- Email: [email protected]
Th1 response during ribavirin and interferon-α combination therapy in chronic hepatitis C
Hepatology Research 34 (2006) 104–110
Th1 response during ribavirin and interferon-␣ combination therapy in chronic hepatitis C Koju Kobayashi a,∗ , Yoshiyuki Ueno b , Yoshie Kobayashi c , Takehiro Akahane d , Shuichi Satoh e , Kumiko Kikuchi f , Hiromasa Okamoto g , Motoyasu Ishii h , Tooru Shimosegawa b , Miyagi Ribavirin Study Group a
Tohoku University, School of Health Sciences and Comprehensive Research and Education, Center for Planning of Drug Development and Clinical Evaluation, Japan b Department of Gastroenterology, Tohoku University Graduate School of Medicine, Japan c Department of Internal Medicine, Tohoku Teishin Hospital, Japan d Department of Gastroenterology, Ishinomaki City Hospital, Japan e Department of Internal Medicine, Kurihara Municipal Hospital, Japan f Department of Internal Medicine, Iwai Hospital, Japan g Department of Gastroenterology, Shirakawa Hospital, Japan h Department of Internal Medicine, Kurokawa Hospital, Japan
Received 29 October 2004; received in revised form 4 March 2005; accepted 9 November 2005 Available online 27 December 2005
Abstract Ribavirin and interferon-␣ induce Th1 polarization of human CD4+ T cells. The study was conducted to investigate the whether cellular immune response during ribavirin/interferon-␣ therapy is associated with viral eradication by examining mRNA expression of molecules relevant to Th1 and Th2 polarization in CD4+ cells of 13 patients with chronic hepatitis C (seven patients with sustained viral response and six with transient response). Peripheral CD4+ T lymphocytes at 0, 4 and 24 weeks of treatment were tested. There were no significant differences in the mRNA levels at each point of time of the treatment between patients with sustained viral response and those with transient response. The percent increase in mRNA level of the IL-12R 2 chain from the baseline to the end of the treatment was significantly higher in patients with sustained viral response (15.3 ± 6.1%) than in those with transient response (−1.6 ± 4.7%, p < 0.05). There was no significant difference in percent changes in level of IL-12R 1 chain mRNA between the two groups. In conclusion, the results of this study indicate that the increase of Th1 response is related to the inflammatory activity in the liver and possibly to ribavirin and interferon-␣ therapy. It is also suggested that the measurement of Th1 response has the potential to distinguish patients with relapse from those with sustained virus response. © 2005 Elsevier Ireland Ltd. All rights reserved. Keywords: CD4+ T-lymphocyte; Chronic hepatitis C; Interferon-␥; Interle3ukin-12 receptor; Ribavirin
1. Introduction Ribavirin, a synthetic guanosine nucleoside analogue, is widely used for the treatment of chronic hepatitis C in combi∗ Corresponding author at: School of Health Sciences, Tohoku University, 2-1 Seiryo-machi, Aoba-ku, Sendai 980-8575, Japan. Tel.: +81 22 717 7929; fax: +81 22 717 7910. E-mail address: [email protected] (K. Kobayashi).
1386-6346/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.hepres.2005.11.002
nation with interferon (IFN)-␣ [1]. Combination therapy with ribavirin and IFN-␣ has been shown to have a higher response rate both at the end of treatment and at the end of follow-up when compared with IFN-␣ monotherapy [2,3]. However, there are two types of viral response after the loss of serum HCV RNA during treatment, that is, sustained virus loss and relapse of viral replication after withdrawal of treatment, the latter of which may be due to incomplete immune-mediated removal of infected cells [4–6].
K. Kobayashi et al. / Hepatology Research 34 (2006) 104–110
105
Table 1 Baseline characteristics of the 13 patients with chronic hepatitis C Characteristics
Total
SVR
REL
p
N Gender (male/female) Age in years, median (range)
13 11/2 41 (20–62)
7 6/1 31 (20–54)
6 5/1 51 (41–62)
NS <0.05
Source or type of infection, n (%) Blood transfusion Tattoo Sporadic, or unknown ALT IU/I, median (range)
3 0 10 85 (54–608)
1 0 6 85 (54–608)
2 0 4 114 (77–275)
HCV genotype Genotype 1 Genotype 2 + 3 HCV RNA kcopies/ml, median (range)
6 7 350 (260–>850)
1 6 350 (260–>850)
5 1 250 (250–650)
Fibrosis score 0 1 2 3 4 Undetermined
4 1 2 1 1 4
3 1 0 0 1 2
1 0 2 1 0 2
Activity score 1 2 Undetermined
3 6 4
3 2 2
0 4 2
NS NS <0.05 NS
NS
NS
Development of an HCV-specific Th1 response is observed with the resolution of acute infection with virus clearance [7,8], while loss of the Th1 response is associated with the development of chronic infection [9]. Therefore, it is expected that failure to develop an effective cellular immune response during ribavirin/IFN-␣ treatment in chronic HCV infection may be associated with viral persistence. In previous studies in vitro, we have shown that both ribavirin and IFN-␣ may have a modulating effect on the Th1 polarization of human peripheral CD4+ T cells through the up-regulation of mRNA for the interleukin (IL)-12 receptor 2 chain (IL-12R 2 chain) in patients with hepatitis C and the normal volunteers [10,11]. To investigate whether such cellular immune response during combination therapy of ribavirin and IFN-␣ may be associated with sustained viral response, we compared the expression of mRNA for molecules, which are relevant to the development of Th1 and Th2 in CD4+ T cells ex vivo between patients with sustained viral response and those with transient viral response.
Declaration of Helsinki and was approved by the Institution’s human research committee. The patients entered in the study received recombinant IFN-␣ at a dose of 6 or 10 mU daily for the first 2 weeks and thrice weekly for the subsequent 22 weeks. They were also received ribavirin at a dose of 600 mg/day (300 mg twice a day) for patients weighing <60 kg and 800 mg/day (400 mg twice a day) for patients weighing >60 kg. Further characteristics of the patients are listed in Table 1. As control subjects, 15 healthy individuals were also included in the study (six males and nine females, age 48.9 ± 9.7 years old). Samples for analysis of mRNA level were obtained just before the beginning of treatment (W0), at 4 weeks of the treatment (W4) and at the end of the treatment (W24). After sampling, the blood was immediately processed for separation of peripheral blood mononuclear cells (PBMC) separation (as described below).
2. Patients and methods
PBMC were isolated from patients by gradient centrifugation over Ficoll Hypaque. PBMC (1 × 106 cells in a volume of 500 l) were resuspended in phosphate buffered saline (PBS). Using anti-CD4 antibody coated magnetic beads (Dynabeads CD4, Dynal Biotec, Oslo, Norway), CD4+ lymphocytes were separated according to the manufacturer’s instructions. For the measurement of cytokine mRNA level in CD4+ cells, total RNA was isolated using Isogen (Nippon Gene, Toyama, Japan). cDNA was synthesized from
2.1. Patients and treatment The study included 13 patients with serologically (antiHCV antibodies and HCV RNA positive) and histologically demonstrated chronic hepatitis C. Informed consent was obtained from each subject included in the study. The study protocol conforms to the ethical guidelines of the 1975
2.2. Preparation of PBMC and extraction of cellular RNA
106
K. Kobayashi et al. / Hepatology Research 34 (2006) 104–110
total RNA using random hexamers and M-MRV (Invitrogen, Carlsbad, CA).
monitorTM test (Roche Diagnostic Systems, Branchburg, NJ). The lowest level of detection of this test is 200 HCV RNA copies/ml of sample.
