Tetrahydrobiopterin biosynthesis in white and brown adipose tissues is enhanced following intraperitoneal administration of bacterial lipopolysaccharide

Biochimica et Biophysica Acta 1670 (2004) 181 – 198 www.bba-direct.com

Tetrahydrobiopterin biosynthesis in white and brown adipose tissues is enhanced following intraperitoneal administration of bacterial lipopolysaccharide Kentaro Fujiwara a, Keiji Mori b, Yoko S. Kaneko b, Akira Nakashima b, Akio Nagasaka a, Mitsuyasu Itoh a, Akira Ota b,* a

Division of Endocrinology and Metabolism, Department of Internal Medicine, Fujita Health University School of Medicine, Toyoake 470-1192, Japan b Department of Physiology, School of Medicine, Fujita Health University, Toyoake 470-1192, Japan Received 26 February 2003; received in revised form 25 November 2003; accepted 16 December 2003

Abstract Tetrahydrobiopterin is an essential cofactor for nitric oxide synthase (NOS). This study was undertaken to examine the effects of intraperitoneally injected lipopolysaccharide on tetrahydrobiopterin biosynthesis in murine white and brown adipose tissues. Tetrahydrobiopterin content, catalytic activity and mRNA expression level of GTP cyclohydrolase I (GCH), rate-controlling enzyme in de novo biosynthesis of tetrahydrobiopterin, in both adipose tissues were up-regulated by 500-Ag lipopolysaccharide at 6 h after the injection. On the contrary, treatment of 3T3-L1 adipocytes with lipopolysaccharide alone did not affect GCH mRNA expression level, whereas the combination of lipopolysaccharide, tumor necrosis factor (TNF)-a, and interferon g induced the increase in expression levels of GCH mRNA and CD14 mRNA. Collectively, our results showed that tetrahydrobiopterin biosynthesis can be augmented by increased GCH activity caused by a synergistic effect of lipopolysaccharide and cytokines in white and brown adipose tissues. These observations support the view that tetrahydrobiopterin biosynthesis in the adipose tissues is a target of inflammatory events triggered by peripheral LPS injection. D 2004 Elsevier B.V. All rights reserved. Keywords: Adipose tissue; Tetrahydrobiopterin; GTP cyclohydrolase I; Lipopolysaccharide; Inducible nitric oxide synthase

1. Introduction Nowadays, adipocytes are identified as active endocrine cells, because they produce and release the hormones and cytokines such as leptin [1 –3] and tumor necrosis factor (TNF)-a [4] as well as nitric oxide (NO), which is the smallest biological signal in mammals. NO is synthesized via L-arginine oxidation by a family of NO synthase (NOS) isoforms. Inducible NOS (iNOS) isozyme is calcium/calmodulin-independent and its presence was identified in white and brown adipose tissues [5,6]. Because of the size and widespread distribution, the adipose tissue should be one of the major sources of appreciable amounts of NO. Recently it was reported that 3T3-L1 adipocytes could produce NO via iNOS induction by the combination treatment of lipo-

* Corresponding author. Tel.: +81-562-93-2462, +81-562-93-2463; fax: +81-562-93-2649. E-mail address: [email protected] (A. Ota). 0304-4165/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.bbagen.2003.12.004

polysaccharide (LPS), the major lipid constituent of the cell wall of gram-negative bacilli, and cytokines [6]. Furthermore, systemic administration of LPS to rats markedly increased the iNOS mRNA and protein levels in their epididymal and perirenal white adipose tissues and interscapular brown adipose tissue [6]. iNOS requires five cofactors to catalyze the conversion of L-arginine to L-citrulline, namely, nicotinamide adenine dinucleotide phosphate, flavin adenine dinucleotide, flavin mononucleotide, calmodulin, and tetrahydrobiopterin ((6R)L-erythro-dihydroxypropyl-2-amino-4-hydroxy-5,6,7,8-tetrahydropteridine; BH4). The first three cofactors are usually present in cells at concentrations that are not limiting for catalytic activity. The fourth cofactor, calmodulin, is constitutively bound to iNOS protein to make iNOS activity calcium-independent [7]. Contrary to that of other cofactors, the intracellular level of the fifth cofactor, BH4, is ratelimiting for NO generation in a murine macrophage cell line [8]. The cellular level of BH4 is largely regulated by the activity of GTP cyclohydrolase I (GCH), the enzyme that

182

K. Fujiwara et al. / Biochimica et Biophysica Acta 1670 (2004) 181–198

converts GTP into 7,8-dihydroneopterin triphosphate and is the first and rate-limiting enzyme in the cascade of de novo biosynthesis of BH4 [9]. 7,8-Dihydroneopterin triphosphate is then the substrate that generates BH4 by the action of successive two enzymes, i.e., 6-pyruvoyltetrahydropterin synthase and sepiapterin reductase, neither of which is ratelimiting. The endotoxemia caused by the peripheral injection of LPS caused widespread induction of GTP cyclohydrolase I (GCH) mRNA and GCH protein in peripheral organs [10,11]. Therefore, the synergized production of BH4 would be expected to underlie the LPS-induced production of NO in adipose tissues. However, there have been no reports on alterations in BH4 contents, GCH catalytic activity, and GCH mRNA expression in white and brown adipose tissues in experimental animals exposed to LPS-induced endotoxemia. In addition, 3T3-L1 adipocytes did not produce appreciable amount of NO by the incubation with LPS alone [6], although adipose tissues were reported to possess CD14, the specific receptor for LPS [12,13]. Very recently, inflammatory stimulation of 3T3-L1 adipocytes by the mixture consisting of LPS, TNF-a, and IFN-g was known to strongly induce GCH mRNA and iNOS mRNA leading to NO production [14]. These findings and reports urge us to examine the mRNA expressions in the adipose tissues of the genes encoding GCH, iNOS, CD14, Toll-like receptor type 4 (Tlr4: the innate LPS receptor) and receptors for immune mediators (TNF-a receptor type I and II [TNFR1 and TNFR2], IFN-g receptor 1 and 2 [IFNGR1 and IFNGR2], and IL-1h receptor [IL1hR]). On the other hand, the first physiological role of BH4 to be identified was its action as a proton-donating cofactor for L-aromatic amino acid hydroxylation [15]. Therefore, competition for BH4 among iNOS and L-aromatic amino acid hydroxylases, namely, phenylalanine hydroxylase (PAH), tryptophan hydroxylase (TPH), and tyrosine hydroxylase (TH), might supposedly modulate the activities of iNOS and L-aromatic amino acid hydroxylases in adipose tissues. Collectively, this study was designed at first to substantiate the LPS-induced iNOS induction in white and brown adipose tissues reported by Kapur et al. [6] from the viewpoint of BH4 de novo biosynthesis; second, to examine the mRNA expression levels of the genes encoding LPS receptors, CD14 and Tlr4, the receptors for immune mediators, and L-aromatic amino acid hydroxylases in adipose tissues. The results obtained in our study suggest that peripheral LPS readily enhanced GCH mRNA expression in white and brown adipose tissues, which was followed by increased GCH catalytic activity and de novo biosynthesis of BH4.

2. Materials and methods 2.1. Reagents LPS from Escherichia coli, sero-type 026:B6, was purchased from Sigma-Aldrich, Inc. (St. Louis, MO, USA). 14 L-[ C]Arginine was purchased from Amersham Biosciences

(Tokyo, Japan). Other reagents used in this study were of analytical grade and were purchased mainly from SigmaAldrich. 2.2. In vivo experimental procedures for mice C3H/HeN and C3H/HeJ mice, both of which were 8week-old and male, were obtained from S.L.C. (Hamamatsu, Japan). C3H/HeN inbred strain is LPS-responsive. C3H/HeJ inbred mice have an extreme hyporesponsiveness to LPS challenge at a dose lethal to other inbred strain of mice [16] because of a missense point mutation in the coding region at position 712 of the Tlr4 gene [17,18]. They were housed in a temperature-controlled room with controlled lighting (lights on, 0600 – 1800 h), and were given free access to standard rodent food and water. On the day of an experiment, C3H/HeN mice were housed individually in opaque cages. The first intraperitoneal (i.p.) injection of 250 Al of 20 Ag/ml LPS solution (5 Ag LPS or approximately 0.2 mg/kg) or of 2 mg/ml LPS solution (500 Ag LPS or approximately 20 mg/kg) or 250 Al of vehicle solution (saline) given to the mice in their cages was undertaken at 9 AM. At 2, 4 or 6 h following the i.p. injection of LPS solution or vehicle solution, the mice were anesthetized with 50 mg/kg sodium pentobarbital (i.p. injection), and blood was withdrawn by puncturing the left ventricle in the open chest while the heart was still beating. The epididymal white adipose tissue and interscapular brown adipose tissue were quickly removed, put into Eppendorf tubes, and frozen by immersion in liquid nitrogen. They were stored at 80 jC until use for measurements. C3H/HeJ mice were classified into four groups: (1) vehicle (saline) i.p. injection; (2) LPS 500 Ag i.p. injection; (3) TNF-a 1 Ag i.p. injection; (4) both of LPS 500 Ag i.p. and TNF-a 1 Ag i.p. injection. The first i.p. injection to C3H/HeJ mice in their cages was undertaken at 9 AM. The volume of the solutions injected into each C3H/HeJ mouse was 0.35 ml. At 4 h after the i.p. injection, C3H/HeJ mice were sacrificed in the same way as for C3H/HeN mice. 2.3. 3T3-L1 adipocytes 3T3-L1 adipocytes were obtained from Health Science Research Resources Bank (Sennan, Osaka, Japan). Cells were grown and differentiated as previously described by Kapur et al. [6] with minor changes. Briefly, cells were grown and maintained in monolayer culture in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% (vol/ vol) fetal bovine serum (FBS) (lot no. 2B0360; JRH Biosciences, Inc., Lenexa, KS, USA) in an atmosphere of 5% CO2 at 37 jC. Cells used for RNA extraction were plated in 25-cm2 flasks (Beckton Dickinson Labware, Franklin Lakes, NJ, USA); cells used for the assay of enzyme activity were plated on OPTILUXk petri dish in 100  15 mm style (Beckton Dickinson Labware). One day postconfluence, differentiation was initiated by incubating cells in DMEM

