 splice site, usually a G, is involved in an important base-pairing interaction with U6 snRNA (Kandels-Lewis and Seraphin, 1993; Lesser and Guthrie, 1993). Thus, an additional mutation of the C at position 5 of the U12-dependent 59 splice site to a G might be expected to block U12-dependent splicing and activate U2-dependent splicing at that 59 splice site. The pattern of in vivo splicing of this triple mutation is shown in Figure 1, lane 6. Splicing is observed only between the mutant 59 splice site and the 26 and 217 upstream AG/ dinucleotides. No splicing is seen to the normal U12-dependent 39 splice site. Also, no products that use the cryptic U2-dependent 59 splice site are seen. In addition, this triple mutation strongly activates a skipped splice between the mutant 59 splice site in intron F and the wild-type U2-dependent 39 splice site of intron G (not shown). These results strongly suggest that these mutations have converted the U12dependent intron F 59 splice site to a largely or exclusively U2-dependent 59 splice site. This U2-dependent spliceosome uses only the upstream AG/ 39 splice sites but not the AG/ at the wild-type position or any of the downstream 39 splice sites, in agreement with the in vitro data. U12-Dependent Introns with /GU and AG/ Terminal Dinucleotides Occur Naturally The above demonstration that the U12-dependent spliceosome can correctly splice introns with /GU and AG/ terminal dinucleotides suggested that such introns may occur naturally. This possibility was reinforced by the sequences of a set of homologous introns in the two related families of voltage-gated sodium and calcium channel a-subunit genes. As shown in Figure 3, the sodium channel genes (SCN_A) each contain an intron near their 59 ends that matches the consensus sequences for the U12-dependent class. One of these has

Intron Termini and Spliceosome Site 155

also been shown to be a member of this class in vitro (Wu and Krainer, 1996). All of these introns have /AU and AC/ termini. Of the four sequenced calcium channel genes that have introns in homologous positions, the CACNL1A4 intron has /AU and AC/ termini and the CACNL1A1 intron has /AU and AG/ termini, whereas the CACNL1A2 and CACNL1A3 introns have /GU and AG/ termini. Nevertheless, at all other positions these splice sites conform closely to the U12-dependent consensus sequences. While these differences in the terminal dinucleotides could be the result of sequencing errors as suggested (Wu and Krainer, 1997), they also could represent natural examples of the mutants studied above. To determine if other apparent U12-dependent introns with /GU and AG/ terminal dinucleotides occur outside of the sodium and calcium channel families, a database of 1799 nonredundant human splice sites (Stephens and Schneider, 1992) was searched for occurrences of 59 splice sites with the sequence /GUAUCCUU. Three such 59 splice sites were found and are listed in Figure 3. All three introns had an AG/ dinucleotide at the 39 splice site. Of these introns, the one in the Sm E protein gene was listed in its entirety in GenBank and inspection revealed a sequence that matched the U12-dependent branch site at seven of eight positions. The other two introns were not listed as complete sequences. The c-raf-1 intron matched the U12-dependent consensus sequences in all positions known, while the ADP ribose polymerase (ADPRP) intron had too little sequence in GenBank to assess its branch site region. To resolve this problem, we amplified by PCR the region containing the ADPRP intron from human genomic DNA and determined its sequence. As shown in Figure 3, the sequence of this intron matched the U12-dependent intron class consensus sequences with the exception of the first and last nucleotides. In each of the introns listed in Figure 3, the putative branch site was within the conserved distance from the 39 splice site observed in other members of the U12-dependent intron class. Thus, from a sequence standpoint, it would appear that these introns represent additional examples of U12-dependent introns with /GU and AG/ terminal dinucleotides, showing that this class of introns exists in genes beyond the cation channel a-subunits. The above sequence comparison indicated that these introns, like the double mutant of the P120 intron, should be spliced by the U12-dependent mechanism. To confirm this idea, the snRNA requirements for in vitro splicing of the ADPRP intron were investigated. For these experiments, a fragment of the human ADPRP gene containing this intron was amplified from genomic DNA, transcribed into RNA, and spliced in vitro. The transcribed portion contained the intron and parts of the flanking exons. The 59 and 39 splice sites from the adjacent introns were excluded to avoid effects due to small nuclear ribonucleoprotein (snRNP) binding to nearby sites (Wu and Krainer, 1996). Figure 4A shows that incubation of the ADPRP premRNA in HeLa cell nuclear extract yielded the expected products of splicing, including the excised lariat intron, the ligated exons, and the first exon intermediate. The formation of all these products was ATP dependent. Correct splicing was confirmed by reverse transcription

