- Email: [email protected]
G EGF polymorphism is functional but is neither a prognostic marker nor a risk factor for glioblastoma
Cancer Genetics and Cytogenetics 172 (2007) 33e37
The 61 A/G EGF polymorphism is functional but is neither a prognostic marker nor a risk factor for glioblastoma Elodie Vauleona,b, Nathalie Augera,b, Alexandra Benouaich-Amiela,b,c, Florence Laigle-Donadeyc, Gentian Kaloshic, Julie Lejeunec, Jean-Yves Delattrea,b,c, Joe¨lle Thilleta,b, Marc Sansona,b,c,* a
INSERM, U711, Biologie des Interactions Neurones & Glie, 75651 Paris cedex 13, France b Universite´ Pierre et Marie Curie, Faculte´ de Me´decine, Paris, France c Service de Neurologie Mazarin, Groupe Hospitalier Pitie´-Salpeˆtrie`re, 47 boulevard de l’Hoˆpital, 75013 Paris, France Received 6 June 2006; received in revised form 13 July 2006; accepted 24 July 2006
Abstract
The A/G61 polymorphism located in the 50 UTR of the EGF gene has been found to be both a risk factor and a prognostic factor in glioblastoma (GBM), but the functional consequences have not been investigated. Here we show, in vitro, that this polymorphism is functional, in that the G allele promoter is 40% more active than the A variant (P ! 0.001). However, analysis of a large series of 209 GBM patients and 214 control subjects did not confirm that A/G61 polymorphism is a significant risk factor for GBM, despite a trend for higher GG frequency in these patients. Furthermore, A/G61 polymorphism was not a prognostic factor for survival in GBM patients, although it does appear to affect progression-free survival. Ó 2007 Elsevier Inc. All rights reserved.
1. Introduction With a median survival of 12e15 months, glioblastoma (GBM) is the most frequent (65%) and most malignant histological subtype of glioma [1,2]. None of the most frequent molecular alterations involved in GBM (10q loss, EGFR amplification, TP53 mutation, TP16 deletion, and PTEN mutation [3,4]) serve as clear prognostic markers, in contrast to clinical factors such as age and performance status, which do have a strong effect on survival [5]. The majority of GBMs are sporadic, and little is known about the environmental and genetic risk factors in this context; it is tempting, however, to postulate that functional polymorphisms involving the genes just mentioned may represent risk factors for glioma development. A recent study suggested that a polymorphism located in the 50 UTR of the EGF gene (G in position 61) is both a risk factor for GBM and a prognostic factor in GBM patients [6]; however, these data were based on a small series (42 patients) and have not been confirmed to date. Moreover, it has been supposed, but not demonstrated, that this polymorphism is functional.
* Corresponding author. Tel.: þ33-(0)1-42160573; fax: 33-(0)142160375. E-mail address: [email protected] (M. Sanson). 0165-4608/06/$ e see front matter Ó 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.cancergencyto.2006.07.013
In the present study, we demonstrated that this variant indeed bears functional consequences in vitro. We also analyzed the role of 61 A/G EGF polymorphism as a prognostic factor and a risk factor for GBM in a large case-control study (423 subjects in all). 2. Methods 2.1. EGF-luciferase constructs For the amplification of the 960-1532 EGF gene sequence (GenBank accession no. AF 023155), the following primers were used: forward 50 -GGAAGATCTGAACTATCTTTACTAT-30 and reverse 50 -CCCAAGCTTTCCTGACACCTATGACAA-30 (the nucleotides highlighted in bold italics correspond respectively to the restriction site of BglII and HindIII). The amplification of the 573-bp region containing either A or G variants was performed in a 25-mL reaction containing 200 ng total DNA, 1.5 mL each primer (10 mmol/L), and 10 mL master mix (Eppendorf, Hamburg, Germany). The polymerase chain reaction (PCR) conditions were 5 minutes at 95 C, followed by 35 cycles of 95 C for 30 seconds, 48 C for 30 seconds and 72 C for 3 minutes and finally 72 C for 7 minutes. The PCR products were then purified and cloned in luciferase promoterless expression vector pGL3 by standard methods. Both clones pGL3-EGF A and G were checked by