K. Fujiwara et al. / Biochimica et Biophysica Acta 1670 (2004) 181–198

containing 10% (vol/vol) FBS, 0.5 mM 3-isobutyl-1-methylxantine (IBMX), 1 AM dexamethasone, and 10 Ag/ml insulin for 48 h, followed by a 72-h incubation period in the same medium but without IBMX and dexamethasone. Differentiation was completed by incubating cells in DMEM containing 10% (vol/vol) FBS for 8 days. On the day of the addition of LPS and/or cytokine(s), differentiated 3T3-L1 adipocytes were incubated with serum-free DMEM for 12 h, and then, they were incubated for 6 h with 10 Ag/ml LPS and cytokine(s) (10 ng/ml TNF-a and/or 24 ng/ml [ = 200 NIH units/ml] IFN-g), alone or in a concerted manner. Once washed by phosphate-buffered saline, total RNA was extracted from the cells in the same way as for the adipose tissue. 2.4. Measurement of BH4 in the adipose tissues and in differentiated 3T3-L1 adipocytes BH4 levels in adipose tissues obtained from C3H/HeN mice and differentiated 3T3-L1 adipocytes were determined by differential oxidation as already reported [19] by using HPLC with fluorescence detection [20]. 2.5. Determination of enzyme activities 2.5.1. GCH activity The GCH activities in the homogenates of white and adipose tissues obtained from C3H/HeN mice and differentiated 3T3-L1 adipocytes were assayed by the measurement of neopterin enzymatically converted from 7,8-dihydroxyneopterin triphosphate by using an HPLC apparatus equipped with a fluoromonitor according to the method previously described [21]. 2.5.2. iNOS activity The assay for the activity of iNOS NOS detectk Assay Kit (Stratagene, La Jolla, CA, USA) was performed according to the supplier’s instruction with minor modifications. Briefly, white and brown adipose tissues obtained from C3H/HeN mice obtained 6 h after the i.p. injection of 500 Ag LPS or vehicle were homogenized in 25 mM Tris – HCl (pH 7.4) containing 1 mM EDTA and 1 mM ethyleneglycolbis(h-aminoethylether)-N,N,NV,NV-tetraacetic acid (EGTA) by using a sonifier (model UR-20P; TOMY) on ice. The homogenate was used as an enzyme sample. The enzyme reaction was started by the mixing of 10 Al of enzyme sample with 40 Al of reaction buffer which gave the final concentrations of 25 mM Tris –HCl [pH 7.4], 1 AM flavin adenine dinucleotide, 1 AM riboflavin mononucleotide, 1 mM reduced nicotinamide adenine dinucleotide phosphate, 2.88 AM L-[14C]arginine (specific activity 348 mCi/mmol) containing or not containing 3 AM BH4. For the blank, NGnitro-L-arginine methyl ester was added to the reaction buffer before adding the enzyme sample to be finally 2 mM in the reaction mixture. The enzyme reaction was carried out at 37 jC for 60 min and was terminated by

183

the addition of 400 Al of ice-cold stop buffer (50 mM N-2hydroxyethylpiperazine-N V-2-ethanesulfonic acid [pH 5.5] containing 5 mM EDTA). The tubes were immediately put on ice. Then, samples were mixed with 100 Al of resin supplied in the kit, transferred to spin cups, which were also supplied in the kit, and centrifuged. The eluates were transferred to the scintillation vials and enzymatically synthesized L-[14C]citrulline in the eluates was quantified by a liquid scintillation counter (LSC-1000, ALOKA Co. Ltd., Mitaka, Japan) [22]. The differentiated 3T3-L1 cells were incubated for 6 h with 10 Ag/ml LPS alone, with the mixture of 10 ng/ml TNF-a and 24 ng/ml [ = 200 NIH units/ml] IFN-g, or with the cocktail of LPS and cytokines. The preparation of the enzyme samples and the assay of iNOS activity were performed in the same way as those for the adipose tissues. 2.5.3. Immunoblotting analysis for iNOS protein Immunoblotting analysis for iNOS protein was performed as previously described [23] with minor modifications. Samples used were the tissue or cell homogenates in 25 mM Tris – HCl (pH 7.4) containing 1 mM EDTA and 1 mM EGTA. They were prepared at the same time for those used for the assay of iNOS activity. Samples (1.5 Ag for tissue homogenates and 12 Ag for cell homogenates) were mixed with Laemmli’s sample buffer containing 0.9% h-mercaptoethanol, boiled, and resolved on SDS-PAGE. Then, the proteins were electrotransferred to a nitrocellulose membrane (Immobilonk-P; Millipore, Bedford, MA, USA) by using KS-8640k blotting system (Marysol, Tokyo, Japan), blocked with 3% skimmed milk supplied as ECL Advancek Western Blotting Detection Kit (Amersham Biosciences), and probed with the first antibody (anti-mouse iNOS monoclonal antibody, 1:5000, BD Biosciences #610599, Tokyo, Japan) for 60 min at room temperature. The blotting membrane was washed and exposed to the second antibody of peroxidase-conjugated antimouse IgG (whole molecule) (1:2000) purchased from Sigma-Aldrich for 60 min at room temperature, and the blots were luminated by using ECL Advancek Western Blotting Detection Kit and semi-quantified by using Lumino-Imageanalyzer LAS-1000k (Fujifilm, Tokyo, Japan). 2.6. Estimation of mRNA expression levels by quantitative real-time PCR The RNA extraction from white and brown adipose tissues and differentiated 3T3-L1 adipocytes followed by the quantitative estimation of mRNA expression levels by using a quantitative real-time PCR were performed as previously described in detail [24]. The sequences of the primers and the probes used in this study are summarized in Table 1. The expression levels of mRNAs encoding GCH and iNOS were quantified by a quantitative real-time PCR using TaqMank primer and probe sets. These TaqMank probes were labeled with a reporter fluorescent dye 6-carboxyfluorescein at their

184

K. Fujiwara et al. / Biochimica et Biophysica Acta 1670 (2004) 181–198

Table 1 Nucleotide sequences of primers and probes used for quantitative real-time PCR Gene name

GenBank accession number

Primer orientation

Nucleotide sequence (from 5Vto 3V)

GCH

L09737

iNOS

NM_010927

CD14

NM_009841

Tlr4

AF110133

TNFR1

M59378

TNFR2

M60469

IFNGR1

NM_010511

IFNGR2

NM_008338

IL1hR

M59378

PAH

X51942

TPH

J04758

TH

M69200

forward reverse TaqMan forward reverse TaqMan forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse

GCAGCGAGGAGGAAAACCA CCAGCGAGAGCAGAATGGA CTCCCCAAACTGGCGGCTGCTTACT CGTCCACAGTATGTGAGGATCAA CAAGCAAGACTTGGACTTGCAA TCTTCACCACAAGGCCACATCGGATTT GACCTGTCTGACAATCCTGAATTG ACGCAGCGCTAAAACTTGGA CCTCTGCCTTCACTACAGAGACTTT CACAATAACCTTCCGGCTCTTG CGCCTTGAAAACCCATTCTG CAGGCCTTGCATAGCACATTT GCCAGATCTCACAGGAATACTATGAC TCCGAGGTCTTGTTGCAGAA ATGGCCTCCGGTTATGACAA CCTGTGAGTCTATACCCCATGAGA CCAGACCAATTCATCTTAGA AGCACATCATCTCGCTCCTTT CAGACCCAGGAGTGTTCACAGA ACATGGACACACCCTGGTTCA TATGACCCCTACACTCAAAG AAAGGATTCCAACCTCACTA AAGTACAACCCGTACACA GCATCACTGATGACATCAAG GGCTTCTCTGACCAGGCGTAT TGCTTGTATTGGAAGGCAATCTC

Size of PCR products (bp) 72

108

93 94 117 100 92 110 81 94 104 68

The nucleotide residues of the primers and probes are numbered in the 5Vto 3Vdirection starting from the first residue of the ATG triplet, which codes for the initiation methionine.

5V end and with a fluorescent dye quencher 6-carboxytetramethyl-rhodamine at their 3Vend (PE Biosystems). The expression levels of mRNAs encoding other genes were quantified by a quantitative real-time PCR using SYBRR Green PCR master mix (PE Biosystems). All primers and probes were designed from the sequences in the GenBank database (http://www.ncbi.nlm.nih.gov:80/entrez/query. fcgi?CMD = search&DB = nucleotide).

statistical analyses, P < 0.05 was considered to be statistically significant.

3. Results 3.1. Effects of LPS on BH4 contents in adipose tissues obtained from C3H/HeN mice and in differentiated 3T3-L1 adipocytes (Fig. 1)

2.7. Protein concentrations The protein concentration of each sample was determined with a Bio-Rad Protein Assay Kit (Bio-Rad, Hercules, CA, USA) with bovine serum albumin used as a standard. The apparatus used for the measurement was MPR-A4i microplate reader (Tosoh, Tokyo, Japan). 2.8. Statistics All numerical data shown in this paper were expressed as the mean F standard error of the mean (S.E.). The comparison between two groups was performed by using Student’s t test. Analysis of variance (ANOVA) was used to analyze all data in comparison among the groups of more than three. If the ANOVA revealed a significant overall effect, the significance of the differences between results was determined by Scheffe`’s test as a post-hoc test. For all

BH4 contents in the white and brown adipose tissues were compared between LPS-challenged and vehicle-treated groups at 2, 4, and 6 h after i.p. injection in order to substantiate the enhanced expression of iNOS mRNA and protein [6]. The results are shown in Fig. 1. Briefly, at 2 and 4 h after the injection, the BH4 contents in the white and brown adipose tissues of the LPS-injected mice did not increase to a statistically significant level compared with those of the vehicle-injected ones. At 6 h after LPS 500 Ag i.p. injection, however, BH4 contents in white and brown adipose tissues increased to a statistically significant level compared with those in vehicle-treated ones (for white adipose tissue, LPSinjected mice, 19.4 F 1.7 pmol/mg protein vs. vehicleinjected ones 10.7 F 1.2 pmol/mg protein, P < 0.01; for brown adipose tissue, LPS-injected mice 5.3 F 0.5 pmol/ mg protein vs. vehicle-injected ones 3.2 F 0.3 pmol/mg protein, P < 0.01). On the contrary, LPS at 5 Ag i.p. injection

K. Fujiwara et al. / Biochimica et Biophysica Acta 1670 (2004) 181–198

did not cause any significant change in the BH4 content in either white or brown adipose tissue (Fig. 1, Panels A and B). Intracellular BH4 contents in differentiated 3T3-L1 adipocytes were enhanced by the stimulation of the cocktail of LPS and cytokines to a statistically significant level (cells stimulated by the cocktail of LPS and cytokines 7.12 F 0.53 pmol/mg protein vs. untreated control cells 4.35 F 0.70 pmol/mg protein, P < 0.05). It is noted that the stimulation by LPS alone was ineffective to enhance intracellular BH4 contents in these cells (cells stimulated by LPS alone 4.88 F 0.53 pmol/mg protein vs. untreated control cells 4.35 F 0.70 pmol/mg protein, P = 0.916).