2.3. Realtime RT-PCR 2.5. Statistical analysis Quantifications of mRNA for IFN-␥, IL-4, and IL-12R 1 and 2 chains were performed on an ABI PRISM 7700 Sequence Detector (Perkin-Elmer Applied Biosystems, Foster City, CA) using predeveloped Taqman reagents including primers and probes for IFN-␥, IL-4 and GAPDH according to the manufacturer’s instructions [11]. Primers and probes for the amplification and quantification of the IL-12R 1 chain and the 2 chain mRNA were deduced from the reported nucleotide sequence [12]: 1 chain: forward (nt.1049–1069) AACCAGACGTGGCACATTCCT, reverse (nt.1138–1159) CCAATACATGGTGGTCCCGTT, probe (nt.1087–1116) ACCAGTGGCTCTGAATATCAGCGTCGGAAC; 2 chain: forward (nt.3113–3136) CAGCACATCTCCCTTTCTGTTTTC, reverse (nt.3254–3276) ACTTTAAGGCTTGAAGCCTCACC, probe (nt.3140–3169) TCAAGTTCTCTTCACCCACTCACCTTCTCC. Primers and probes for IFN-␥ and IL-4 mRNA were as follows: IFN-␥: forward (nt.463–486) CGAGATGACTTCGAAAAGCTGACT, reverse (nt.570–592) TTTTGTCCCTTCGCTTTTTTC, probe (nt.541–566) CAAGTGATGGCTGAACTGTCGCCAGC; IL-4: forward (nt.66–85) GGGTCTCACCTCCCAACTGC, reverse (nt.285–305) ACACGAGGCCGTCAAGATGTC, probe (nt.114–135) TGCCGGCAACTTTGTCCACGGA. Amplification of GAPDH was performed for each experimental sample as an endogenous control. Threshold cycle C1, which is inversely correlated with the target mRNA levels, was determined as the cycle number at which the reporter fluorescent emission increased above the threshold level. The amount of target mRNA was compared with that of standard DNA, which was obtained by the cloning of PCR products into plasmid vectors, and expressed as log copies/g total RNA. Variations between experiments were verified to be less than 10% by four repeated measurements on the same cDNA preparation from a healthy subject. Lower detection level of each cytokine mRNA by this assay was 100 copies/g total RNA. Changes of mRNAs between weeks 0, 4 and 24 were calculated as follows: changes between weeks 0 and 4 (0–4) = ((mRNA level at week 4 − mRNA level at week 0)/mRNA level at week 0) × 100, and changes between weeks 0 and 24 (0–24) = ((mRNA level at week 24 − mRNA level at week 0)/mRNA level at week 0) × 100. Changes of levels of these mRNA were compared between the two groups of patients to evaluate the possibility of clinical usability in estimating the viral relapse after the therapy. 2.4. HCV RNA Quantification of HCV RNA in serum samples was performed using a commercially available kit: Amplicor HCV
Non-parametrical analysis of sequential changes in cytokine mRNA levels was performed using Friedman’s test. For the analysis of percent increase in cytokine mRNA level as a factor of viral responses, the Mann–Whitney U-test was employed. For comparison of mRNA level at each time point among patients with different HCV genotypes, oneway ANOVA or Dunnett’s t-test was used. P-values of <0.05 were considered to be statistically significant.
3. Results 3.1. Virological responses All 13 patients completed the 24-week ribavirin/IFN-␣ therapy. At the end of the treatment, serum HCV RNA was detected in none of the 13 patients. At the end of the 24-week follow-up after the treatment, serum HCV RNA became positive in six patients (relapse, REL) and remained negative in seven patients (sustained viral response, SVR). Two baseline factors were found to be significantly different between patients with SVR and those with REL, namely HCV genotype (1b versus others, p = 0.029) and age (>40 years old versus ≤40 years old, p = 0.046, Table 1). 3.2. Cytokine mRNA level in CD4+ cells Expression levels of IL-12R 1 and 2 chains, IFN-␥ and IL-4 at pretreatment in 13 patients with chronic hepatitis C were compared with those of 15 normal subjects. The comparison showed no statistical difference in mRNAs for IL-12R 1 and 2 chains between patients and healthy subjects (Table 2). Expression of IFN-␥ mRNA was significantly higher in patients with chronic hepatitis C (p < 0.001). Baseline cytokine mRNA level in CD4+ cells in patients with chronic hepatitis C was not correlated with clinical findings such as HCV virus load, HCV genotypes, serum levels of ALT, liver fibrosis grade or liver histological activity (Table 2). Sequential measurement of changes in mRNA level in CD4+ cells during the treatment showed no substantial changes in the level of mRNA for IL-12R 1 chain, IL-12R 2 chain, IFN-␥ and IL-4 when the average of 13 patients was compared between three sampling points (Table 3). Expression level of each mRNA was not significantly different between SVR and REL (Table 3 and Fig. 1). IL-4 mRNA was detectable in seven patients at week 0, 10 patients at week 4 and 11 patients at week 24, although expression of IL-4 mRNA was at low levels near detection limits in most cases. Due to the possibility of unstable results near detection
K. Kobayashi et al. / Hepatology Research 34 (2006) 104–110
107
Table 2 Baseline level of cytokine mRNA and clinical factors Characteristics
N
IL-12R 1 chaina
Patient group Hepatitis C Normal subjects
13 15
5.23 (0.12) 3.01 (1.26)
Age in years >40 ≤40
4 9
ALT (IU/I) >100 ≤100
IL-12R 2 chaina
IFN-␥
IL-4a,b
5.01 (0.11) 3.02 (1.05)
5.31 (0.11) 2.02 (0.76)
2.08 (0.06) ND
4.95 (0.32) 5.36 (0.10)
5.00 (0.25) 5.02 (0.12)
5.03 (0.25) 5.44 (0.10)
<2.00 2.12 (0.09)
7 6
5.19 (0.13) 5.71 (0.09)
5.01 (0.18) 4.98 (0.25)
5.36 (0.13) 5.42 (0.11)
<2.00 2.10 (0.10)
HCV genotype Genotype 1 Genotype 2 + 3
6 7
5.27 (0.14) 5.20 (0.21)
4.97(0.15) 5.06 (0.16)
5.40 (0.15) 5.24 (0.19)
2.18 (0.13) <2.00
HCV RNA (kcopies/ml) >400 ≤400
6 7
5.04 (0.12) 5.34 (0021)
4.85 (0.28) 2.10 (0.12)
5.30 (0.13) 5.30 (0.19)
<2.00 2.04 (0.04)
Fibrosis score 0, 1, 2 3, 4
7 6
5.55 (0.17) 5.34 (0.16)
4.81 (0.01) 5.04 (0.20)
5.31 (0.06) 5.45 (0.12)
2.15 (0.15) <2.00
Activity score 1 2
5 8
5.24 (0.20) 5.58 (0.10)
4.97 (0.26) 50.0 (0.18)
5.47 (0.17) 5.37 (0.09)
2.06 (0.06) <2.00
Baseline level of each cytokine was compared in association with various clinical factors by Student’s t test; ND: not detected. a log copies/g RNA. Data indicate mean and standard error in parentheses. b Comparison was made using seven cases with detectable IL-4 mRNA.