(RT)–PCR amplification and sequencing of the spliced exon product (data not shown). The snRNA requirements for the splicing reaction were investigated by preincubating the extract in the presence of anti-sense 29-O-methyl oligonucleotides directed against various snRNAs. As was previously observed with the U12dependent P120 intron, oligonucleotides against U1 and U2 snRNAs actually stimulated the level of splicing in the extract (Tarn and Steitz, 1996a). For this reason, the effects of the addition of other antisense oligonucleotides were assayed in the presence of the anti-U2 oligonucleotide. Addition of an anti-U6 oligonucleotide to the anti-U2 stimulated reaction had no effect (lane 5), while addition of either anti-U6atac (lane 6) or anti-U12 (lane 7) oligonucleotides blocked splicing completely. Thus, in vitro splicing of this intron requires the functions of U12 and U6atac snRNAs but not of U1, U2, or U6 snRNAs, confirming that the ADPRP intron is a U12dependent intron. Four other snRNAs, U5, U4, U4atac, and U11, are known to be involved in splicing but were not assayed in the above experiment. U5 snRNA appears to be used by both spliceosomes (Tarn and Steitz, 1996a) so that inhibition of its function would not discriminate between the two splicing systems. U4 and U4atac appear to function by helping to deliver U6 and U6atac, respectively, to the spliceosome as U4/U6 or U4atac/U6atac complexes, which preexist in the in vitro extract. Thus, addition of anti-sense oligonucleotides against U4 or U4atac would likely have little or no effect on in vitro splicing (Tarn and Steitz, 1996b). U11 function is not inhibited by 29-O-methyl anti-sense oligonucleotides (Tarn and Steitz, 1996a). To demonstrate that the anti-sense oligonucleotides were capable of blocking the function of the various snRNAs, control experiments using the U2-dependent intron from the adenovirus major late transcript and the U12-dependent P120 intron F were performed. Figure 4B shows the response of the U2-dependent splicing system to the same levels of antisense oligonucleotides used in Figure 4A. Addition of anti-U1, U2, or U6 oligonucleotides blocked splicing completely, while addition of anti-U12 or U6atac oligonucleotides had no effect. Figure 4C shows that the U12-dependent splicing system responded in the opposite manner: anti-U2 or U1 oligonucleotides stimulated the splicing reaction; anti-U6 had little effect; and anti-U12 or anti-U6atac oligonucleotides blocked splicing.

Naturally Occurring U2-Dependent Introns with /AU and AC/ Terminal Dinucleotides During these investigations, we noted that each of the two sodium channel genes described above had another unusual intron at homologous positions toward the 39 end of the genes. These introns had /AU and AC/ termini but lacked the other features of the U12dependent intron class. This characteristic has also been noted by others (Wu and Krainer, 1996, 1997). The first two entries in Figure 5 show the splice site sequences for these two sodium channel introns. Comparison of these sequences with the consensus U2and U12-dependent intron classes shows that, with the