185

3.2. Effects of LPS on enzyme catalytic activity 3.2.1. GCH catalytic activity (Fig. 2) The results of GCH catalytic activity in white and brown adipose tissues obtained from C3H/HeN mice are shown in Fig. 2. Consistent with the results on BH4 contents in the adipose tissues, no significant increase in GCH catalytic activity in either white or brown adipose tissues obtained from the mice i.p. injected with 500 Ag LPS was observed during the first 4 h after the i.p. injection. A significant increase in GCH catalytic activity due to LPS at 500 Ag was observed at 6 h after the LPS injection (for white adipose tissue, LPS-injected mice 6.0 F 0.7 pmol/h/mg protein vs. vehicle-injected ones 3.0 F 0.3 pmol/h/mg protein, P < 0.001; for brown adipose tissue, LPS-injected mice 3.2 F 0.2 pmol/h/mg protein vs. vehicle-injected ones 2.3 F 0.2 pmol/h/mg protein, P < 0.05). As was the case for BH4 content, the i.p. injection of 5 Ag LPS did not cause any significant increase in GCH catalytic activity in either tissue (Fig. 2). These results indicate that the increase in BH4 content in the adipose tissues of LPS-injected C3H/HeN mice was synchronous with the increase in the catalytic activity of GCH. GCH catalytic activity in differentiated 3T3-L1 adipocytes was enhanced by the stimulation of the cocktail of LPS and cytokines to a statistically significant level (cells stimulated by the cocktail of LPS and cytokines 11.86 F 1.78 pmol/h/mg protein vs. untreated control cells 6.05 F 0.64 pmol/h/mg protein, P < 0.05). It is noted that the stimulation by LPS alone was ineffective to enhance GCH catalytic activity in these cells (cells stimulated by LPS alone 6.49 F 0.85 pmol/h/mg protein vs. untreated control cells 6.05 F 0.64 pmol/h/mg protein, P = 0.995). 3.2.2. iNOS catalytic activity (Fig. 3) iNOS activities in white and brown adipose tissues obtained from C3H/HeN mice, obtained 6 h after an i.p. injection of 500 Ag LPS or vehicle, were assayed in the presence or absence of exogenous 3 AM BH4 (Fig. 3,

Fig. 1. Changes in BH4 content in white adipose tissue (panel A), brown adipose tissue (panel B) obtained from C3H/HeN mice at 2, 4, and 6 h after i.p. injection of LPS (5 Ag or 500 Ag) or vehicle; in differentiated 3T3-L1 adipocytes (panel C). BH4 contents are displayed in pmol/mg protein. The measurements of BH4 were carried out in triplicate for one sample. The data are expressed as the mean (column) F S.E. (bars). The number of mice used for the measurements of BH4 in white and brown adipose tissues was 13, 15, and 13 at 2, 4, and 6 h, respectively, after vehicle injection; 8, 11, and 6 at 2, 4, and 6 h, respectively, after 5 Ag LPS injection; and 6, 6, and 11 at 2, 4, and 6 h, respectively, after 500 Ag LPS injection. The differentiated 3T3-L1 cells were incubated for 6 h with 10 Ag/ml LPS alone, with the mixture of 10 ng/ ml TNF-a and 24 ng/ml [ = 200 NIH units/ml] IFN-g, or with the cocktail of LPS and cytokines. Each group consisted of five dishes. Because the ANOVA revealed a significant overall effect, Scheffe`’s test as a post-hoc test was carried out to determine the significance of the differences among the groups. **P < 0.01 compared with ‘‘vehicle i.p.’’ in WAT (white adipose tissue) and BAT (brown adipose tissue); *P < 0.05 compared with cells exposed neither to LPS nor to cytokines.

186

K. Fujiwara et al. / Biochimica et Biophysica Acta 1670 (2004) 181–198

of brown adipose tissues did not reject the null hypothesis as well as the case of white adipose tissues. The data of iNOS activity obtained from 3T3-L1 cells were very similar to those obtained from adipose tissues (Fig. 3, Panel B). ANOVA carried out among four groups of 3T3-L1 cells did not reject the null hypothesis in the presence or absence of exogenous 3 AM BH4 in the reaction buffer, respectively. ANOVA carried out for the comparison between the data obtained by using reaction mixture containing or not containing exogenous BH4 also did not reject the null hypothesis. 3.3. Immunoblotting analyses of iNOS protein (Fig. 4) iNOS protein expressions in the homogenates of adipose tissues and differentiated 3T3-L1 adipocytes were studied by using immunoblotting analyses. Both of the blots obtained from tissue and cell gave two bands, which was same as the result brought by the supplier of anti-mouse iNOS monoclonal antibody (BD Biosciences #610599, Tokyo, Japan). ANOVA carried out for the comparison among the expression levels of iNOS protein rejected the null hypothesis in either adipose tissues or cells. However, post-hoc test

Fig. 2. Changes in GCH catalytic activities in white and brown adipose tissues (panel A) obtained from C3H/HeN mice at 2, 4, 6 h after i.p. injection of LPS (5 Ag or 500 Ag) or vehicle and in differentiated 3T3-L1 cells (panel B). GCH catalytic activities were displayed in pmol/h/mg protein. The measurements of neopterin (see Materials and methods) were carried out in triplicate for each sample. The data are expressed as the mean (column) F S.E. (bars). The number of mice used for the assay of GCH activity in white adipose tissue was 13, 15, and 13 at 2, 4, and 6 h, respectively, after vehicle injection; 8, 11, and 4 at 2, 4, and 6 h, respectively, after 5 Ag LPS injection; and 6, 6, and 10 at 2, 4, and 6 h, respectively, after 500 Ag LPS injection. The number of mice used for the assay of GCH activity in brown adipose tissue was 12, 4, and 10 at 6 h after the injection of vehicle, 5 Ag LPS, and 500 Ag LPS, respectively. 3T3-L1 cells were classified into four groups in the same way as described in the legend for Fig. 1. Each group consisted of five dishes. The data shown in this figure were obtained from the sister culture of the cells used for the measurement of intracellular BH4 contents (Fig. 1). Because the ANOVA revealed a significant overall effect, Scheffe`’s test as a post-hoc test was carried out to determine the significance of the differences among the groups. *P < 0.05 and ***P < 0.001 compared with ‘‘vehicle i.p.’’ in WAT (white adipose tissue) and BAT (brown adipose tissue); *P < 0.05 compared with cells exposed neither to LPS nor to cytokines.

Panel A). iNOS activity in white adipose tissue from vehicleinjected mice was below detection limit of our system. As shown in Fig. 3, ANOVA carried out among four groups of white adipose tissues did not reject the null hypothesis. iNOS activities in brown adipose tissue were higher than those in white adipose tissue. ANOVA carried out among four groups

Fig. 3. Changes in iNOS catalytic activities in white adipose tissue (panel A) and brown adipose tissue (panel B) obtained from C3H/HeN mice and in differentiated 3T3-L1 cells (panel C). Adipose tissues were extracted at 6 h after i.p. injection of LPS (500 Ag) or vehicle. 3T3-L1 cells were incubated with LPS and/or cytokines for 6 h. 3T3-L1 cells were classified into four groups in the same way as described in the legend for Fig. 1. iNOS catalytic activities were displayed in pmol/min/mg protein. The measurements were carried out in duplicate for each sample. The data are expressed as the mean (column) F S.E. (bars). All the groups shown in this figure consisted of five animals or five dishes. ANOVAs carried out for any comparison did not reject the null hypotheses.

K. Fujiwara et al. / Biochimica et Biophysica Acta 1670 (2004) 181–198

did not give significant difference in the comparison between vehicle-injected and LPS-injected mice in either white or brown adipose tissue. Although post-hoc test for cells revealed statistically significant increase of iNOS protein expression level in LPS-treated cells, the increment was to a small degree (1.2 times) (Fig. 4). 3.4. Effects of LPS on GCH and iNOS mRNA expression levels 3.4.1. Adipose tissues obtained from C3H/HeN mice The mRNA expression levels of GCH in the white and brown adipose tissues were assayed by using the real-time PCR. The time profile of GCH mRNA expression level after LPS or vehicle injection was almost similar between white

187

and brown adipose tissues (Fig. 5, Panels A and B). Contrary to the data on the time profile of GCH catalytic activity, GCH mRNA expression levels in white and brown adipose tissues of the mice injected i.p. with 500 Ag LPS were increased to the statistically significant level compared with those of the ones injected i.p. with vehicle at 2 h after the injection, and this significant increase was sustained at 4 and 6 h. As in the case of BH4 content and GCH catalytic activity in the white and brown adipose tissues, GCH mRNA expression levels were not affected at any time point examined after i.p. injection of LPS at 5 Ag (Fig. 5, Panels A and B). The mRNA expression levels of iNOS in the white and brown adipose tissues were also assayed by using the realtime PCR. The time profile of the iNOS mRNA expression level after LPS injections was different between white and

Fig. 4. Immunoblotting analyses of iNOS protein in white and brown adipose tissues (panel A) obtained from C3H/HeN mice and differentiated 3T3-L1 adipocytes (panel B). iNOS protein expression in the homogenates of adipose tissues and 3T3-L1 adipocytes was examined by using immunoblotting analyses as described in Materials and methods. Each group consisted of five mice or dishes. The quantification of the expression levels was also performed as described in Materials and methods. iNOS expression levels in adipose tissues were expressed relative to the one in WAT (white adipose tissue) obtained from vehicle injected control mice. iNOS expression levels in 3T3-L1 cells were expressed relative to the one in untreated control cells. As a positive control, 0.2 Ag of the lysate of mouse macrophage cell line RAW 264.7, which was provided by the supplier of anti-mouse iNOS monoclonal antibody, was loaded onto the same gel. BAT, brown adipose tissue; PC, positive control.

188

K. Fujiwara et al. / Biochimica et Biophysica Acta 1670 (2004) 181–198

brown adipose tissues (Fig. 6, Panels A and B). The expression in white adipose tissue of the mice injected i.p. with 500 Ag LPS was increased to a statistically significant level compared with that of the ones injected i.p. with vehicle at 2 h after the i.p. injection, and this significant increase was sustained at 4 and 6 h after the injection. Contrary to that in the white adipose tissue, at 2 and 4 h after the injection, the iNOS mRNA expression level in the brown adipose tissue of the mice injected i.p. with 500 Ag LPS did not increase to a statistically significant level compared with that of the ones i.p. injected with the vehicle. However, at 6 h the increase did reach significance. iNOS mRNA expression levels were not affected at any time points examined after LPS 5 Ag i.p. injection (Fig. 6, Panels A and B).