Table 3 Level of mRNA for cytokines at three sampling points during ribavirin and IFN-␣ therapy mRNAa
Weeks in therapy 4
24
IL-12R 1 chain Total 5.23 (0.12) SVR 5.17 (0.20) REL 5.29 (0.15)
0
5.30 (0.16) 5.19 (0.12) 5.43 (0.32)
5.02 (0.10) 4.96 (0.16) 5.08 (0.11)
IL-12R 2 chain Total 5.01 (0.11) SVR 4.93 (0.15) REL 5.11 (0.16)
5.38 (0.18) 5.27 (0.27) 5.51 (0.22)
5.36 (0.19) 5.66 (0.29) 5.00 (0.215)
IFN-␥ Total SVR REL
5.31 (0.11) 5.14 (0.15) 5.52 (0.14)
5.21 (0.12) 5.03 (0.13) 5.42 (0.20)
5.26 (0.10) 5.28 (0.16) 5.21 (0.10)
IL-4b Total SVR REL
2.08 (0.06) 2.00 (0.00) 2.18 (0.13)
2.06 (0.05) 2.09 (0.09) 2.03 (0.03)
2.15 (0.05) 2.16 (0.08) 2.13 (0.08)
a
log copies/g RNA. Data indicate mean, and standard error in parenthe-
ses. b Data for IL-4 mRNA level was positive in 7 (2 SVR and 5 REL) of 13 cases at week 0, 10 (5 SVR and 5 REL) at week 4 and 11 (5 SVR and 6 REL) at week 24.
limits of realtime PCR, statistical analysis was not performed on the expression of IL-4 mRNA. Comparison was made to find the difference of changes in mRNA using the percent change of mRNA level. Percent increase in level of mRNA for IL-12R 2 chain from baseline to the end of the treatment was significantly higher in patients with SVR (15.3 ± 6.1%) than in those with REL (1.6 ± 4.7%, p < 0.05, Table 4). Percent changes in the level of mRNA for IFN-␥ from the baseline to the end of the treatment was 3.1 ± 3.3% in patients with SVR and −5.3 ± 2.7% in REL, but the difference was not statistically significant. There was no significant difference in percent changes in the level of mRNA for the IL-12R 1 chain between the two groups (−3.8 ± 2.1% for SVR versus −3.5 ± 4.0% for REL, data not shown). Since mRNA for IL-4 was detected in only one subject at week 4, in four of the seven subjects with SVR at the end of the treatment, in one subject at week 4, and four of the six subjects with REL at the end of the treatment (data not shown), percent increase was not calculated for IL-4 mRNA. 3.3. Relevance of changes in cytokine mRNA level and relapse of HCV The sensitivity and specificity to estimate HCV relapse after the therapy were calculated by using kinetics of mRNA levels of IL-12R 2 chain mRNA and IFN-␥: 71% and 67% for 0–24 of IL-12R 2 chain mRNA, respectively, and 57% and 67% for 0–24 of IFN-␥ mRNA, respectively. When fig-
K. Kobayashi et al. / Hepatology Research 34 (2006) 104–110
108
Fig. 1. Changes in mRNA expression of IL-12R 2 chain and IFN-␥ during ribavirin and IFN-␣ combination therapy. Serial changes in mRNA levels of IL-12R 2 chain (upper panel) and IFN-␥ (lower panel) were compared between patients with SVR and those with REL. Each point indicates an individual case. Blood samples were obtained before (week 0), at week 4 and at the end (week 24) of the ribavirin and IFN-␣ combination therapy.
Table 4 Level of mRNA for cytokines during ribavirin and IFN-␣ therapy: comparison by three time points between SVR and REL p
Weeks in therapy
IL-12R 2 SVR REL IFN-␥b SVR REL
0
4
4.93 (0.15) 5.11 (0.16)
5.27 (0.27) 5.51 (0.22)
5.14 (0.15) 5.52 (0.14)
5.03 (0.13) 5.42 (0.20)
0–4a
24
0–24a
7.54 (6.57) 8.50 (6.61)
5.66 (0.29) 5.00 (0.15)
15.31 (6.12) −1.64 (4.71)
−1.54 (3.87) −1.35 (5.31)
5.28 (0.16) 5.21 (0.10)
3.14 (3.30) −5.30 (2.70)
chainb < 0.05
Abbreviations used: SVR, sustained viral response; REL: relapse of HCV. a Percent changes of mRNA level at weeks 4 and 24 from week 0. b log copies/ma RNA. Data indicate mean and standard error in parentheses.
ure for both mRNA were combined, sensitivity and specificity became 57% and 100%, respectively. Changes in clinical parameters were compared between patients with SVR and those with REL at three sampling points (Table 5). Levels of leukocytes and lymphocytes were not different between the two groups.
4. Discussion In this study, we evaluated the Th1 response ex vivo during treatment with ribavirin and IFN-␣ and found an increase of Th1 response at the end of the treatment in patients with sustained loss of HCV.
K. Kobayashi et al. / Hepatology Research 34 (2006) 104–110 Table 5 Changes in the level of biochemical and hematological parameters during ribavirin and IFN-␣ therapy: Comparison by 3 time points between SVR and REL Weeks in therapy 0
4
24
3257.1 ± 416.8 4180.0 ± 661.4
3185.7 ± 173.8 3080.0 ± 483.1
Lymphocytesa (%) SVR 14.7 ± 6.3 REL 22.4 ± 6.0
16.7 ± 7.5 19.7 ± 7.2
15.5 ± 6.8 21.0 ± 6.2
ALTa (IU/I) SVR REL
31.3 ± 6.1 64.8 ± 29.8
17.6 ± 5.1 48.6 ± 15.9
0 33.3
0 0
Leukocytesa SVR REL
(l−1 ) 3800.0 ± 333.1 4700.0 ± 349.3
164.7 ± 75.3 146.6 ± 34.5
HCV RNA positiveb (%) SVR 100 REL 100
109
We were unable to analyze the kinetics of cytokine mRNA in patients with null viral response. Detailed study on such patients would be beneficial for the future development of an improved regimen of anti-viral therapy in patients with chronic hepatitis C, since the non-virological response has been reported to be as high as 40% in patients with genotype 1b and high viral load [25]. In conclusion, the results of this study suggest that the increase of Th1 response may be induced by combination therapy with ribavirin and IFN-␣, and such a therapy may contribute to the eradication of HCV in these patients. The mechanisms which cause differences in the response of these mRNAs in CD4+ T cells between patients with SVR and those with REL are currently unclear. However, these results may suggest the possibility of using the Th1 response to distinguish patients with relapse of HCV after the therapy from those who achieve sustained virus response.
a
Data, except for serum HCV RNA, indicate mean and standard error of 7 SVR patients and 6 REL patients. b Percentage of patients with serum HCV RNA positive at indicated time points.