Molecular Cell 156

Figure 4. Effect of 29-O-Methyl Antisense Oligonucleotides against U snRNAs on In Vitro Splicing of U2- and U12-Dependent Introns (A) In vitro splicing of the human ADPRP intron 22. ATP and creatine phosphate were omitted from the reaction in lane 1 and included in all the others. Splicing reactions were preincubated with no oligonucleotide (lanes 1 and 2), 20 mM anti-U1 (lane 3), 8 mM anti-U2 (lane 4), 8 mM anti-U2 plus 10 mM anti-U6 (lane 5), 8 mM anti-U2 plus 5 mM antiU6atac (lane 6), or 8 mM anti-U2 plus 2 mM anti-U12 (lane 7) oligonucleotides for 10 min, followed by addition of 32P-labeled RNA substrate for 3 hr at 308C. The size markers in lane 8 are φ174 replication form (RF) DNA digested with HaeIII. The RNAs are diagrammed on the left, and from top to bottom are lariat intron product, precursor, spliced exon product, and 59 exon intermediate. The multiple spliced exon bands are due to 39 heterogeneity since only a single product was obtained after reverse transcription and PCR amplification (data not shown). (B) In vitro splicing of the U2-dependent adenovirus substrate RNA. Splicing reactions were preincubated with either no oligonucleotide (lane 2), 20 mM anti-U1 (lane 3), 8 mM anti-U2 (lane 4), 10 mM anti-U6 (lane 5), 5 mM anti-U6atac (lane 6), or 2mM anti-U12 (lane 7) oligonucleotides for 10 min followed by addition of 32P-labeled RNA substrate for 1 hr at 308C. The positions of the various RNAs are indicated as in (A). Lane 1, RNA markers in nucleotides (Ambion). (C) In vitro splicing of the U12-dependent P120 intron F substrate RNA. Splicing reactions were preincubated with no oligonucleotide (lane 1), 0.5 mM (lane 2), 2 mM (lane 3), or 8 mM (lane 4) anti-U2 oligonucleotide, or with 20 mM anti-U1 oligonucleotide (lane 5). Lanes 6–10 all contained anti-U2 oligonucleotide at a concentration of 8 mM as well as 10 mM anti-U6 oligonucleotide (lane 6), 0.5 mM (lane 7), 2 mM (lane 8), or 5 mM (lane 9) antiU6atac oligonucleotide, or 2 mM anti-U12 oligonucleotide (lane 10). Oligonucleotides were preincubated with extract and ATP for 10 min at 308C followed by addition of 32P-labeled RNA substrate for 3 hr at 308C. The positions of the various RNAs are indicated as in (A).

exception of the terminal nucleotides, there is a good match to the U2-dependent consensus, while only the terminal dinucleotides match the U12-dependent consensus. In addition, there is no match in these introns to the highly conserved branch site sequence of the U12-dependent intron class. In light of the findings reported above, that either AU–AC or GU–AG terminal

dinucleotides are functional for U12-dependent introns, and the earlier reports that mutated U2-dependent introns could function with AU–AC termini, we wished to determine which system was responsible for splicing the introns shown in Figure 5. For these experiments, a fragment of the human SCN4A gene containing intron 21 was amplified from a genomic clone, and pre-mRNA Figure 5. Splice Site Sequences of Introns Homologous to Human SCN4A Intron 21 Genomic clones containing the introns shown were generated and sequenced as described in Experimental Procedures. Consensus sequences of U2-dependent (Senapathy et al., 1990) and U12-dependent (Hall and Padgett, 1994) introns are shown (Y, pyrimidine).

Intron Termini and Spliceosome Site 157

or U6atac function, consistent with splicing by the U2dependent pathway. These results are similar to those obtained with the same intron using the technique of oligonucleotide mediated RNase H cleavage of snRNAs (Wu and Krainer, 1997).

Figure 6. Effect of 29-O-Methyl Antisense Oligonucleotides on In Vitro Splicing of the SCN4A Intron 21 Substrate RNA Splicing reactions were preincubated with no oligonucleotide (lane 1), 20 mM anti-U1 (lane 2), 8 mM anti-U2 (lane 3), 10 mM anti-U6 (lane 4), 5 mM anti-U6atac (lane 5), or with 2 mM anti-U12 (lane 6) oligonucleotides for 10 min, followed by addition of 32P-labeled RNA substrate for 3 hr at 308C. The positions of the various RNAs are indicated as in Figure 4.

was transcribed from this fragment and spliced in vitro. The transcribed portion contained the intron and parts of the flanking exons. The 59 and 39 splice sites of the adjacent introns were excluded to avoid effects due to snRNP binding to nearby sites (Wu and Krainer, 1996). The results of in vitro splicing of this RNA are shown in Figure 6. Splicing of this RNA is inefficient, owing either to a lack of the normal cis-acting signals, including the adjacent splice sites, or to an intrinsically low efficiency of splicing introns with other than G residues at the 59 and 39 splice junctions. Nevertheless, clear signals are seen for the presumed lariat intermediate and lariat intron product, the 59 exon intermediate RNA, and a small amount of spliced exon product. The nature of the presumed lariat RNAs was investigated by excising the RNAs, debranching them, and rerunning them against DNA size standards. The results showed that the debranched RNAs now migrated faster than the untreated RNA at positions consistent with the lengths of the intron plus second exon and the intron alone (data not shown). To demonstrate that splicing was taking place at the presumed splice sites, the spliced exon RNA was eluted, reverse transcribed, amplified by PCR, and sequenced. The sequence of the spliced RNA matched the published cDNA sequence covering this region (data not shown). Thus we conclude that the observed RNAs are the products of authentic splicing. To determine which splicing pathway was active on this RNA in vitro, the function of various snRNAs was inhibited by the addition of anti-sense 29-O-methyl oligonucleotides as described above. The results show that splicing of this intron requires U1, U2, and U6 snRNA function in vitro and is not affected by blockage of U12