3.4.2. Adipose tissues obtained from C3H/HeJ mice (Fig. 7) GCH mRNA expression levels in white and brown adipose tissues obtained from C3H/HeJ mice were not affected by LPS 500 Ag i.p. injection (Fig. 7). One microgram of TNF-a injected i.p. readily enhanced GCH mRNA expression levels in both adipose tissues and additivity of LPS injection to TNF-a injection was not observed. iNOS mRNA expression levels in both adipose tissues were also not affected by LPS 500 Ag i.p. injection. 3.4.3. 3T3-L1 adipocytes GCH mRNA expression levels in differentiated 3T3-L1 adipocytes incubated with LPS and cytokines, alone or in a concerted manner, were also assayed by using the real-time PCR amplification (Fig. 5, Panel C). Incubation of the 3T3L1 adipocytes with LPS or IFN-g alone did not enhance GCH mRNA expression level in these cells. Incubation of the cells with TNF-a alone induced a slight increase in GCH mRNA expression level, but this was not to a statistically significant level. The incubation with the combination of all of LPS, IFN-g and TNF-a induced a robust increase in GCH mRNA expression in these cells. Again, it should be emphasized that incubation of the 3T3-L1 adipocytes with LPS alone did not enhance GCH mRNA expression level in these cells. The mRNA expression levels of iNOS in differentiated 3T3-L1 cells were also assayed by using the quantitative real-time PCR. The iNOS mRNA expression levels after LPS stimulation were different from those obtained from white and brown adipose tissues (Fig. 6, Panel C). The expression pattern of iNOS mRNA in these cells was almost same as the one obtained for GCH mRNA in these cells. Incubation of the 3T3-L1 adipocytes with LPS alone did not Fig. 5. Changes in GCH mRNA expression levels in white adipose tissue (panel A), brown adipose tissue (panel B) obtained from C3H/HeN mice at 2, 4, and 6 h after i.p. injection of LPS (5 Ag or 500 Ag) or vehicle; in differentiated 3T3-L1 adipocytes (panel C). The amount of GCH mRNA was measured by using quantitative real-time PCR. GCH mRNA was displayed in amoles/Ag total RNA. The measurements of the amount of GCH mRNA were carried out in triplicate for each sample. The number of mice used for the assay of GCH mRNA amount in white adipose tissue was 7, 7, and 11 at 2, 4, and 6 h, respectively, after vehicle injection; 3, 3, and 3 at 2, 4, and 6 h, respectively, after 5 Ag LPS injection; and 7, 7, and 11 at 2, 4, and 6 h, respectively, after 500 Ag LPS injection. The number of mice used for the assay of GCH mRNA amount in brown adipose tissue was 13, 16, and 13 at 2, 4, and 6 h, respectively, after the vehicle injection; 9, 12, and 6 at 2, 4, and 6 h, respectively, after 5 Ag LPS injection; and 7, 7, and 11 at 2, 4, and 6 h, respectively, after 500 Ag LPS injection. The data on adipose tissues are expressed as the mean (column) F S.E. (bars). Differentiated 3T3-L1 adipocytes were incubated for 6 h with 10 Ag/ml LPS and cytokines (10 ng/ml TNF-a and 24 ng/ml [ = 200 NIH units/ml] IFN-g), individually or in a concerted manner. The data on cells are expressed as the mean (column) F S.E. (bars) of three separate cell culture. Because the ANOVA revealed a significant overall effect, Scheffe`’s test as a post-hoc test was carried out to determine the significance of the differences among the groups. *P < 0.05, ***P < 0.001, and ****P < 0.0001 compared with ‘‘vehicle i.p.’’; #P < 0.05, ###P < 0.001, and ####P < 0.0001 compared with ‘‘LPS 5 Ag i.p.’’ in WAT (white adipose tissue) and BAT (brown adipose tissue); *P < 0.05, ***P < 0.001, and ****P < 0.0001 compared with ‘‘LPS (+), TNF-a (+), IFN-g (+)’’.

K. Fujiwara et al. / Biochimica et Biophysica Acta 1670 (2004) 181–198

189

enhance iNOS mRNA expression level in these cells. The incubation with the combination of all of LPS, IFN-g and TNF-a induced a robust increase in iNOS mRNA expression in these cells. It should be emphasized that a synergic effect of these immune molecules was observed on both GCH and iNOS mRNA expression levels in 3T3-L1 adipocytes. 3.5. Effects of LPS on mRNA expressions of genes other than those encoding GCH and iNOS

Fig. 6. Changes in iNOS mRNA expression levels in white adipose tissue (panel A), brown adipose tissue (panel B) obtained from C3H/HeN mice at 2, 4, and 6 h after i.p. injection of LPS (5 or 500 Ag) or vehicle; in differentiated 3T3-L1 adipocytes (panel C). The amount of iNOS mRNA was measured by using quantitative real-time PCR. iNOS mRNA is expressed in amoles/Ag total RNA. The measurements of the amount of iNOS mRNA were carried out in triplicate for each sample. The number of mice used for the assay of the amount of iNOS mRNA in white and brown adipose tissues was the same as that in the assay of GCH mRNA amount. The data on adipose tissues are expressed as the mean (column) F S.E. (bars). Differentiated 3T3-L1 adipocytes were incubated for 6 h with LPS and/or cytokines as described in the legend of Fig. 5. The data on cells are expressed as the mean (column) F S.E. (bars) of three separate cell cultures. Because the ANOVA revealed a significant overall effect, Scheffe`’s test as a post-hoc test was carried out to determine the significance of the differences among the groups. *P < 0.05 and **P < 0.01 compared with ‘‘vehicle i.p.’’; ## P < 0.01 compared with ‘‘LPS 5 Ag i.p.’’ in WAT (white adipose tissue) and BAT (brown adipose tissue); ***P < 0.001 and ****P < 0.0001 compared with ‘‘LPS (+), TNF-a (+), IFN-g (+)’’.

3.5.1. Adipose tissue obtained from C3H/HeN mice (Fig. 8) The mRNA expressions of the genes encoding LPS receptors (CD14 and Tlr4), cytokine receptors (TNFR1, TNFR2, INFGR1, IFNGR2, and IL1bR), and aromatic amino acid hydroxylases (PAH, TPH, and TH) in white and brown adipose tissues were assayed by using real-time PCR. The mRNA expressions of the genes encoding CD14, TNFR1, TNFR2, INFGR1, and IL1bR were enhanced at 2 h after injection in white adipose tissue from LPS (500 Ag)-injected C3H/HeN mice to a statistically significant level compared with those in vehicle-injected mice (Fig. 8). Their increases persisted until 4 h after the injection. In brown adipose tissue of C3H/HeN mouse, the mRNA expressions of the genes encoding CD14, TNFR1, TNFR2, IFNGR1, and IL1bR were increased to a statistically significant level due to LPS injection (Fig. 8). In both white and brown adipose tissues, the mRNA expression level of TNFR2 gene was higher than that of TNFR1 gene. The mRNA expression level of the gene encoding Tlr4 was not affected by LPS injection. The amounts of mRNAs of the genes encoding PAH, TPH, and TH in total RNA extracted from white and brown adipose tissues of C3H/HeN mice sacrificed at 6 h after LPS (500 Ag) or vehicle i.p. injection were measured by using quantitative real-time PCR. Each group consisted of six mice. The mRNA expressions of them in both adipose tissues were generally low, although they were detected by quantitative real-time PCR. In white adipose tissues, the expression levels of mRNAs encoding these enzymes were not affected by LPS injection (PAH mRNA; 0.1356 F 0.0624 amoles/Ag total RNA in LPS-injected mice vs. 0.0785 F 0.0279 amoles/Ag total RNA in vehicle-injected ones [ P = 0.423]: TPH mRNA; 0.3927 F 0.1039 amoles/Ag total RNA in LPS-injected mice vs. 0.3620 F 0.0940 amoles/Ag total RNA in vehicle-injected ones [ P = 0.831]: TH mRNA; 0.0047 F 0.0008 amoles/Ag total RNA in LPS-injected mice vs. 0.0115 F 0.0042 amoles/ Ag total RNA in vehicle-injected ones [ P = 0.144]). On the other hand, the amount of PAH mRNA in brown adipose tissue was increased to a statistically significant by LPS injection (PAH mRNA: 0.0016 F 0.0.0004 amoles/Ag total RNA in LPS-injected mice vs. 0.0005 F 0.0001 amoles/Ag total RNA in vehicle-injected ones [ P = 0.017]; TPH mRNA: 0.0597 F 0.0141 amoles/Ag total RNA in LPS-injected mice vs. 0.0420 F 0.0075 amoles/Ag total RNA in vehicle-injected ones [ P = 0.293]; TH mRNA: 0.0016 F 0.0005 amoles/Ag total RNA in LPS-injected mice vs. 0.0015 F 0.0003 amoles/ Ag total RNA in vehicle-injected ones [ P = 0.850]).

190

K. Fujiwara et al. / Biochimica et Biophysica Acta 1670 (2004) 181–198

Fig. 7. Changes in mRNA expressions of the genes encoding GCH, iNOS, CD14, TNFR1, TNFR2, IFNGR1, IFNGR2, and IL1bR in white and brown adipose tissues at 4 h after i.p. injection of LPS (500 Ag) and/or TNF-a (1 Ag) or vehicle into C3H/HeJ mice. The amounts of mRNAs were measured by using quantitative real-time PCR. The results were displayed in amoles/Ag total RNA. The measurements of the amount of mRNAs were carried out in triplicate for each sample. The data are expressed as the mean (column) F S.E. (bars). The number of C3H/HeJ mice used for the assay of mRNA amounts in white and brown adipose tissues were 6 for vehicle injection, 5 for LPS injection, 5 for TNF-a injection, and 5 for both LPS and TNF-a injection, respectively. When the ANOVA revealed a significant overall effect, Scheffe`’s test as a post-hoc test was carried out to determine the significance of the differences among the groups. *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001 compared with vehicle injection (LPS ( ), TNF-a ( )). WAT, white adipose tissue; BAT, brown adipose tissue.

3.5.2. Adipose tissues obtained from C3H/HeJ mice (Fig. 7) The increases in mRNA expressions of the genes encoding CD14, TNFR1, TNFR2, INFGR1, INFGR2, and IL1bR in both adipose tissues did not attain the statistically

significant level at 4 h after LPS (500 Ag) i.p. injection, although they tended to increase. On the other hand, 1 Ag of TNF-a i.p. injected readily enhanced the mRNA expressions of all of the genes listed above in white adipose tissue.