Pretreatment levels of IL-12R 2 chain and IFN-␥ were higher in patients with chronic hepatitis C than those in healthy subjects, indicating the possibility that a Th1 response was evoked in the liver with chronic HCV infection. Differentiation of uncommitted CD4+ T cells is affected by various factors including signals from costimulatory molecules on antigen presenting cells, as well as the nature and the concentration of antigen and the cytokines present under local circumstances [13,14]. Although there were no significant changes in the IL-12R 1 chain mRNA in our study, nitric oxide and IFN-␣ upregulates the IL-12R 2 chain independently of the IL-12R 1 chain [15,16]. Our previous studies in vitro in human T cells have shown that both ribavirin and IFN-␣ have the potential to induce upregulation of IL12R 2 chain mRNA [10,11], which plays a key role in the differentiation of CD4+ T cells towards Th1 [17,18]. During the therapy, although a decrease in inflammation activity may attenuate stimulation of CD4+ T cells, administered ribavirin and IFN-␣ induces upregulation of IL-12R 2 chain mRNA. The results of this study also suggest that combination therapy of ribavirin and IFN-␣ may activate CD4+ cells and lead to IFN-␥ activity in some patients. Since IFN-␥ has been reported to suppress HBV and HCV replication [19–21], production of IFN-␥ by CD4+ T cells during ribavirin and IFN-␣ therapy may contribute to sustained virus loss and the induction of cytotoxic T lymphocytes [22]. In a long-term study, Shinohara et al. have demonstrated that baseline Th1 and Th2 cells may be related to the HCV response to IFN therapy [23]. Our results suggest for the possibility for using the kinetics of IL-12R 2 and IFN-␥ mRNA levels to predict patients with relapse of HCV after the therapy in addition to viral analysis [24].
Acknowledgement This study was partly supported by grants from the Japanese Ministry of Education, Culture, Sports, Science and Technology.
References [1] NIH Consensus Statement on Management of Hepatitis C: 2002. NIH Consens State Sci Statements. 2002;19:1–46. [2] Saracco G, Olivero A, Ciancio A, et al. A randomized 4-arm multicenter study of interferon alfa-2b plus ribavirin in the treatment of patients with chronic hepatitis C relapsing after interferon monotherapy. Hepatology 2002;36:959–66. [3] Poynard T, Marcellin P, Lee SS, et al. Randomised trial of interferon alpha2b plus ribavirin for 48 weeks or for 24 weeks versus interferon alpha2b plus placebo for 48 weeks for treatment of chronic infection with hepatitis C virus. International Hepatitis Interventional Therapy Group (IHIT). Lancet 1998;352:1426–32. [4] Tong MJ, el-Farra NS, Reikes AR, Co RL. Clinical outcomes after transfusion-associated hepatitis C. N Engl J Med 1995;332:1463–6. [5] Poynard T, Bedossa P, Opolon P. For the OBSVIRC, METAVIR, CLINIVIR and DOSVIRC groups. Natural history of liver fibrosis progression in patients with chronic hepatitis C. Lancet 1997;349:825–32. [6] Darby SC, Ewart DW, Giangrande PLF, et al. Mortality from liver cancer and liver disease in haemophilic men and boys given blood products contaminated with hepatitis C. Lancet 1997;350:1425–31. [7] Sarih M, Bouchrit N, Benslimane A. Different cytokine profiles of peripheral blood mononuclear cells from patients with persistent and self-limited hepatitis C virus infection. Immunol Lett 2000;74:117–20. [8] Kamal SM, Rasenack JW, Bianchi L, et al. Acute hepatitis C without and with schistosomiasis: correlation with hepatitis C-specific CD4 (+) T-cell and cytokine response. Gastroenterology 2001;121:646– 56. [9] Gerlach JT, Diepolder HM, Jung MC, et al. Recurrence of hepatitis C virus after loss of virus-specific CD4 (+) T-cell response in acute hepatitis C. Gastroenterology 1999;117:933–41. [10] Satoh H, Kobayashi K, Shiina M, et al. Gene expression of interleukin-12 receptor beta2 chain and Th1 population of periph-
110
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
K. Kobayashi et al. / Hepatology Research 34 (2006) 104–110 eral blood mononuclear cells in chronic hepatitis C. Hepatol Res 2002;22:270–7. Shiina M, Kobayashi K, Satoh H, Niitsuma H, Ueno Y, Shimosegawa T. Ribavirin up-regulates interleukin-12 receptor and induces T cell differentiation towards type 1 in chronic hepatitis C. J Gastroenterol Hepatol 2004;19:558–64. Presky DH, Yang H, Minetti LJ, et al. A functional interleukin 12 receptor complex is composed of two beta-type cytokine receptor subunits. Proc Natl Acad Sci USA 1996;26(93):14002–7. Simon JC, Krutmann J, Elmets CA, Bergstresser PR, Cruz Jr PD. Ultraviolet B-irradiated antigen-presenting cells display altered accessory signaling for T-cell activation: relevance to immune responses initiated in skin. J Invest Dermatol 1992;98(Suppl):66S–9S. Rothoeft T, Gonschorek A, Bartz H, Anhenn O, Schauer U. Antigen dose, type of antigen-presenting cell and time of differentiation contribute to the T helper 1/T helper 2 polarization of naive T cells. Immunology 2003;110:430–9. Niedbala W, Wei XQ, Campbell C, Thomson D, Komai-Koma M, Liew FY. Nitric oxide preferentially induces type 1 T cell differentiation by selectively up-regulating IL-12 receptor beta 2 expression via cGMP. Proc Natl Acad Sci USA 2002;99:16186–91. Verhagen CE, de Boer T, Smits HH, et al. Residual type 1 immunity in patients genetically deficient for interleukin 12 receptor beta1 (IL-12Rbeta1): evidence for an IL-12Rbeta1-independent pathway of IL-12 responsiveness in human T cells. J Exp Med 2000;192:517–28. Rogge L, Barberis-Maino L, Biffi M, et al. Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J Exp Med 1997;185:825–31. Rogge L, Papi A, Presky DH, et al. Antibodies to the IL-12 receptor beta 2 chain mark human Th1 but not Th2 cells in vitro and in vivo.
[19]
[20]
[21]
[22]
[23]
[24]
[25]
Antibodies to the IL-12 receptor beta 2 chain mark human Th1 but not Th2 cells in vitro and in vivo. J Immunol 1999;162:3926–32. Guidotti LG, Ando K, Hobbs MV, et al. Cytotoxic T lymphocytes inhibit hepatitis B virus gene expression by a noncytolytic mechanism in transgenic mice. Proc Natl Acad Sci USA 1994;91:3764–968. Larkin J, Jin L, Farmen M, et al. Synergistic antiviral activity of human interferon combinations in the hepatitis C virus replicon system. J Interferon Cytokine Res 2003;23:247–57. Frese M, Schwarzle V, Barth K, et al. Interferon-gamma inhibits replication of subgenomic and genomic hepatitis C virus RNAs. Hepatology 2002;35:694–703. Yamakami K, Akao S, Tadakuma T, Nitta Y, Miyazaki J, Yoshizawa N. Administration of plasmids expressing interleukin-4 and interleukin-10 causes BALB/c mice to induce a T helper 2-type response despite the expected T helper 1-type response with a lowdose infection of Leishmania major. Immunology 2002;105:515–23. Shinohara M, Ishii K, Takamura N. Long-term changes of peripheral blood CD4-positive T cell subsets (Th1, Th2) in chronic hepatitis C patients with a sustained response or no response to IFN. Hepatol Res 2003;27:260–5. Iino S, Tomita E, Kumada H, et al. Prediction of treatment outcome with daily high-dose IFN ␣-2b plus ribavirin in patients with chronic hepatitis C with genotype 1b and high HCV RNA levels: relationship of baseline viral levels and viral dynamics during and after therapy. Hepatol Res 2004;30:63–70. Tsubota A, Arase Y, Someya T, et al. Early viral kinetics and treatment outcome in combination of high-dose interferon induction versus. pegylated interferon plus ribavirin for naive patients infected with hepatitis C virus of genotype 1b and high viral load. J Med Virol 2005;75:27–34.