U2-Dependent Introns with /AU and AC/ Terminal Dinucleotides Are Evolutionarily Conserved The two homologous human sodium channel introns described above are the only examples known to us of naturally occurring U2-dependent introns with /AU and AC/ termini. The fact that this rare intron type was conserved in two members of this gene family, which are expressed in different tissues (skeletal muscle and cardiac muscle for SCN4A and SCN5A, respectively) and have been diverged for some time, led us to investigate the evolutionary conservation of this feature. First, the related calcium channel a-subunit genes discussed above have no other AU–AC introns. Therefore, this feature either appeared after the divergence of these two gene families or was lost in the calcium channel lineage. Within the sodium channel gene family, we examined two homologous introns from the puffer fish Fugu rubripes and one from the sea slug Aplysia californica (Figure 5). Both introns from F. rubripes, but not the intron from A. californica, have /AU and AC/ termini. Thus, this feature has been conserved over the 400 million years since the divergence of mammals and puffer fish but not over the 600 million years of separate evolution of the vertebrate and molluscan genes. Possible reasons for the stability of this rare intron type are discussed below. Discussion Both U12- and U2-Dependent Spliceosomes Can Use GU-AG and AU-AC Splice Sites The most conserved elements of splice sites are the terminal dinucleotides, usually /GU at the 59 splice junction and AG/ at the 39 splice junction. Mutations of these sequences typically inactivate the affected site leading to cryptic splice site activation or exon skipping. In a systematic investigation of mutations at the first and last intron nucleotides, it was found that the defective phenotype of some mutations at one site could be alleviated by specific mutations at the other site (Parker and Siliciano, 1993). This led to the idea that the terminal nucleotides of introns interact directly via non–Watson– Crick base pairing. Subsequent work has largely supported this notion (Scadden and Smith, 1995), although it has been argued that the data do not support a direct interaction (Luukkonen and Seraphin, 1997). In these studies, the pairs of terminal dinucleotides that best restored correct splicing were AU–AC and AU–AA. Interestingly, these pairs are the same as the terminal dinucleotides used by the U12-dependent minor class of introns. It was therefore of interest to determine if a similar direct or indirect interaction between the terminal nucleotides of U12-dependent introns could be identified by mutual suppression of single mutations. The results presented here show that the U12-dependent spliceosomal mechanism can accommodate several other pairs of terminal dinucleotides in addition to

Molecular Cell 158

the originally identified AU–AC pair. These include AU– AG, GU–AU, and GU–AG. These pairs of sites were used both in vivo and in vitro. The evidence that these splice sites were used by the U12-dependent system is that the splice sites were used in vitro under conditions where the U2-dependent pathway was inactivated by antisense oligonucleotide addition, but they were not used when the U12-dependent pathway was similarly blocked (Figure 2). In vivo usage of the U12-dependent 39 splice sites was eliminated when the 59 splice site was further mutated toward the U2-dependent consensus. It is worth noting that the single mutation of the 59 splice site terminal dinucleotide from /AU to GU/ created a 59 splice site, which was recognized by both the U2- and U12-dependent systems, and that this mutation activated a cryptic AG/ 39 splice site that could be used by either the U2- or the U12-dependent system. These results raised the question of whether a class of U12-dependent introns with other than /AU and AC/ terminal dinucleotides might exist. Evidence that it might came from the sequences of homologous introns from the voltage-gated sodium and calcium channel a-subunit genes, where several calcium channel genes appeared to have either AU–AG or GU–AG termini while matching the U12-dependent consensus in all other positions. A search of a database of human splice sites revealed another three examples of such introns. In vitro analysis of the intron from the human ADP-ribose polymerase gene showed that it is indeed a U12-dependent intron. These results establish the existence of a previously unrecognized class of introns that have “normal” /GU and AG/ terminal dinucleotides yet are spliced by the U12-dependent mechanism. Yet another class of introns was found, coincidentally, in members of the sodium channel a-subunit gene family. In this case, the introns had /AU and AC/ terminal dinucleotides, yet resembled U2-dependent introns rather than U12-dependent introns. Specifically, they lacked the rest of the highly conserved 59 splice site sequence and the conserved branch site sequence. In vitro splicing of one of these introns showed that it was indeed a U2-dependent intron. This result was also recently reported elsewhere (Wu and Krainer, 1997). These results combine to show that the terminal dinucleotide sequences of an intron, a feature that has previously been used to distinguish the U2- and U12-dependent classes of introns, do not specify which system will splice an intron. Indeed, the frequency with which the GU–AG class of U12-dependent introns occurred in the small splice site database (3 of 1799 or about 1 of 600) is substantially greater than the frequency of AU–AC U12-dependent introns (1 of 5,000– 10,000). Thus, it may develop that the GU–AG type will outnumber the AU–AC type of U12-dependent introns. Two other types of U12-dependent introns with AU–AG (Soldatov, 1994) or AU–AA (Wu et al., 1996) termini have also been observed and appear to represent even rarer subtypes. The point that this work brings out is that the pathway by which an intron is spliced is not determined by the terminal dinucleotides of the intron but rather by the complete set of splice site sequences. Several lines of evidence suggest that U2- and U12-dependent splice