K. Fujiwara et al. / Biochimica et Biophysica Acta 1670 (2004) 181–198

191

Fig. 8. Changes in mRNA expression levels of the genes encoding LPS receptors and cytokine receptors in white and brown adipose tissues obtained from C3H/HeN mice at 2 and 4 h after i.p. injection of LPS (5 or 500 Ag) or vehicle. The amounts of mRNAs of the genes encoding CD14, Tlr4, TNFR1, TNFR2, IFNGR1, IFNGR2, and IL1bR in total RNA extracted from white and brown adipose tissues of the mice sacrificed at 2 and 4 h after LPS (5 Ag or 500 Ag) or vehicle i.p. injection were measured by using quantitative real-time PCR. They were expressed in amoles/Ag total RNA and displayed as the mean (column) F S.E. (bars). Horizontal abscissa shows the time after administration (h). The number of mice used for the assay of mRNA amounts in the adipose tissues was 13, 9, and 7 at 2 h after vehicle injection, LPS 5 Ag injection, LPS 500 Ag injection, respectively; 17, 11, and 7 at 4 h after vehicle injection, LPS 5 Ag injection, LPS 500 Ag injection, respectively. Because the ANOVA revealed a significant overall effect, Scheffe`’s test as a post-hoc test was carried out to determine the significance of the differences among the groups. WAT, white adipose tissue; BAT, brown adipose tissue. *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001 compared with ‘‘vehicle i.p.’’; #P < 0.05, ##P < 0.01, ###P < 0.001, and ####P < 0.0001 compared with ‘‘LPS 5 Ag i.p.’’.

3.5.3. 3T3-L1 adipocytes (Fig. 9) Quantitative real-time PCR for the genes examined on white and brown adipose tissues was also performed for mRNAs obtained from 3T3-L1 adipocytes. ANOVA com-

paring the effects of LPS and/or cytokines on 3T3-L1 adipocytes rejected the null hypothesis for the mRNA expression levels of all genes encoding LPS receptors and cytokine receptors examined: i.e., CD14, Tlr4, TNFR1,

192

K. Fujiwara et al. / Biochimica et Biophysica Acta 1670 (2004) 181–198

Fig. 9. mRNA Expressions of the genes encoding LPS receptors and cytokine receptors in 3T3-L1 adipocytes. The amounts of mRNAs of the genes encoding CD14, Tlr4, TNFR1, TNFR2, IFNGR1, IFNGR2, and IL1bR were measured by using quantitative real-time PCR. Incubation of 3T3-L1 cells and extraction of mRNAs from the cells were performed as described in the legend of Fig. 5. The data were expressed in amoles/Ag total RNA and displayed as the mean (column) F S.E. (bars) of three independent cell culture. Because the ANOVA revealed a significant overall effect, Scheffe`’s test as a post-hoc test was carried out to determine the significance of the differences among the groups. *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001 compared with ‘‘LPS ( ), TNF-a ( ), IFN-g ( )’’.

K. Fujiwara et al. / Biochimica et Biophysica Acta 1670 (2004) 181–198

193

Table 2 PAH mRNA, TPH mRNA, and TH mRNA expression levels in 3T3-L1 adipocytes

LPS LPS LPS LPS LPS LPS LPS LPS

( ), TNF-a ( ), IFN-g ( ) (+), TNF-a ( ), IFN-g ( ) ( ), TNF-a (+), IFN-g ( ) ( ), TNF-a ( ), IFN-g (+) (+), TNF-a (+), IFN-g ( ) (+), TNF-a ( ), IFN-g (+) ( ), TNF-a (+), IFN-g (+) (+), TNF-a (+), IFN-g (+)

PAH mRNA

TPH mRNA

TH mRNA

0.0097 F 0.0012 0.0032 F 0.0008* 0.0019 F 0.0008* 0.0020 F 0.0011* 0.0008 F 0.0001* 0.0029 F 0.0011* 0.0022 F 0.0003* 0.0021 F 0.0004*

0.0157 F 0.0019 0.0177 F 0.0012 0.0260 F 0.0042 0.0105 F 0.0073 0.0243 F 0.0027 0.0131 F 0.0017 0.0182 F 0.0062 0.0291 F 0.0088

0.0004 F 0.0000 0.0002 F 0.0001 0.0005 F 0.0001 0.0001 F 0.0001 0.0006 F 0.0002 0.0002 F 0.0000 0.0006 F 0.0002 0.0004 F 0.0002

The amounts of mRNAs of the genes encoding PAH, TPH, and TH in total RNA extracted from 3T3-L1 adipocytes were measured by using quantitative realtime PCR. All cDNAs used as templates in quantitative real-time PCR were same as those used for the amplification of the genes encoding GCH and iNOS. The data were expressed in amoles/Ag total RNA and displayed as the mean F S.E. of three separate cell culture. Because the ANOVA revealed a significant overall effect, Scheffe`’s test as a post-hoc test was carried out to determine the significance of the differences among the groups. *P < 0.0001 compared with ‘‘LPS ( ), TNF-a ( ), IFN-g ( )’’.

TNFR2, IFNGR1, IFNGR2, and IL1bR (Fig. 9). Although none of LPS, IFN-g, and TNF-a alone affected CD14 mRNA expression level in the cells, the incubation of the cells with the combination of LPS, IFN-g and TNF-a or all of them synergistically enhanced CD14 mRNA level. Although TNFR1 and TNFR2 mRNA expression levels were not affected by the incubation with LPS or IFN-g alone, they were enhanced by the incubation with any combination including TNF-a. In differentiated 3T3-L1 adipocytes, mRNA expression level of TNFR2 gene was higher than that of TNFR1 gene, which was similar to the results obtained in white and brown adipose tissues. The enhancement of IFNGR1 and IFNGR2 mRNA expression levels required TNF-a in the incubation mixture. The enhancement of IL1hR mRNA expression level required both TNFa and IFN-g in the incubation mixture. The addition of LPS into the incubation mixture did not affect IL1hR mRNA expression in the cells. On the other hand, mRNA expression level of Tlr4 gene in 3T3-L1 cells was different from those of CD14 mRNA and cytokine receptor mRNAs, because LPS reduced Tlr4 mRNA expression level in the cells and cancelled the increase in mRNA expression caused by the incubation of the cells with TNF-a. Again, it should be emphasized that LPS alone did not affect mRNA expression levels of the genes examined except for Tlr4 gene in differentiated 3T3-L1 adipocytes. The mRNA expressions of the genes encoding PAH, TPH, and TH in 3T3-L1 cells were generally low, although they were detected by quantitative real-time PCR (Table 2). The expression levels of PAH mRNA in the cells were reduced by mixing any of LPS, IFN-g, and TNF-a in the incubation mixture, whereas those of TPH mRNA and TH mRNA were not affected by the incubation with the agents above.

4. Discussion The results presented in this study clearly show that GCH mRNA expression, enzyme activity, and BH4 are constitutively expressed in murine white and brown adi-

pose tissues and that they are up-regulated by 500 Ag LPS (approximately 20 mg/kg) given by i.p. injection. The time course of the changes after the addition of LPS was similar to that previously reported for the expression in rat aorta [25] and rat myocardium [26]. Also, by using quantitative real-time PCR we demonstrated the basal expression of mRNAs encoded by CD14, Tlr4, TNFR1, TNFR2, IFNGR1, IFNGR2, and IL1bR genes in vehicle-treated white and brown adipose tissues and enhanced mRNA expressions of all genes listed above except for Tlr4 and IFNGR2 genes in LPS-treated white and brown adipose tissues. On the other hand, the data on GCH mRNA expression level obtained from differentiated 3T3-L1 adipocytes were very different from those obtained from the adipose tissues. In these cultured cells, LPS alone did not exert any effect on mRNA expression levels of the genes encoding GCH, CD14, and all cytokine receptors examined, and iNOS, whereas TNF-a alone readily enhanced the mRNA expression levels of the genes encoding cytokine receptors examined except for IL1bR. These observations raise the question of whether the effect on GCH mRNA expression in adipose tissues is directly triggered by LPS receptors on adipocytes, or whether it is due to an endogenous mediator released from macrophages and monocytes into the circulation after the LPS injection. The combination of LPS and cytokines could readily enhance GCH mRNA expression levels in 3T3-L1 adipocytes. In addition, similar to the report by Fearns et al. [12], CD14 mRNA expression level was enhanced to a statistically significant level in adipose tissues by LPS injection and in 3T3-L1 adipocytes by the incubation with LPS and cytokine(s). LPS interacts with most cells through CD14, which is a 55-kDa glycosylphosphatidylinositol-anchored protein expressed on the cell surface. LPS is then transferred to the transmembrane signaling receptor Tlr4 and its accessory protein MD2 [17,18,27]. Recent studies have revealed that the signaling cascade of Tlr4 is quite similar to that of IL1Rs [28 –31]. LPS activates several intracellular signaling pathways including the InB kinase (IKK) – nuclear factor-nB (NF-nB) pathway [32 – 34]. The endotoxic shock and immunostimulatory effects of LPS are primarily caused

194

K. Fujiwara et al. / Biochimica et Biophysica Acta 1670 (2004) 181–198

through the activation of monocytes and macrophages, leading to uncontrolled production of proinflammatory cytokines such as TNF-a by these cells [35 – 37]. In fact, TNF-a plays a prominent role in mediating many biologic responses to LPS injection. Studies in non-fat tissue have shown that TNF-a, upon binding and oligomerization of TNFR1 and TNFR2, induces several distinct signaling cascade, because their intracellular portions are quite dissimilar. These receptors regulate de novo gene expression through activation of transcription factors, one of which is IKK –NF-nB pathway. Although the pathway leading to NF-nB activation induced by TNF-a is different from the one activated by LPS [38 – 40], there is a cross-talk between LPS and TNF-a signaling [41]. It should be noted that murine GCH gene up to 681 nucleotides upstream of the initiation site reveals a putative NF-nB binding site to be located in a GC-rich region [42] Contrary to C3H/HeN mice, GCH mRNA expression in white and brown adipose tissues obtained from C3H/HeJ mice was not affected at all by LPS (500 Ag) i.p. injection. Exogenous TNF-a readily enhanced GCH mRNA expression levels in both adipose tissues from C3H/HeJ mice. In addition, TNF-a alone and/or the combination of TNF-a and LPS enhanced the mRNA expression levels in white adipose tissue of the genes encoding all of cytokine receptors examined except for IFNGR2. It is already known that the production of cytokines including TNF-a in C3H/HeJ mice is not triggered by exogenous LPS [43 –45]. Collectively, it is reasonable to assume that the following successive events occurred to the adipose tissues: (1) TNFa, IL-1h, IFN-g, and other cytokines were released from the LPS-stimulated macrophages and/or monocytes; (2) these cytokines exerted their effects on adipose tissues through their respective specific receptors; (3) cytokine receptors in the adipose tissues were induced by newly generated cytokines on each other; (4) GCH mRNA was induced as an effect of cytokine(s) on adipose tissues; (5) CD14 mRNA was also induced in adipose tissues as an effect of cytokine(s) on adipose tissues; (6) LPS became allowed to exert its effect directly on adipose tissues via CD14; (7) finally, cytokine(s) and LPS synergistically exerted their effects on adipocytes to induce GCH mRNA. The observations on iNOS mRNA expression in these cells were almost same as those on GCH mRNA expression described just above. In addition, adipose tissue itself is known to synthesize cytokines [4]. These cytokines generated in the adipose tissues exert their effects toward adipose tissue in autocrine and/or paracrine fashion [4]. Because the mice in which TNFR1 and/or TNFR2 were genetically defected were unavailable in this study, the determination of the utility of TNFR subtypes in inducing GCH mRNA expression in adipose tissues was outside the scope of this work. It should be necessary to consider the possibility that the activated macrophages and monocytes invaded into the adipose tissues and synthesized BH4 in the adipose tissues, to which enhanced contents of BH4 in adipose tissues were ascribed. Because the histological investigation is lacking in