Th1 response during ribavirin and interferon-␣ combination therapy in chronic hepatitis C Koju Kobayashi a,∗ , Yoshiyuki Ueno b , Yoshie Kobayashi c , Takehiro Akahane d , Shuichi Satoh e , Kumiko Kikuchi f , Hiromasa Okamoto g , Motoyasu Ishii h , Tooru Shimosegawa b , Miyagi Ribavirin Study Group a
Tohoku University, School of Health Sciences and Comprehensive Research and Education, Center for Planning of Drug Development and Clinical Evaluation, Japan b Department of Gastroenterology, Tohoku University Graduate School of Medicine, Japan c Department of Internal Medicine, Tohoku Teishin Hospital, Japan d Department of Gastroenterology, Ishinomaki City Hospital, Japan e Department of Internal Medicine, Kurihara Municipal Hospital, Japan f Department of Internal Medicine, Iwai Hospital, Japan g Department of Gastroenterology, Shirakawa Hospital, Japan h Department of Internal Medicine, Kurokawa Hospital, Japan
Received 29 October 2004; received in revised form 4 March 2005; accepted 9 November 2005 Available online 27 December 2005
Abstract Ribavirin and interferon-␣ induce Th1 polarization of human CD4+ T cells. The study was conducted to investigate the whether cellular immune response during ribavirin/interferon-␣ therapy is associated with viral eradication by examining mRNA expression of molecules relevant to Th1 and Th2 polarization in CD4+ cells of 13 patients with chronic hepatitis C (seven patients with sustained viral response and six with transient response). Peripheral CD4+ T lymphocytes at 0, 4 and 24 weeks of treatment were tested. There were no significant differences in the mRNA levels at each point of time of the treatment between patients with sustained viral response and those with transient response. The percent increase in mRNA level of the IL-12R 2 chain from the baseline to the end of the treatment was significantly higher in patients with sustained viral response (15.3 ± 6.1%) than in those with transient response (−1.6 ± 4.7%, p < 0.05). There was no significant difference in percent changes in level of IL-12R 1 chain mRNA between the two groups. In conclusion, the results of this study indicate that the increase of Th1 response is related to the inflammatory activity in the liver and possibly to ribavirin and interferon-␣ therapy. It is also suggested that the measurement of Th1 response has the potential to distinguish patients with relapse from those with sustained virus response. © 2005 Elsevier Ireland Ltd. All rights reserved. Keywords: CD4+ T-lymphocyte; Chronic hepatitis C; Interferon-␥; Interle3ukin-12 receptor; Ribavirin
1. Introduction Ribavirin, a synthetic guanosine nucleoside analogue, is widely used for the treatment of chronic hepatitis C in combi∗ Corresponding author at: School of Health Sciences, Tohoku University, 2-1 Seiryo-machi, Aoba-ku, Sendai 980-8575, Japan. Tel.: +81 22 717 7929; fax: +81 22 717 7910. E-mail address: [email protected] (K. Kobayashi).
1386-6346/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.hepres.2005.11.002
nation with interferon (IFN)-␣ [1]. Combination therapy with ribavirin and IFN-␣ has been shown to have a higher response rate both at the end of treatment and at the end of follow-up when compared with IFN-␣ monotherapy [2,3]. However, there are two types of viral response after the loss of serum HCV RNA during treatment, that is, sustained virus loss and relapse of viral replication after withdrawal of treatment, the latter of which may be due to incomplete immune-mediated removal of infected cells [4–6].
K. Kobayashi et al. / Hepatology Research 34 (2006) 104–110
105
Table 1 Baseline characteristics of the 13 patients with chronic hepatitis C Characteristics
Total
SVR
REL
p
N Gender (male/female) Age in years, median (range)
13 11/2 41 (20–62)
7 6/1 31 (20–54)
6 5/1 51 (41–62)
NS <0.05
Source or type of infection, n (%) Blood transfusion Tattoo Sporadic, or unknown ALT IU/I, median (range)
3 0 10 85 (54–608)
1 0 6 85 (54–608)
2 0 4 114 (77–275)
HCV genotype Genotype 1 Genotype 2 + 3 HCV RNA kcopies/ml, median (range)
6 7 350 (260–>850)
1 6 350 (260–>850)
5 1 250 (250–650)
Fibrosis score 0 1 2 3 4 Undetermined
4 1 2 1 1 4
3 1 0 0 1 2
1 0 2 1 0 2
Activity score 1 2 Undetermined
3 6 4
3 2 2
0 4 2
NS NS <0.05 NS
NS
NS
Development of an HCV-specific Th1 response is observed with the resolution of acute infection with virus clearance [7,8], while loss of the Th1 response is associated with the development of chronic infection [9]. Therefore, it is expected that failure to develop an effective cellular immune response during ribavirin/IFN-␣ treatment in chronic HCV infection may be associated with viral persistence. In previous studies in vitro, we have shown that both ribavirin and IFN-␣ may have a modulating effect on the Th1 polarization of human peripheral CD4+ T cells through the up-regulation of mRNA for the interleukin (IL)-12 receptor 2 chain (IL-12R 2 chain) in patients with hepatitis C and the normal volunteers [10,11]. To investigate whether such cellular immune response during combination therapy of ribavirin and IFN-␣ may be associated with sustained viral response, we compared the expression of mRNA for molecules, which are relevant to the development of Th1 and Th2 in CD4+ T cells ex vivo between patients with sustained viral response and those with transient viral response.
Declaration of Helsinki and was approved by the Institution’s human research committee. The patients entered in the study received recombinant IFN-␣ at a dose of 6 or 10 mU daily for the first 2 weeks and thrice weekly for the subsequent 22 weeks. They were also received ribavirin at a dose of 600 mg/day (300 mg twice a day) for patients weighing <60 kg and 800 mg/day (400 mg twice a day) for patients weighing >60 kg. Further characteristics of the patients are listed in Table 1. As control subjects, 15 healthy individuals were also included in the study (six males and nine females, age 48.9 ± 9.7 years old). Samples for analysis of mRNA level were obtained just before the beginning of treatment (W0), at 4 weeks of the treatment (W4) and at the end of the treatment (W24). After sampling, the blood was immediately processed for separation of peripheral blood mononuclear cells (PBMC) separation (as described below).
2. Patients and methods
PBMC were isolated from patients by gradient centrifugation over Ficoll Hypaque. PBMC (1 × 106 cells in a volume of 500 l) were resuspended in phosphate buffered saline (PBS). Using anti-CD4 antibody coated magnetic beads (Dynabeads CD4, Dynal Biotec, Oslo, Norway), CD4+ lymphocytes were separated according to the manufacturer’s instructions. For the measurement of cytokine mRNA level in CD4+ cells, total RNA was isolated using Isogen (Nippon Gene, Toyama, Japan). cDNA was synthesized from
2.1. Patients and treatment The study included 13 patients with serologically (antiHCV antibodies and HCV RNA positive) and histologically demonstrated chronic hepatitis C. Informed consent was obtained from each subject included in the study. The study protocol conforms to the ethical guidelines of the 1975
2.2. Preparation of PBMC and extraction of cellular RNA
106
K. Kobayashi et al. / Hepatology Research 34 (2006) 104–110
total RNA using random hexamers and M-MRV (Invitrogen, Carlsbad, CA).
monitorTM test (Roche Diagnostic Systems, Branchburg, NJ). The lowest level of detection of this test is 200 HCV RNA copies/ml of sample.