sites cannot cooperate (i.e., there are no mixed introns with one class of 59 splice site splicing to the other class 39 splice site). Thus, to categorize the splicing pathway of a newly discovered AU–AC intron, a comparison should be made to the consensus sequences of the two classes. The most diagnostic feature appears to be the sequence of the 59 splice site. In U12-dependent introns, this sequence is almost always AUAUCCUU in plants as well as in animals. A second, almost as conserved feature is the branch site sequence UCCUUAAC situated close to the 39 splice junction. It is these features that determine whether the intron is removed by the U2 or U12 pathway. The identities of the first and last nucleotides are probably important for the proper contacts for the splicing reaction itself, rather than for interactions with the snRNPs in the early phases of the reaction.

The Intron Structure Is Evolutionarily Stable The examples of U2-dependent AU-AC introns discussed here occur in members of a multigene family in species that have been separate for approximately 400 million years; thus, this feature is evolutionarily stable. This stability may be a testament to the difficulty of mutating back to the GU-AG consensus while maintaining the protein sequence or reading frame. It is worth noting that the protein sequence of this part of the sodium channel gene family is highly conserved so that addition, deletion, or alteration of the amino acids at the splice junction might be highly deleterious. Simultaneous mutation of both terminal residues to Gs would be a very low-frequency event. The fact that these same genes also contain a single example of a U12-dependent AU-AC intron is probably coincidental, given that the introns are at opposite ends of the genes. A more speculative idea for the existence of two distinct types of U2-dependent introns is that they may function in some form of alternative splicing. Since the splice sites must function in pairs (i.e., /GU will splice to AG/ but not to AC/, and /AU will splice to AC/ but not to AG/), this would preclude the formation of certain combinations of alternative exons. This mechanism could be exploited to allow a restricted set of combinatorial possibilities among a set of alternative exons. An equally striking conservation of intron type is seen in the U12-dependent introns found in both the sodium and calcium channel genes. The small number of changes needed to alter the spliceosomal specificity of introns suggests that this conservation should be relatively common. Indeed, this may explain to some extent why the U12-dependent class is so rare (i.e., only a few changes convert a U12-dependent to a U2dependent intron, while many more changes would be needed to convert the other way). We may be seeing such a process occurring in the calcium gene family with the change of the terminal dinucleotides to /GU and AG/. It is possible that other family members that have completed the change to U2-dependence may be found. These might be recognized by further changes in the conserved 59 splice site and branch site sequences. Alternatively, there may be an as yet unrecognized functional reasons for maintaining these introns as U12dependent.