this study, our data obtained from the homogenates of the adipose tissues did not allow us to confirm or to deny such a possibility. However, the data obtained from 3T3-L1 cells clearly showed that the combination of LPS and cytokines readily enhanced the intracellular BH4 contents and GCH catalytic activity in these cells (Figs. 1 and 2). This observation supports the view that the adipocytes in the adipose tissue responded to the stimuli of cytokines and LPS and that BH4 biosynthesis was activated in these cells. There have already been reports concerning an LPSstimulated increase in GCH mRNA expression in various cells and tissues [11,46 –48]. In such reports, it was suggested that the increase in GCH mRNA levels should precede the changes in enzyme activity and BH4 content. IFN-g and kit ligand also induced GCH activity in primed T-cells and in bone marrow-derived mast cells obtained from HPH-1 mice, which show a phenylketonuria due to decreased hepatic GCH activity [49]. Although the cloning of the murine GCH gene up to 681 nucleotides upstream of the initiation site revealed a putative NF-nB binding site [42], this NF-nB binding site contained several overlapping potential transcriptional regulator binding sites. Therefore, it is reasonable to speculate that the increase in GCH gene expression by the activation of this NF-nB binding site does not straightforwardly follow. The IFN-g site, another promoter region associated with LPS, was not identified up to about 800 base pairs upstream of the initiation codon [50]. In addition, the aforementioned HPH-1 mice, whose open reading frame of the GCH gene is not affected by the hph-1 mutation, revealed a marked decrease in the steady-state mRNA level specific for the GCH gene [49]. As shown in Figs. 8 and 9, TNFR1 and TNFR2 mRNAs in murine adipose tissues and 3T3-L1 cells were readily induced by i.p. injection of LPS or incubation with LPS and cytokines, respectively. TNF-a is also known to regulate members of the family of signaling proteins termed mitogen-activated protein kinases (MAPK). These molecules propagate signals from the cell surface to the nucleus in defined phosphorylation cascades, and some effects of TNF-a are transduced by MAPK [51]. MAPK, in turn, phosphorylate and activate an array of transcription factors. However, in 3T3-L1 adipocytes, whether all MAPK are constitutively phosphorylated or not (in other words, phosphorylation of MAPK is altered by TNF-a or not) has not been concluded yet [52,53]. In addition, in rat C6 glioma cells, inhibition of extracellular signal-regulated kinase 1/2, one of mammalian MAPK groups, had no effect on TNF-a-induced GCH activity [54]. Therefore, for elucidation of the mechanism for the LPS stimulation leading to increase in GCH mRNA expression and GCH activity in murine tissues, cloning of the murine GCH gene containing the elements in introns, or in far upstream or downstream regions should be done; and/or another cis- or trans-acting elements cross-talking with LPS stimuli should be sought, because forskolin has the ability to induce GCH gene expression in rat vascular muscle cells [55] and cyclic AMP response elements were identified in the promoter of the rat GCH gene [56].

K. Fujiwara et al. / Biochimica et Biophysica Acta 1670 (2004) 181–198

The concurrent up-regulation of iNOS and GCH by LPS injection has been reported in rat hepatocytes [57], rat aorta [58], human umbilical vein smooth muscles [59], rat myocardium [26], rat C6 glioma cells [48], and so on. In C6 glioma cells, TNF-a potentiated the stimulation of NO and BH4 production in which the increased BH4 levels resulted from increased GCH protein and activity rather than from reduced turnover of BH4 [60]. In addition, in rat C6 glioma cells, TNF-a stimulated GCH transcription via a ceramideand NF-nB-independent pathway, whereas TNF-a-induced iNOS induction was regulated by a ceramide- and NF-nBdependent pathway [60]. Inhibitors of the BH4 synthetic pathway have been shown to decrease induced NO synthesis in fibroblasts [61], macrophages [8], and vascular smooth muscle cells [62]. In addition, GCH feedback regulatory protein was not affected by TNF-a in C6 glioma cells [60]. In the white and brown adipose tissues in rats, a significant increase in the iNOS mRNA level was detectable at 2 h after LPS injection, and the expression reached its peak value at 4 h after the injection. In the white adipose tissue, the level of iNOS mRNA returned to the basal level by 8 h after the LPS injection; whereas, in brown adipose tissue, it sustained the high-level expression at 8 h [6]. In murine white adipose tissue, as presented in this paper, the time course of iNOS mRNA expression was almost the same as that of rats. On the contrary, in murine brown adipose tissue, the iNOS mRNA expression level became significantly higher in LPS-injected mice than in vehicleinjected mice at 6 h after the injection. It is unclear at present why the time course of iNOS mRNA expression in the brown adipose tissue was different between mice and rats, although the dose of LPS injected into mice in our experiment (20 mg/kg) was similar to that (15 mg/kg) used for the rats in the experiments performed by Kapur et al. [6]. The GCH mRNA expression level in both white and brown adipose tissues was enhanced to a significantly higher level in LPS (500 Ag)-injected mice than in vehicle-injected mice at 2 h after the injection, and the higher level in LPS (500 Ag)-injected mice was sustained until 6 h after the injection; whereas the significant elevations in GCH activity and BH4 contents in the white and brown adipose tissues in LPS (500 Ag)-injected mice were detected at 6 h after the injection. Kapur et al. [6] reported a remarkable elevation of iNOS activity in rat white and brown adipose tissues at 4 h after LPS injection. It was not to our expectation that iNOS activity in white and brown adipose tissues and differentiated 3T3-L1 adipocytes assayed in the presence of exogenous 3 AM BH4 was not different from the one assayed in the absence of exogenous BH4. The changes of iNOS protein expression levels in adipose tissues and differentiated 3T3-L1 cells caused by the stimulation of LPS and/or cytokines were not so remarkable (Fig. 4). Although the iNOS protein expression levels in adipose tissues and cells were not in accordance with their iNOS mRNA expression levels, the data on immunoblotting analyses of iNOS protein support the data that iNOS catalytic activities were not

195

affected by the stimulation of LPS and/or cytokines in these tissues and cells. Collectively, these observations indicate the possibility that the amount of BH4 present in the adipose tissues and differentiated 3T3-L1 adipocytes in the basal state was sufficient for saturating the iNOS protein in the adipose tissues exposed to endotoxemia. In rat liver, basal BH4 synthesis was adequate to support iNOS activity, whereas BH4 synthesis was increased to support PAH activity in the liver [63]. Taken together, a portion of newly synthesized BH4 could be assigned the roles other than as the cofactor for NOS isoforms. It should be noted that BH4 was also known to modulate the stability of iNOS mRNA in human mesangial cells [64] and rat vascular smooth muscle cells [65]. A reaction between reactive oxygen species and NO has been implicated in the development of cytotoxicity observed during the inflammation [66,67]. Recently, the protective effect of BH4 against NO-induced cytotoxicity was reported in the cell lines HL-60 [68] and PC12 [69], and in rat endothelial cells [25]. As far as NO synthesis is concerned, BH4 is known to act as a modulator of cationic amino acid transport protein CAT-2 mRNA levels in rat cardiac myocytes to augment intracellular arginine availability [70]. In addition, in some tissues and cells, parallel regulation of NO production and BH4 synthesis may not be required or desirable, as observed in BH4-dependent ether lipid metabolism [71] and in the case of ceramide-induced potentiation of NO production [60]. As already described in Introduction, the first physiological role of BH4 to be identified was its action as a protondonating cofactor for L-aromatic amino acid hydroxylation [15]. Therefore, the mRNA expressions of the genes encoding L-aromatic amino acid hydroxylases, namely, TH, TPH, and PAH, were examined by quantitative real-time PCR in our present study in order to examine the possibility of the competition for BH4 among iNOS, TH, TPH, and PAH. The overall levels of mRNA expressions of the genes encoding TH, TPH, and PAH were generally low in adipose tissues and 3T3-L1 adipocytes, although the expression levels were different among the three enzymes. It is unlikely that the adipose tissues are biosynthesizing serotonin, dopamine, noradrenaline, and adrenaline. In white adipose tissue, the mRNA expression levels of the genes encoding PAH, TPH, and TH were not affected by LPS (500 Ag) injection. PAH mRNA expression level in 3T3-L1 adipocytes was rather decreased by the addition of LPS and cytokines in the incubation mixture. Therefore, a competition for BH4 among NOS isoforms and L-aromatic amino acid hydroxylases would be unlikely to happen in white adipose tissue. Contrary to white adipose tissue, PAH mRNA expression level in brown adipose tissue was enhanced by LPS (500 Ag) injection. The amount of PAH mRNA in brown adipose tissue was very low. It is already known that the level of BH4 required for catalytic activity of L-aromatic amino acid hydroxylases is 100-fold higher than that required for the catalytic activities of NOS [72]. In addition, in rat liver, basal BH4 synthesis was adequate to support iNOS activity

196

K. Fujiwara et al. / Biochimica et Biophysica Acta 1670 (2004) 181–198

despite the substantial increase in BH4 synthesis to support PAH activity [63]. Taken together, PAH should be supposed not to necessitate BH4 to an amount which affects iNOS catalytic activity in brown adipose tissue. The physiological roles assigned to brown adipose tissue are different from those to white adipose tissue. For example, brown adipose tissue has been implicated as an important site of facultative energy expenditure because of its capacity to uncouple mitochondrial respiration [73,74]. However, the alterations of BH4 content, GCH catalytic activity and GCH mRNA expression in response to peripheral LPS were almost the same between white and brown adipose tissues, although the basal and the LPS-induced levels of BH4 content in brown adipose tissue were much lower than those in white adipose tissue. The pattern of mRNA expression of the genes encoding the receptors for LPS and cytokines in response to LPS injection observed in brown adipose tissue was almost same as the one observed in white adipose tissue. Collectively, our data do not provide rational answers as to the functional difference mentioned above between these two adipose tissues and the reported longer duration of the sustained iNOS mRNA expression in brown adipose tissue than in white adipose tissue [6]. In this study, we obtained data showing that LPS induced BH4 production in white and brown adipose tissues. These observations thus further broaden the range of phenotypic responses seen in the adipose tissues during acute endotoxemia. However, the evaluation of data concerning the LPS effect on the adipose tissues is very complicated, because endotoxemia caused by peripheral LPS injection can give rise to systemic and regional hemodynamic changes [75]. For example, NO generated in LPS-stimulated adipose tissue causes vasodilation of the adipose tissue microcirculation [76], resulting in the modulation of the adipose tissue function. Therefore, we must define the physiological phenomena, in addition to the enhanced catalytic activity of iNOS, triggered by LPS-induced BH4 production in white and brown adipose tissues, as well as elucidate the precise mechanism for the LPS-induced increase in BH4 content in the adipose tissues. These problems are the next tasks to be undertaken in our laboratory.