2.3. Realtime RT-PCR 2.5. Statistical analysis Quantifications of mRNA for IFN-␥, IL-4, and IL-12R 1 and 2 chains were performed on an ABI PRISM 7700 Sequence Detector (Perkin-Elmer Applied Biosystems, Foster City, CA) using predeveloped Taqman reagents including primers and probes for IFN-␥, IL-4 and GAPDH according to the manufacturer’s instructions [11]. Primers and probes for the amplification and quantification of the IL-12R 1 chain and the 2 chain mRNA were deduced from the reported nucleotide sequence [12]: 1 chain: forward (nt.1049–1069) AACCAGACGTGGCACATTCCT, reverse (nt.1138–1159) CCAATACATGGTGGTCCCGTT, probe (nt.1087–1116) ACCAGTGGCTCTGAATATCAGCGTCGGAAC; 2 chain: forward (nt.3113–3136) CAGCACATCTCCCTTTCTGTTTTC, reverse (nt.3254–3276) ACTTTAAGGCTTGAAGCCTCACC, probe (nt.3140–3169) TCAAGTTCTCTTCACCCACTCACCTTCTCC. Primers and probes for IFN-␥ and IL-4 mRNA were as follows: IFN-␥: forward (nt.463–486) CGAGATGACTTCGAAAAGCTGACT, reverse (nt.570–592) TTTTGTCCCTTCGCTTTTTTC, probe (nt.541–566) CAAGTGATGGCTGAACTGTCGCCAGC; IL-4: forward (nt.66–85) GGGTCTCACCTCCCAACTGC, reverse (nt.285–305) ACACGAGGCCGTCAAGATGTC, probe (nt.114–135) TGCCGGCAACTTTGTCCACGGA. Amplification of GAPDH was performed for each experimental sample as an endogenous control. Threshold cycle C1, which is inversely correlated with the target mRNA levels, was determined as the cycle number at which the reporter fluorescent emission increased above the threshold level. The amount of target mRNA was compared with that of standard DNA, which was obtained by the cloning of PCR products into plasmid vectors, and expressed as log copies/g total RNA. Variations between experiments were verified to be less than 10% by four repeated measurements on the same cDNA preparation from a healthy subject. Lower detection level of each cytokine mRNA by this assay was 100 copies/g total RNA. Changes of mRNAs between weeks 0, 4 and 24 were calculated as follows: changes between weeks 0 and 4 (0–4) = ((mRNA level at week 4 − mRNA level at week 0)/mRNA level at week 0) × 100, and changes between weeks 0 and 24 (0–24) = ((mRNA level at week 24 − mRNA level at week 0)/mRNA level at week 0) × 100. Changes of levels of these mRNA were compared between the two groups of patients to evaluate the possibility of clinical usability in estimating the viral relapse after the therapy. 2.4. HCV RNA Quantification of HCV RNA in serum samples was performed using a commercially available kit: Amplicor HCV
Non-parametrical analysis of sequential changes in cytokine mRNA levels was performed using Friedman’s test. For the analysis of percent increase in cytokine mRNA level as a factor of viral responses, the Mann–Whitney U-test was employed. For comparison of mRNA level at each time point among patients with different HCV genotypes, oneway ANOVA or Dunnett’s t-test was used. P-values of <0.05 were considered to be statistically significant.
3. Results 3.1. Virological responses All 13 patients completed the 24-week ribavirin/IFN-␣ therapy. At the end of the treatment, serum HCV RNA was detected in none of the 13 patients. At the end of the 24-week follow-up after the treatment, serum HCV RNA became positive in six patients (relapse, REL) and remained negative in seven patients (sustained viral response, SVR). Two baseline factors were found to be significantly different between patients with SVR and those with REL, namely HCV genotype (1b versus others, p = 0.029) and age (>40 years old versus ≤40 years old, p = 0.046, Table 1). 3.2. Cytokine mRNA level in CD4+ cells Expression levels of IL-12R 1 and 2 chains, IFN-␥ and IL-4 at pretreatment in 13 patients with chronic hepatitis C were compared with those of 15 normal subjects. The comparison showed no statistical difference in mRNAs for IL-12R 1 and 2 chains between patients and healthy subjects (Table 2). Expression of IFN-␥ mRNA was significantly higher in patients with chronic hepatitis C (p < 0.001). Baseline cytokine mRNA level in CD4+ cells in patients with chronic hepatitis C was not correlated with clinical findings such as HCV virus load, HCV genotypes, serum levels of ALT, liver fibrosis grade or liver histological activity (Table 2). Sequential measurement of changes in mRNA level in CD4+ cells during the treatment showed no substantial changes in the level of mRNA for IL-12R 1 chain, IL-12R 2 chain, IFN-␥ and IL-4 when the average of 13 patients was compared between three sampling points (Table 3). Expression level of each mRNA was not significantly different between SVR and REL (Table 3 and Fig. 1). IL-4 mRNA was detectable in seven patients at week 0, 10 patients at week 4 and 11 patients at week 24, although expression of IL-4 mRNA was at low levels near detection limits in most cases. Due to the possibility of unstable results near detection
K. Kobayashi et al. / Hepatology Research 34 (2006) 104–110
107
Table 2 Baseline level of cytokine mRNA and clinical factors Characteristics
N
IL-12R 1 chaina
Patient group Hepatitis C Normal subjects
13 15
5.23 (0.12) 3.01 (1.26)
Age in years >40 ≤40
4 9
ALT (IU/I) >100 ≤100
IL-12R 2 chaina
IFN-␥
IL-4a,b
5.01 (0.11) 3.02 (1.05)
5.31 (0.11) 2.02 (0.76)
2.08 (0.06) ND
4.95 (0.32) 5.36 (0.10)
5.00 (0.25) 5.02 (0.12)
5.03 (0.25) 5.44 (0.10)
<2.00 2.12 (0.09)
7 6
5.19 (0.13) 5.71 (0.09)
5.01 (0.18) 4.98 (0.25)
5.36 (0.13) 5.42 (0.11)
<2.00 2.10 (0.10)
HCV genotype Genotype 1 Genotype 2 + 3
6 7
5.27 (0.14) 5.20 (0.21)
4.97(0.15) 5.06 (0.16)
5.40 (0.15) 5.24 (0.19)
2.18 (0.13) <2.00
HCV RNA (kcopies/ml) >400 ≤400
6 7
5.04 (0.12) 5.34 (0021)
4.85 (0.28) 2.10 (0.12)
5.30 (0.13) 5.30 (0.19)
<2.00 2.04 (0.04)
Fibrosis score 0, 1, 2 3, 4
7 6
5.55 (0.17) 5.34 (0.16)
4.81 (0.01) 5.04 (0.20)
5.31 (0.06) 5.45 (0.12)
2.15 (0.15) <2.00
Activity score 1 2
5 8
5.24 (0.20) 5.58 (0.10)
4.97 (0.26) 50.0 (0.18)
5.47 (0.17) 5.37 (0.09)
2.06 (0.06) <2.00
Baseline level of each cytokine was compared in association with various clinical factors by Student’s t test; ND: not detected. a log copies/g RNA. Data indicate mean and standard error in parentheses. b Comparison was made using seven cases with detectable IL-4 mRNA.