Intron Termini and Spliceosome Site 159

Could There Be Other Minor Spliceosomes? One of the most striking features of the original set of U12-dependent intron splice sites was the use of noncanonical terminal dinucleotides. Indeed, it was this feature that led both Jackson (1991) and us (Hall and Padgett, 1994) to compare the known examples of AUAC introns and to note that other features were also conserved. As we show here, however, the /AU and AC/ terminal dinucleotides are not the defining feature of U12-dependent introns and may be more the exception than the rule. It may be speculated whether other types of introns might exist with standard GU-AG termini yet not use either the U2- or U12-dependent splicing mechanisms. There are certainly many known splice sites that are poor matches to the U2-dependent consensus sequences. To our knowledge, no systematic effort has been made to organize and compare them to determine whether some fall into clear groups with similar sequence elements. After all, without the AU-AC subclass of U12-dependent introns, it is doubtful that the GUAG subclass would have been recognized as a distinct family. Experimental Procedures DNA Constructs Mutations of the human P120 intron F were constructed, as previously described, using mutagenic PCR primers (Kolossova and Padgett, 1997). The mutations were introduced into a four-exon construct containing exons 5–8 and introns E through G of the P120 gene in the pCB6 expression vector. The human SCN4A intron 21 and flanking exons (George et al., 1993) was amplified from a l clone containing this region of the gene (George et al., 1993) using the primers GCCGCAGTACGAGGT GAACC and TCTGTTCCTCCGTCATAAAGATGTC. The human SCN5A intron 25 and flanking exons (Wang et al., 1996) was amplified from genomic DNA using the primers CACCCTGAACCTCTTTATTGGT GTC and CCAGCTTCTTCATGGCATTGTAG. The region of the ADPRP gene surrounding intron 22 was amplified from human genomic DNA using the primers CGCGGTACCAAAACTACCCCTGATC and GCGGATCCCGGCTACCTCTCCCAATTAC. The amplification products were cloned into the vector pCR-Script SK1 (Stratagene), following the supplier’s protocol, and sequenced. One of the F. rubripes (GenBank accession number D37977) and the A. californica (Dyer et al., 1997) (GenBank accession number U66915) sodium channel genes were identified in GenBank, and primers were synthesized to amplify the regions homologous to the location of the human SCN4A intron 21 (George, et al., 1993) (F. rubripes primers CATCATATTTGGCTCCTTCTTCACCCCTC and GGTCGGGGAATAGGTTTCTGAGGC; A. californica primers CACTC TCAACCTCTTCATTGGTGTC and GGACTGCATTCGTTTCATGGC). Genomic DNA from F. rubripes or A. californica was then amplified by PCR, and bands larger than the calculated size of the cDNA were isolated from agarose gels, cloned, and sequenced. In most cases, only a single DNA species was amplified consistently over a range of buffer and temperature conditions. The homologous intron region of the other F. rubripes sodium channel gene was identified by searching the F. rubripes genome project database (U. K. Human Genome Mapping Project Resource Center). A cosmid (010M03) was identified that contained part of a sodium channel homolog. A sequenced fragment from this cosmid contained the 39 portion of an intron and an exon that was homologous to the human SCN4A exon 22. To obtain the sequences of the 59 part of this intron and the upstream exon, two reverse PCR primers were designed: one from the downstream exon (GGTCTGGGGATAG GCTTCTGGGGT), and one from the known portion of the intron (AAGCCATCCCATTTGCCTCAGC). A low-stringency amplification was then carried out with the F. rubripes cosmid as a template, using the reverse downstream exon primer and the forward primer