Acknowledgements

[3]

[4]

[5]

[6] [7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15] [16] [17]

[18]

[19] [20]

This work was supported by grants-in-aid from Fujita Health University, Japan, to AO. We thank Ms. Rie´ Chiba and Ms. Sayoko Nishio for their technical help.

References [1] L.A. Campfield, F.J. Smith, Y. Guisez, R. Devos, P. Burn, Recombinant mouse OB protein: evidence for a peripheral signal linking adiposity and central neural networks, Science 269 (1995) 546 – 549. [2] J.L. Halaas, K.S. Gajiwala, M. Maffei, S.L. Cohen, B.T. Chait, D. Rabinowitz, R.L. Lallone, S.K. Burley, J.M. Friedman, Weight-reduc-

[21]

[22]

[23]

ing effects of the plasma protein encoded by the obese gene, Science 269 (1995) 543 – 546. M.A. Pelleymounter, M.J. Cullen, M.B. Baker, R. Hecht, D. Winters, T. Boone, F. Collins, Effects of the obese gene product on body weight regulation in ob/ob mice, Science 269 (1995) 540 – 543. G.S. Hotamisligil, N.S. Shargill, B.M. Spiegelman, Adipose expression of tumor necrosis factor-a: direct role in obesity-linked insulin resistance, Science 259 (1993) 87 – 91. C. Ribie`re, A.M. Jaubert, N. Gaudiot, D. Sabourault, M.L. Marcus, J.L. Boucher, D. Denis-Henriot, Y. Giudicelli, White adipose tissue nitric oxide synthase: a potential source for NO production, Biochem. Biophys. Res. Commun. 222 (1996) 706 – 712. S. Kapur, B. Marcotte, A. Marette, Mechanism of adipose tissue iNOS induction in endotoxemia, Am. J. Physiol. 276 (1999) E635 – E641. H.J. Cho, Q.W. Xie, J. Calaycay, R.A. Mumford, K.M. Swiderek, T.D. Lee, C. Nathan, Calmodulin is a subunit of nitric oxide synthase from macrophages, J. Exp. Med. 176 (1992) 599 – 604. N. Sakai, S. Kaufman, S. Milstein, Tetrahydrobiopterin is required for cytokine-induced nitric oxide production in a murine macrophage cell line (RAW 264), Mol. Pharmacol. 43 (1993) 6 – 10. T. Nagatsu, S. Matsuura, T. Sugimoto, Physiological and clinical chemistry of biopterin, in: G. de Stevens (Ed.), Medical Research Reviews, vol. 9, Willey, New York, 1989, pp. 25 – 44. G. Werner-Felmayer, H. Prast, E.R. Werner, A. Philippu, H. Wachter, Induction of GTP cyclohydrolase I by bacterial lipopolysaccharide in the rat, FEBS Lett. 322 (1993) 223 – 226. Y. Hattori, M. Oka, K. Kasai, N. Nakanishi, S.I. Shimoda, Lipopolysaccharide treatment in vivo induces tissue expression of GTP cyclohydrolase I mRNA, FEBS Lett. 368 (1995) 336 – 338. C. Fearns, V.V. Kravchenko, R.J. Ulevitch, D.J. Loskutoff, Murine CD14 gene expression in vivo: extramyeloid synthesis and regulation by lipopolysaccharide, J. Exp. Med. 181 (1995) 857 – 866. H.A. MacQueen, C.M. Pond, Immunofluorescent localisation of tumour necrosis factor-a receptors on the popliteal lymph node and the surrounding adipose tissue following a simulated immune challenge, J. Anat. 192 (1998) 223 – 231. P. Linscheid, U. Keller, N. Blau, D.J. Schaer, B. Mu¨ller, Diminished production of nitric oxide synthase cofactor tetrahydrobiopterin by rosiglitazone in adipocytes, Biochem. Pharmacol. 65 (2003) 593 – 598. S. Kaufman, Studies on the mechanism of the enzymatic conversion of phenylalanine to tyrosine, J. Biol. Chem. 234 (1959) 2677 – 2682. B.M. Sultzer, Genetic control of leucocyte responses to endotoxin, Nature 219 (1968) 1253 – 1254. A. Poltorak, X. He, I. Smirnova, M.Y. Liu, C. Van Huffel, X. Du, D. Birdwell, E. Alejos, M. Silva, C. Galanos, M. Freudenberg, P. Ricciardi-Castagnoli, B. Layton, B. Beutler, Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene, Science 282 (1998) 2085 – 2088. S.T. Qureshi, L. Larivie`re, G. Leveque, S. Clermont, K.J. Moore, P. Gros, D. Malo, Endotoxin-tolerant mice have mutations in Toll-like receptor 4 (Tlr4), J. Exp. Med. 189 (1999) 615 – 625. T. Fukushima, J.C. Nixon, Analysis of reduced forms of biopterin in biological tissues and fluids, Anal. Biochem. 102 (1980) 176 – 188. Y.S. Kaneko, K. Mori, A. Nakashima, I. Nagatsu, T. Nagatsu, A. Ota, Determination of tetrahydrobiopterin in murine locus coeruleus by HPLC with fluorescence detection, Brain Res. Protoc. 8 (2001) 25 – 31. A. Ota, S. Yoshida, T. Nomura, S. Matsui, Y. Hagino, K. Umezawa, S. Katoh, T. Nagatsu, Tetrahydrobiopterin biosynthesis enhanced by lipopolysaccharide stimulation in murine neuroblastoma cell line N1E115, J. Neurochem. 67 (1996) 2540 – 2548. C. Hofmann, K. Lorenz, S.S. Braithwaite, J.R. Colca, B.J. Palazuk, G.S. Hotamisligil, B.M. Spiegelman, Altered gene expression for tumor necrosis factor-a and its receptors during drug and dietary modulation of insulin resistance, Endocrinology 134 (1994) 264 – 270. P. Matsudaira, Sequence from picomole quantities of proteins electroblotted onto polyvinylidene difluoride membranes, J. Biol. Chem. 262 (1987) 10035 – 10038.

K. Fujiwara et al. / Biochimica et Biophysica Acta 1670 (2004) 181–198 [24] K. Mori, Y.S. Kaneko, A. Nakashima, K. Fujiwara, I. Nagatsu, A. Ota, Effect of peripheral lipopolysaccharide injection on dopamine content in murine anterior olfactory nucleus, J. Neural Transm. 110 (2003) 31 – 50. [25] S. Shimizu, M. Ishii, Y. Kawakami, K. Momose, T. Yamamoto, Protective effects of tetrahydrobiopterin against nitric oxide-induced endothelial cell death, Life Sci. 63 (1998) 1585 – 1592. [26] Y. Hattori, S. Hattori, S. Motohashi, K. Kasai, S.I. Shimoda, N. Nakanishi, Co-induction of nitric oxide and tetrahydrobiopterin synthesis in the myocardium in vivo, Mol. Cell. Biochem. 166 (1997) 177 – 181. [27] H. Yang, D.W. Young, F. Gusovsky, J.C. Chow, Cellular events mediated by lipopolysaccharide-stimulated toll-like receptor 4: MD-2 is required for activation of mitogen-activated protein kinases and Elk-1, J. Biol. Chem. 275 (2000) 20861 – 20866. [28] T.K. Means, D.T. Golenbock, M.J. Fenton, Structure and function of Toll-like receptor proteins, Life Sci. 68 (2000) 241 – 258. [29] J.L. Imler, J.A. Hoffmann, Toll and Toll-like proteins: an ancient family of receptors signaling infection, Rev. Immunogenet. 2 (2000) 294 – 304. [30] R.J. Ulevitch, Molecular mechanisms of innate immunity, Immunol. Res. 21 (2000) 49 – 54. [31] K. Takeda, S. Akira, Roles of Toll-like receptors in innate immune responses, Genes Cells 6 (2001) 733 – 742. [32] J.M. Mu¨ller, H.W. Ziegler-Heitbrock, P.A. Baeuerle, Nuclear factor kappa B, a mediator of lipopolysaccharide effects, Immunobiology 187 (1993) 233 – 256. [33] C. Fischer, S. Page, M. Weber, T. Eisele, D. Neumeier, K. Brand, Differential effects of lipopolysaccharide and tumor necrosis factor on monocytic InB kinase signalsome activation and InB proteolysis, J. Biol. Chem. 274 (1999) 24625 – 24632. [34] K.A. Fitzgerald, E.M. Palsson-McDermott, A.G. Bowie, C.A. Jefferies, A.S. Mansell, G. Brady, E. Brint, A. Dunne, P. Gray, M.T. Harte, D. McMurray, D.E. Smith, J.E. Sims, T.A. Bird, L.A. O’Neill, Mal (MyD88-adapter-like) is required for Toll-like receptor-4 signal transduction, Nature 413 (2001) 78 – 83. [35] B. Beutler, I.W. Milsark, A.C. Cerami, Passive immunization against cachectin/tumor necrosis factor protects mice from lethal effect of endotoxin, Science 229 (1985) 869 – 871. [36] K.J. Tracey, B. Beutler, S.F. Lowry, J. Merryweather, S. Wolpe, I.W. Milsark, R.J. Hariri, T.J. Fahey III, A. Zentella, J.D. Albert, G.T. Shires, A. Cerami, Shock and tissue injury induced by recombinant human cachectin, Science 234 (1986) 470 – 474. [37] M.F. Tsan, R.N. Clark, S.M. Goyert, J.E. White, Induction of TNF-a and MnSOD by endotoxin: role of membrane CD14 and Toll-like receptor-4, Am. J. Physiol. 280 (2001) C1422 – C1430. [38] H. Hsu, J. Xiong, D.V. Goeddel, The TNF receptor 1-associated protein TRADD signals cell death and NF-nB activation, Cell 81 (1995) 495 – 504. [39] H. Hsu, H.B. Shu, M.G. Pan, D.V. Goeddel, TRADD-TRAF2 and TRADD-FADD interactions define two distinct TNF receptor 1 signal transduction pathways, Cell 84 (1996) 299 – 308. [40] H. Hsu, J. Huang, H.B. Shu, V. Baichwal, D.V. Goeddel, TNF-dependent recruitment of the protein kinase RIP to the TNF receptor-1 signaling complex, Immunity 4 (1996) 387 – 396. [41] Y. Takada, B.B. Aggarwal, Genetic deletion of the tumor necrosis factor receptor p60 or p80 sensitizes macrophages to lipopolysaccharide-induced nuclear factor-nB, mitogen-activated protein kinases, and apoptosis, J. Biol. Chem. 278 (2003) 23390 – 23397. [42] M. Shimoji, K. Hirayama, K. Hyland, G. Kapatos, GTP cyclohydrolase I gene expression in the brains of male and female hph-1 mice, J. Neurochem. 72 (1999) 757 – 764. [43] R.N. Apte, O. Ascher, D.H. Pluznik, Genetic analysis of generation of serum interferon by bacterial lipopolysaccharide, J. Immunol. 119 (1977) 1898 – 1902. [44] A.H. Ding, F. Porteu, E. Sanchez, C.F. Nathan, Shared actions of endotoxin and taxol on TNF receptors and TNF release, Science 248 (1990) 370 – 372.