Table 3 Level of mRNA for cytokines at three sampling points during ribavirin and IFN-␣ therapy mRNAa
Weeks in therapy 4
24
IL-12R 1 chain Total 5.23 (0.12) SVR 5.17 (0.20) REL 5.29 (0.15)
0
5.30 (0.16) 5.19 (0.12) 5.43 (0.32)
5.02 (0.10) 4.96 (0.16) 5.08 (0.11)
IL-12R 2 chain Total 5.01 (0.11) SVR 4.93 (0.15) REL 5.11 (0.16)
5.38 (0.18) 5.27 (0.27) 5.51 (0.22)
5.36 (0.19) 5.66 (0.29) 5.00 (0.215)
IFN-␥ Total SVR REL
5.31 (0.11) 5.14 (0.15) 5.52 (0.14)
5.21 (0.12) 5.03 (0.13) 5.42 (0.20)
5.26 (0.10) 5.28 (0.16) 5.21 (0.10)
IL-4b Total SVR REL
2.08 (0.06) 2.00 (0.00) 2.18 (0.13)
2.06 (0.05) 2.09 (0.09) 2.03 (0.03)
2.15 (0.05) 2.16 (0.08) 2.13 (0.08)
a
log copies/g RNA. Data indicate mean, and standard error in parenthe-
ses. b Data for IL-4 mRNA level was positive in 7 (2 SVR and 5 REL) of 13 cases at week 0, 10 (5 SVR and 5 REL) at week 4 and 11 (5 SVR and 6 REL) at week 24.
limits of realtime PCR, statistical analysis was not performed on the expression of IL-4 mRNA. Comparison was made to find the difference of changes in mRNA using the percent change of mRNA level. Percent increase in level of mRNA for IL-12R 2 chain from baseline to the end of the treatment was significantly higher in patients with SVR (15.3 ± 6.1%) than in those with REL (1.6 ± 4.7%, p < 0.05, Table 4). Percent changes in the level of mRNA for IFN-␥ from the baseline to the end of the treatment was 3.1 ± 3.3% in patients with SVR and −5.3 ± 2.7% in REL, but the difference was not statistically significant. There was no significant difference in percent changes in the level of mRNA for the IL-12R 1 chain between the two groups (−3.8 ± 2.1% for SVR versus −3.5 ± 4.0% for REL, data not shown). Since mRNA for IL-4 was detected in only one subject at week 4, in four of the seven subjects with SVR at the end of the treatment, in one subject at week 4, and four of the six subjects with REL at the end of the treatment (data not shown), percent increase was not calculated for IL-4 mRNA. 3.3. Relevance of changes in cytokine mRNA level and relapse of HCV The sensitivity and specificity to estimate HCV relapse after the therapy were calculated by using kinetics of mRNA levels of IL-12R 2 chain mRNA and IFN-␥: 71% and 67% for 0–24 of IL-12R 2 chain mRNA, respectively, and 57% and 67% for 0–24 of IFN-␥ mRNA, respectively. When fig-
K. Kobayashi et al. / Hepatology Research 34 (2006) 104–110
108
Fig. 1. Changes in mRNA expression of IL-12R 2 chain and IFN-␥ during ribavirin and IFN-␣ combination therapy. Serial changes in mRNA levels of IL-12R 2 chain (upper panel) and IFN-␥ (lower panel) were compared between patients with SVR and those with REL. Each point indicates an individual case. Blood samples were obtained before (week 0), at week 4 and at the end (week 24) of the ribavirin and IFN-␣ combination therapy.
Table 4 Level of mRNA for cytokines during ribavirin and IFN-␣ therapy: comparison by three time points between SVR and REL p
Weeks in therapy
IL-12R 2 SVR REL IFN-␥b SVR REL
0
4
4.93 (0.15) 5.11 (0.16)
5.27 (0.27) 5.51 (0.22)
5.14 (0.15) 5.52 (0.14)
5.03 (0.13) 5.42 (0.20)
0–4a
24
0–24a
7.54 (6.57) 8.50 (6.61)
5.66 (0.29) 5.00 (0.15)
15.31 (6.12) −1.64 (4.71)
−1.54 (3.87) −1.35 (5.31)
5.28 (0.16) 5.21 (0.10)
3.14 (3.30) −5.30 (2.70)
chainb < 0.05
Abbreviations used: SVR, sustained viral response; REL: relapse of HCV. a Percent changes of mRNA level at weeks 4 and 24 from week 0. b log copies/ma RNA. Data indicate mean and standard error in parentheses.
ure for both mRNA were combined, sensitivity and specificity became 57% and 100%, respectively. Changes in clinical parameters were compared between patients with SVR and those with REL at three sampling points (Table 5). Levels of leukocytes and lymphocytes were not different between the two groups.
4. Discussion In this study, we evaluated the Th1 response ex vivo during treatment with ribavirin and IFN-␣ and found an increase of Th1 response at the end of the treatment in patients with sustained loss of HCV.
K. Kobayashi et al. / Hepatology Research 34 (2006) 104–110 Table 5 Changes in the level of biochemical and hematological parameters during ribavirin and IFN-␣ therapy: Comparison by 3 time points between SVR and REL Weeks in therapy 0
4
24
3257.1 ± 416.8 4180.0 ± 661.4
3185.7 ± 173.8 3080.0 ± 483.1
Lymphocytesa (%) SVR 14.7 ± 6.3 REL 22.4 ± 6.0
16.7 ± 7.5 19.7 ± 7.2
15.5 ± 6.8 21.0 ± 6.2
ALTa (IU/I) SVR REL
31.3 ± 6.1 64.8 ± 29.8
17.6 ± 5.1 48.6 ± 15.9
0 33.3
0 0
Leukocytesa SVR REL
(l−1 ) 3800.0 ± 333.1 4700.0 ± 349.3
164.7 ± 75.3 146.6 ± 34.5
HCV RNA positiveb (%) SVR 100 REL 100
109
We were unable to analyze the kinetics of cytokine mRNA in patients with null viral response. Detailed study on such patients would be beneficial for the future development of an improved regimen of anti-viral therapy in patients with chronic hepatitis C, since the non-virological response has been reported to be as high as 40% in patients with genotype 1b and high viral load [25]. In conclusion, the results of this study suggest that the increase of Th1 response may be induced by combination therapy with ribavirin and IFN-␣, and such a therapy may contribute to the eradication of HCV in these patients. The mechanisms which cause differences in the response of these mRNAs in CD4+ T cells between patients with SVR and those with REL are currently unclear. However, these results may suggest the possibility of using the Th1 response to distinguish patients with relapse of HCV after the therapy from those who achieve sustained virus response.
a
Data, except for serum HCV RNA, indicate mean and standard error of 7 SVR patients and 6 REL patients. b Percentage of patients with serum HCV RNA positive at indicated time points.