for human SCN5A exon 25. One microliter of this reaction was used as a template for another PCR reaction, using the same forward primer and the reverse intron primer. This reaction yielded a single DNA species, which was isolated and sequenced. The sequence of the intron portion of this band matched the known sequence of the intron determined from the cosmid, while the upstream exon sequence was homologous to the human SCN4A exon 21. These features support the conclusion that the isolated fragment represents a homolog of the human SCN4A intron 21 region. In Vivo Analysis of Splicing CHO cells were transfected with the P120 constructs, and RNA was prepared after 48 hr as described (Hall and Padgett, 1996; Kolossova and Padgett, 1997), with the exception that 1 mg of expression plasmid DNA plus 9 mg of pUC19 carrier DNA per plate were used. The splicing pattern of the P120 intron was followed using RT-PCR as described (Hall and Padgett, 1996; Kolossova and Padgett, 1997), except that the primer in exon 7 was labeled at its 59 end with 32 P, and the products were analyzed by electrophoresis in a 6% polyacrylamide gel containing 7 M urea and 40% formamide. 29-O-Methyl Antisense Oligonucleotides All oligonucleotides were purchased from Cruachem and were purified by preparative reverse-phase high-performance liquid chromatography (HPLC). The anti-U1 oligonucleotide was complementary to U1 nucleotides 1–15; the anti-U2 oligonucleotide was complementary to U2 nucleotides 27–49; the anti-U6 oligonucleotide was complementary to U6 nucleotides 27–46; the anti-U12 oligonucleotide was complementary to U12 nucleotides 11–28; and the antiU6atac oligonucleotide was complementary to U6atac nucleotides 1–20. In Vitro Splicing Reactions The in vitro splicing reactions contained 40% HeLa cell nuclear extract prepared as described (Zerivitz and Akusjarvi, 1989); 1.5 mM ATP, 5 mM creatine phosphate and MgCl2 at a final concentration of 0.6 mM (adeno and ADPRP substrates), 2.6 mM (P120 substrate), or 3.6 mM (SCN4A substrate); and 29-O-methyl antisense oligonucleotides at the concentrations indicated. Reactions were assembled on ice with all components except the substrate RNA. Following incubation at 308C for 10 min, 32P-labeled in vitro–transcribed substrate RNA was added and incubation was continued at 308C for the times indicated. The reactions were terminated by the addition of SDS to 1% and proteinase K to 100 mg/ml, followed by incubation at 428C for 15 min. The samples were phenol/chloroform extracted, ethanol precipitated, and analyzed on 5% (29:1 bis) (SCN4A), 6% (19:1 bis) (ADPRP), or 8% (19:1 bis) (adeno and P120) polyacrylamide gels containing 8 M urea. Acknowledgments We thank A. Seyboldt for technical assistance, T. Schneider for sharing his splice site database, and A. George, R. Dunn, P. Powers, and the Human Genome Mapping Project for clones and sequence data. This work was supported by grant GM55105 from the National Institutes of Health. Received July 28, 1997; revised September 9, 1997. References Auer, B., Nagl, U., Herzog, H., Schneider, R., and Schweiger, M. (1989). Human nuclear NAD1 ADP-ribosyltransferase (polymerizing): organization of the gene. DNA 8, 575–580. Bonner, T.I., Kerby, S.B., Sutrave, P., Gunnell, M.A., Mark, G., and Rapp, U.R. (1985). Structure and biological activity of human homologs of the raf/mil oncogene. Mol. Cell. Biol. 5, 1400–1407. Carothers, A.M., Urlaub, G., Grunberger, D., and Chasin, L.A. (1993). Splicing mutants and their second-site suppressors at the dihydrofolate reductase locus in chinese hamster ovary cells. Mol. Cell. Biol. 13, 5085–5098.