197

[45] Q. Yuan, F. Zhao, S.W. Chung, P. Fan, B.M. Sultzer, Y.W. Kan, P.M. Wong, Dominant negative down-regulation of endotoxin-induced tumor necrosis factor a production by Lpsd/Ran, Proc. Natl. Acad. Sci. U. S. A. 97 (2000) 2852 – 2857. [46] Y. Hattori, S.S. Gross, GTP cyclohydrolase I mRNA is induced by LPS in vascular smooth muscle: characterization, sequence and relationship to nitric oxide synthase, Biochem. Biophys. Res. Commun. 195 (1993) 435 – 441. [47] J.-L. Balligand, D. Ungureanu-Longrois, W.W. Simmons, D. Pimental, T.A. Malinski, M. Kapturczak, Z. Taha, C.J. Lowenstein, A.J. Davidoff, R.A. Kelly, T.W. Smith, T. Michel, Cytokine-inducible nitric oxide synthase (iNOS) expression in cardiac myocytes; characterization and regulation of iNOS expression and detection of iNOS activity in single cardiac myocytes in vitro, J. Biol. Chem. 269 (1994) 27580 – 27588. [48] C. D’Sa, K. Hirayama, A. West, M. Hahn, M. Zhu, G. Kapatos, Tetrahydrobiopterin biosynthesis in C6 glioma cells: induction of GTP cyclohydrolase I gene expression by lipopolysaccharide and cytokine treatment, Mol. Brain Res. 41 (1996) 105 – 110. [49] M. Gu¨tlich, I. Ziegler, K. Witter, B. Hemmens, L. Hultner, J.D. McDonald, T. Werner, W. Ro¨dl, A. Bacher, Molecular characterization of HPH-1: a mouse mutant deficient in GTP cyclohydrolase I activity, Biochem. Biophys. Res. Commun. 203 (1994) 1675 – 1681. [50] H. Ichinose, T. Ohye, Y. Matsuda, T. Hori, N. Blau, A. Burlina, B. Rouse, R. Matalon, K. Fujita, T. Nagatsu, Characterization of mouse and human GTP cyclohydrolase I genes: mutations in patients with GTP cyclohydrolase I deficiency, J. Biol. Chem. 270 (1995) 10062 – 10071. [51] J.M. Kyriakis, Activation of the AP-1 transcription factor by inflammatory cytokines of the TNF family, Gene Expr. 7 (1999) 217 – 231. [52] R.G. Jain, K.D. Phelps, P.H. Pekala, Tumor necrosis factor-a initiated signal transduction in 3T3-L1 adipocytes, J. Cell. Physiol. 179 (1999) 58 – 66. [53] M. Ryde´n, A. Dicker, V. van Harmelen, H. Hauner, M. Brunnberg, L. Perbeck, F. Lo¨nnqvist, P. Arner, Mapping of early signaling events in tumor necrosis factor-a-mediated lipolysis in human fat cells, J. Biol. Chem. 277 (2002) 1085 – 1091. [54] L.R. Vann, S.G. Payne, L.C. Edsall, S. Twitty, S. Spiegel, S. Milstien, Involvement of sphingosine kinase in TNF-a-stimulated tetrahydrobiopterin biosynthesis in C6 glioma cells, J. Biol. Chem. 277 (2002) 12649 – 12656. [55] T. Scott-Burden, E. Elizondo, T. Ge, C.M. Boulanger, P.M. Vanhoutte, Simultaneous activation of adenylyl cyclase and protein kinase C induces production of nitric oxide by vascular smooth muscle cells, Mol. Pharmacol. 46 (1994) 274 – 282. [56] G. Kapatos, S.L. Stegenga, K. Hirayama, Identification and characterization of basal and cyclic AMP response elements in the promoter of the rat GTP cyclohydrolase I gene, J. Biol. Chem. 275 (2000) 5947 – 5957. [57] D.A. Geller, M. Di Silvio, T.R. Billiar, K. Hatakeyama, GTP cyclohydrolase I is coinduced in hepatocytes stimulated to produce nitric oxide, Biochem. Biophys. Res. Commun. 276 (2000) 633 – 641. [58] S. Shimizu, M. Ishii, Y. Kawakami, Y. Kiuchi, K. Momose, T. Yamamoto, Presence of excess tetrahydrobiopterin during nitric oxide production from inducible nitric oxide synthase in LPS-treated rat aorta, Life Sci. 65 (1999) 2769 – 2779. [59] R. Walter, P. Linscheid, N. Blau, L. Kierat, A. Schaffner, G. Schoedon, Induction of tetrahydrobiopterin synthesis in human umbilical vein smooth muscle cells by inflammatory stimuli, Immunol. Lett. 60 (1998) 13 – 17. [60] L.R. Vann, S. Twitty, S. Spiegel, S. Milstien, Divergence in regulation of nitric-oxide synthase and its cofactor tetrahydrobiopterin by tumor necrosis factor-a: ceramide potentiates nitric oxide synthesis without affecting GTP cyclohydrolase I activity, J. Biol. Chem. 275 (2000) 13275 – 13281. [61] G. Werner-Felmayer, E.R. Werner, D. Fuchs, A. Hausen, G. Reibnegger, H. Wachter, Tetrahydrobiopterin-dependent formation of

198

[62]

[63]

[64]

[65]

[66]

[67] [68]

[69]

K. Fujiwara et al. / Biochimica et Biophysica Acta 1670 (2004) 181–198 nitrite and nitrate in murine fibroblasts, J. Exp. Med. 172 (1990) 1599 – 1607. S.S. Gross, R. Levi, Tetrahydrobiopterin synthesis. An absolute requirement for cytokine-induced nitric oxide generation by vascular smooth muscle, J. Biol. Chem. 267 (1992) 25722 – 25729. C.M. Pastor, D. Williams, T. Yoneyama, K. Hatakeyama, S. Singleton, E. Naylor, T.R. Billiar, Competition for tetrahydrobiopterin between phenylalanine hydroxylase and nitric oxide synthase in rat liver, J. Biol. Chem. 271 (1996) 24534 – 24538. M. Saura, D. Perez-Sala, F.J. Canada, S. Lamas, Role of tetrahydrobiopterin availability in the regulation of nitric-oxide synthase expression in human mesangial cells, J. Biol. Chem. 271 (1996) 14290 – 14295. P. Linscheid, A. Schaffner, G. Schoedon, Modulation of inducible nitric oxide synthase mRNA stability by tetrahydrobiopterin in vascular smooth muscle cells, Biochem. Biophys. Res. Commun. 243 (1998) 137 – 141. C. Szabo, S. Cuzzocrea, B. Zingarelli, M. O’Connor, A.L. Salzman, Endothelial dysfunction in a rat model of endotoxic shock. Importance of the activation of poly (ADP-ribose) synthetase by peroxynitrite, J. Clin. Invest. 100 (1997) 723 – 735. H. Maeda, T. Akaike, Nitric oxide and oxygen radicals in infection, inflammation, and cancer, Biochemistry (Mosc.) 63 (1998) 854 – 865. S. Kojima, K. Nimura, H. Komatsu, T. Taguchi, H. Iizuka, Modulation of S-nitroso-N-acetyl-D,L-penicillamine (SNAP) induced HL-60 cell death by tetrahydrobiopterin, Anticancer Res. 17 (1997) 929 – 937. K. Koshimura, Y. Murakami, J. Tanaka, Y. Kato, Self-protection of

[70]

[71]

[72]

[73]

[74]

[75]

[76]

PC12 cells by 6R-tetrahydrobiopterin from nitric oxide toxicity, J. Neurosci. Res. 54 (1998) 664 – 672. I.F. Schwartz, D. Schwartz, Y. Wollman, T. Chernichowski, M. Blum, Y. Levo, A. Iaina, Tetrahydrobiopterin augments arginine transport in rat cardiac myocytes through modulation of CAT-2 mRNA, J. Lab. Clin. Med. 137 (2001) 356 – 362. B. Kosar-Hashemi, H. Taguchi, W.L. Armarego, Glyceryl ether monooxygenase [EC 1.14.16.5]: stoichiometry and inhibition, Adv. Exp. Med. Biol. 338 (1993) 93 – 96. J. Giovanelli, K.L. Campos, S. Kaufman, Tetrahydrobiopterin, a cofactor for rat cerebellar nitric oxide synthase, does not function as a reactant in the oxygenation of arginine, Proc. Natl. Acad. Sci. U. S. A. 88 (1991) 7091 – 7095. B.B. Lowell, V. S-Susulic, A. Hamann, J.A. Lawitts, J. HimmsHagen, B.B. Boyer, L.P. Kozak, J.S. Flier, Development of obesity in transgenic mice after genetic ablation of brown adipose tissue, Nature 366 (1993) 740 – 742. S. Enerback, A. Jacobsson, E.M. Simpson, C. Guerra, H. Yamashita, M.E. Harper, L.P. Kozak, Mice lacking mitochondrial uncoupling protein are cold-sensitive but not obese, Nature 387 (1997) 90 – 94. S.M. Gardiner, P.A. Kemp, J.E. March, T. Bennett, Cardiac and regional haemodynamics, inducible nitric oxide synthase (NOS) activity, and the effects of NOS inhibitors in conscious, endotoxaemic rats, Br. J. Pharmacol. 116 (1995) 2005 – 2016. E. Nisoli, C. Tonello, L. Briscini, M.O. Carruba, Inducible nitric oxide synthase in rat brown adipocytes: implications for blood flow to brown adipose tissue, Endocrinology 138 (1997) 676 – 682.