Pretreatment levels of IL-12R 2 chain and IFN-␥ were higher in patients with chronic hepatitis C than those in healthy subjects, indicating the possibility that a Th1 response was evoked in the liver with chronic HCV infection. Differentiation of uncommitted CD4+ T cells is affected by various factors including signals from costimulatory molecules on antigen presenting cells, as well as the nature and the concentration of antigen and the cytokines present under local circumstances [13,14]. Although there were no significant changes in the IL-12R 1 chain mRNA in our study, nitric oxide and IFN-␣ upregulates the IL-12R 2 chain independently of the IL-12R 1 chain [15,16]. Our previous studies in vitro in human T cells have shown that both ribavirin and IFN-␣ have the potential to induce upregulation of IL12R 2 chain mRNA [10,11], which plays a key role in the differentiation of CD4+ T cells towards Th1 [17,18]. During the therapy, although a decrease in inflammation activity may attenuate stimulation of CD4+ T cells, administered ribavirin and IFN-␣ induces upregulation of IL-12R 2 chain mRNA. The results of this study also suggest that combination therapy of ribavirin and IFN-␣ may activate CD4+ cells and lead to IFN-␥ activity in some patients. Since IFN-␥ has been reported to suppress HBV and HCV replication [19–21], production of IFN-␥ by CD4+ T cells during ribavirin and IFN-␣ therapy may contribute to sustained virus loss and the induction of cytotoxic T lymphocytes [22]. In a long-term study, Shinohara et al. have demonstrated that baseline Th1 and Th2 cells may be related to the HCV response to IFN therapy [23]. Our results suggest for the possibility for using the kinetics of IL-12R 2 and IFN-␥ mRNA levels to predict patients with relapse of HCV after the therapy in addition to viral analysis [24].
Acknowledgement This study was partly supported by grants from the Japanese Ministry of Education, Culture, Sports, Science and Technology.
References [1] NIH Consensus Statement on Management of Hepatitis C: 2002. NIH Consens State Sci Statements. 2002;19:1–46. [2] Saracco G, Olivero A, Ciancio A, et al. A randomized 4-arm multicenter study of interferon alfa-2b plus ribavirin in the treatment of patients with chronic hepatitis C relapsing after interferon monotherapy. Hepatology 2002;36:959–66. [3] Poynard T, Marcellin P, Lee SS, et al. Randomised trial of interferon alpha2b plus ribavirin for 48 weeks or for 24 weeks versus interferon alpha2b plus placebo for 48 weeks for treatment of chronic infection with hepatitis C virus. International Hepatitis Interventional Therapy Group (IHIT). Lancet 1998;352:1426–32. [4] Tong MJ, el-Farra NS, Reikes AR, Co RL. Clinical outcomes after transfusion-associated hepatitis C. N Engl J Med 1995;332:1463–6. [5] Poynard T, Bedossa P, Opolon P. For the OBSVIRC, METAVIR, CLINIVIR and DOSVIRC groups. Natural history of liver fibrosis progression in patients with chronic hepatitis C. Lancet 1997;349:825–32. [6] Darby SC, Ewart DW, Giangrande PLF, et al. Mortality from liver cancer and liver disease in haemophilic men and boys given blood products contaminated with hepatitis C. Lancet 1997;350:1425–31. [7] Sarih M, Bouchrit N, Benslimane A. Different cytokine profiles of peripheral blood mononuclear cells from patients with persistent and self-limited hepatitis C virus infection. Immunol Lett 2000;74:117–20. [8] Kamal SM, Rasenack JW, Bianchi L, et al. Acute hepatitis C without and with schistosomiasis: correlation with hepatitis C-specific CD4 (+) T-cell and cytokine response. Gastroenterology 2001;121:646– 56. [9] Gerlach JT, Diepolder HM, Jung MC, et al. Recurrence of hepatitis C virus after loss of virus-specific CD4 (+) T-cell response in acute hepatitis C. Gastroenterology 1999;117:933–41. [10] Satoh H, Kobayashi K, Shiina M, et al. Gene expression of interleukin-12 receptor beta2 chain and Th1 population of periph-
110
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
K. Kobayashi et al. / Hepatology Research 34 (2006) 104–110 eral blood mononuclear cells in chronic hepatitis C. Hepatol Res 2002;22:270–7. Shiina M, Kobayashi K, Satoh H, Niitsuma H, Ueno Y, Shimosegawa T. Ribavirin up-regulates interleukin-12 receptor and induces T cell differentiation towards type 1 in chronic hepatitis C. J Gastroenterol Hepatol 2004;19:558–64. Presky DH, Yang H, Minetti LJ, et al. A functional interleukin 12 receptor complex is composed of two beta-type cytokine receptor subunits. Proc Natl Acad Sci USA 1996;26(93):14002–7. Simon JC, Krutmann J, Elmets CA, Bergstresser PR, Cruz Jr PD. Ultraviolet B-irradiated antigen-presenting cells display altered accessory signaling for T-cell activation: relevance to immune responses initiated in skin. J Invest Dermatol 1992;98(Suppl):66S–9S. Rothoeft T, Gonschorek A, Bartz H, Anhenn O, Schauer U. Antigen dose, type of antigen-presenting cell and time of differentiation contribute to the T helper 1/T helper 2 polarization of naive T cells. Immunology 2003;110:430–9. Niedbala W, Wei XQ, Campbell C, Thomson D, Komai-Koma M, Liew FY. Nitric oxide preferentially induces type 1 T cell differentiation by selectively up-regulating IL-12 receptor beta 2 expression via cGMP. Proc Natl Acad Sci USA 2002;99:16186–91. Verhagen CE, de Boer T, Smits HH, et al. Residual type 1 immunity in patients genetically deficient for interleukin 12 receptor beta1 (IL-12Rbeta1): evidence for an IL-12Rbeta1-independent pathway of IL-12 responsiveness in human T cells. J Exp Med 2000;192:517–28. Rogge L, Barberis-Maino L, Biffi M, et al. Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J Exp Med 1997;185:825–31. Rogge L, Papi A, Presky DH, et al. Antibodies to the IL-12 receptor beta 2 chain mark human Th1 but not Th2 cells in vitro and in vivo.
[19]
[20]
[21]
[22]
[23]
[24]
[25]
Antibodies to the IL-12 receptor beta 2 chain mark human Th1 but not Th2 cells in vitro and in vivo. J Immunol 1999;162:3926–32. Guidotti LG, Ando K, Hobbs MV, et al. Cytotoxic T lymphocytes inhibit hepatitis B virus gene expression by a noncytolytic mechanism in transgenic mice. Proc Natl Acad Sci USA 1994;91:3764–968. Larkin J, Jin L, Farmen M, et al. Synergistic antiviral activity of human interferon combinations in the hepatitis C virus replicon system. J Interferon Cytokine Res 2003;23:247–57. Frese M, Schwarzle V, Barth K, et al. Interferon-gamma inhibits replication of subgenomic and genomic hepatitis C virus RNAs. Hepatology 2002;35:694–703. Yamakami K, Akao S, Tadakuma T, Nitta Y, Miyazaki J, Yoshizawa N. Administration of plasmids expressing interleukin-4 and interleukin-10 causes BALB/c mice to induce a T helper 2-type response despite the expected T helper 1-type response with a lowdose infection of Leishmania major. Immunology 2002;105:515–23. Shinohara M, Ishii K, Takamura N. Long-term changes of peripheral blood CD4-positive T cell subsets (Th1, Th2) in chronic hepatitis C patients with a sustained response or no response to IFN. Hepatol Res 2003;27:260–5. Iino S, Tomita E, Kumada H, et al. Prediction of treatment outcome with daily high-dose IFN ␣-2b plus ribavirin in patients with chronic hepatitis C with genotype 1b and high HCV RNA levels: relationship of baseline viral levels and viral dynamics during and after therapy. Hepatol Res 2004;30:63–70. Tsubota A, Arase Y, Someya T, et al. Early viral kinetics and treatment outcome in combination of high-dose interferon induction versus. pegylated interferon plus ribavirin for naive patients infected with hepatitis C virus of genotype 1b and high viral load. J Med Virol 2005;75:27–34.