Molecular Cell 160

Chanfreau, G., Legrain, P., Dujon, B., and Jacquier, A. (1994). Interaction between the first and last nucleotides of pre-mRNA introns is a determinant of 39 splice site selection in S. cerevisiae. Nucleic Acids Res. 22, 1981–1987. Dyer, J.R., Johnston, W.L., Castellucci, V.F., and Dunn, R.J. (1997). Cloning and tissue distribution of the Aplysia Na1 channel alphasubunit cDNA. DNA Cell Biol. 16, 347–356. George, A.L., Iyer, G.S., Kleinfield, R., Kallen, R.G., and Barchi, R.L. (1993). Genomic organization of the human skeletal muscle sodium channel gene. Genomics 16, 598–606. Hall, S.L., and Padgett, R.A. (1994). Conserved sequences in a class of rare eukaryotic introns with non-consensus splice sites. J. Mol. Biol. 239, 357–365. Hall, S.L., and Padgett, R.A. (1996). Requirement of U12 snRNA for the in vivo splicing of a minor class of eukaryotic nuclear pre-mRNA introns. Science 271, 1716–1718. Hogan, K., Gregg, R.G., and Powers, P.A. (1996). The structure of the gene encoding the human skeletal muscle a1 subunit of the dihydropyridine-sensitive L-type calcium channel (CACNL1A3). Genomics 31, 392–394. Jackson, I.J. (1991). A reappraisal of non-consensus mRNA splice sites. Nucleic Acids Res. 19, 3795–3798. Kandels-Lewis, S., and Seraphin, B. (1993). Involvement of U6 snRNA in 59 splice site selection. Science 262, 2035–2039. Kohrman, D.C., Harris, J.B., and Meisler, M.H. (1996). Mutation detection in the med and medJ alleles of the sodium channel SCN8A: unusual splicing due to a minor class AT-AC intron. J. Biol. Chem. 271, 17576–17581. Kolossova, I., and Padgett, R.A. (1997). U11 snRNA interacts in vivo with the 59 splice site of U12-dependent (AU-AC) introns. RNA 3, 227–233. Lesser, C.F., and Guthrie, C. (1993). Mutations in U6 snRNA that alter splice site specificity: implications for the active site. Science 262, 1982–1988. Luukkonen, B.G.M., and Seraphin, B. (1997). The role of branchpoint-39 splice site spacing and interaction between intron terminal nucleotides in 39 splice site selection in Saccharomyces cerevisiae. EMBO J. 16, 779–792. Ophoff, R.A., Terwindt, G.M., Vergouwe, M.N., van Eijk, R., Oefner, P.J., Hoffman, S.M.G., Lamerdin, J.E., Mohrenweiser, H.W., Bulman, D.E., Ferrari, M., et al. (1996). Familial hemiplegic migraine and episodic ataxia type-2 are caused by mutations in the Ca2 1 channel gene CACNL1A4. Cell 87, 543–552. Padgett, R.A., Konarska, M.M., Aebi, M., Hornig, H., Weissmann, C., and Sharp, P.A. (1985). Nonconsensus branch-site sequences in the in vitro splicing of transcripts of mutant rabbit b-globin genes. Proc. Natl. Acad. Sci. USA 82, 8349–8353. Parker, R., and Siliciano, P.G. (1993). Evidence for an essential non– Watson–Crick interaction between the first and last nucleotides of a nuclear pre-mRNA intron. Nature 361, 660–662. Reed, R. (1989). The organization of 39 splice-site sequences in mammalian introns. Genes Dev. 3, 2113–2123. Ruskin, B., Green, J.M., and Green, M.R. (1985). Cryptic branch point activation allows accurate in vitro splicing of human b-globin intron mutants. Cell 41, 833–844. Scadden, A.D.J., and Smith, C.W.J. (1995). Interactions between the terminal bases of mammalian introns are retained in inosinecontaining pre-mRNAs. EMBO J. 14, 3236–3246. Senapathy, P., Shapiro, M.B., and Harris, N.L. (1990). Splice junctions, branch point sites, and exons: sequence statistics, identification, and applications to genome project. Meth. Enzymol. 183, 252–278. Soldatov, N.M. (1994). Genomic structure of human L-type Ca2 1 channel. Genomics 22, 77–87. Stanford, D.R., Perry, C.A., Holicky, E., Rohleder, A.M., and and Wieben, E.D. (1988). The small nuclear ribonecleoprotein E protein gene contains four introns and has upstream similarities to genes for ribosomal proteins. J. Biol. Chem. 263, 17772–17779. Stephens, R.M., and Schneider, T.D. (1992). Features of spliceosome evolution and function inferred from an analysis of the information at human splice sites. J. Mol. Biol. 228, 1124–1136.

Tarn, W.-Y., and Steitz, J.A. (1996a). A novel spliceosome containing U11, U12, and U5 snRNPs excises a minor class (AT-AC) intron in vitro. Cell 84, 801–811. Tarn, W.-Y., and Steitz, J.A. (1996b). Highly diverged U4 and U6 small nuclear RNAs required for splicing rare AT-AC introns. Science 273, 1824–1832. Tarn, W.-Y., and Steitz, J.A. (1997). Pre-mRNA splicing: the discovery of a new spliceosome doubles the challenge. Trends Biochem. Sci. 22, 132–137. Wang, Q., Li, Z., Shen, J., and Keating, M.T. (1996). Genomic organization of the human SCN5A gene encoding the cardiac sodium channel. Genomics 34, 9–16. Wu, H.-J., Gaubier-Comella, P., Delseny, M., Grellet, F., Van Montagu, M., and Rouze, P. (1996). Non-canonical introns are at least 109 years old. Nature Genet. 14, 383–384. Wu, Q., and Krainer, A.R. (1996). U1-mediated exon definition interactions between AT-AC and GT-AG introns. Science 274, 1005– 1008. Wu, Q., and Krainer, A.R. (1997). Splicing of a divergent subclass of AT-AC introns requires the major spliceosomal snRNAs. RNA 3, 586–601. Yamada, Y., Masuda, K., Li, Q., Ihara, Y., Kubota, A., Miura, T., Nakamura, K., Fujii, Y., Seino, S., and Seino, Y. (1995). The structures of the human calcium channel a1 subunit (CACNL1A2) and b subunit (CACNLB3) genes. Genomics 27, 312–319. Zerivitz, K., and Akusjarvi, G. (1989). An improved nuclear extract preparation method. Gene Anal. Tech. 6, 101–109.