E. Vauleon et al. / Cancer Genetics and Cytogenetics 172 (2007) 33e37
sequencing on an ABI 3100 genetic analyzer (Applied Biosystems, Foster City, CA). 2.2. Cell culture and transfection CHO Chinese hamster ovary cells (American Type Culture Collection, Rockville,MD) were maintained in F12 HAM (Invitrogen, Carslbad, CA), 10% fetal bovine serum, 10 U/mL penicillin, and 10 mg/mL streptomycin. CHO cells (3e3.5 105) were seeded in six-well plates, incubated for 24 hours, and transfected with 3 mg vectors (pGL3-EGF A, pGL3-EGF G), 0.5 mg pSV 40-b-galactosidase and 10 mL Lipofectin (Invitrogen) in 100 mL serum-free medium. After 48 hours, cells were harvested for assays. Transfections were performed in triplicate. The luciferase activity was measured by using luciferase assay substrate (Promega, Madison, WI) in a Victor luminometer (Wallac, Evry, France). Protein concentration was determined using a bicinchoninic acid assay; b-galactosidase activity was measured at 450 nm after addition of Na2CO3 1 mol/L. 2.3. Patients A total of 209 GBM patients (mean age 55.9, range 22 to 83, overall survival 5 16.5 months) were selected from our neurooncology database out of 849 patients (24.6%) treated for GBM from 1998 to 2004 (mean age 56.2, range 17 to 83, overall survival 5 15 months). The inclusion criteria were a histologic diagnostic of GBM (WHO grade IV), age > 18 years, clinical data and follow-up available on the database, no previous history of glial tumor, informed consent obtained, and blood and tumor sample available. Of these 209 GBM patients, 34 (16%) had a biopsy, 48 (23%) had partial tumor removal, and 127 (61%) had complete tumor removal. Postsurgical treatment consisted of both radiotherapy and chemotherapy for 117 patients (56%), radiotherapy alone for 55 patients (26.3%), chemotherapy alone for 26 patients (12.4%), and supportive care for 11 patients (5.3%). Control DNA was obtained from 214 unrelated healthy white volunteers (mainly laboratory staff), ranging in age from 16 to 75 years (median 5 49.0).
2.6. EGFR amplification EGFR amplification of tumor DNA was detected by realtime PCR with an internal probe. The EGFR primers (forward: GTGCAGATCGCAAAGGTAATCAG; reverse: GCAGACCGCATGTGAGGAT; probe: CCCCTCCCCGTATCTC; FAM fluorescein dye labeled) amplified a 79-bp genomic fragment. The reference primers amplified a genomic fragment from RNase P (TaqMan RNase P detection reagents, FAM dye, ref. no. 4316831; Applied Biosystems). Realtime PCR cycles were performed as follows: 50 C for 2 minutes, 95 C for 15 minutes, 40 cycles of 15 seconds at 95 C, and a final 60 C for 1 minute.
2.7. Statistical analysis Chi-square tests were used to compare the genotype distribution between the two groups (GBM and control) and odds ratios were calculated. The associations between qualitative variables were calculated with a c2 test, and the association with continuous variables was calculated with a KruskaleWallis test. Progression-free survival was defined as the time between the diagnosis and recurrence or last follow-up and overall survival was defined as the time between diagnosis and death or last follow-up. Survival curves were obtained by KaplaneMeier methods and were compared using a Log rank test. The following factors were entered as candidate variables in the multivariate Cox proportional hazard regression model analysis: genotype, age, type of surgery, and postoperative treatment. Two-sided P-values ! 0.05 were considered significant.
800
600
U
34
400
2.4. DNA DNAwas extracted from blood and from frozen or paraffin embedded tumor sample according to standard techniques. 2.5. Polymorphism identification PCR amplification was performed as previously published [7]. Uncertain genotypes were confirmed by real-time PCR allelic discrimination with a EGF-Assayon-Demand kit (Applied Biosystems).
200
0
A
G
Fig. 1. Comparison of the two variant promoters, EGF A and EGF G, shows that the G variant results in 40% higher luciferase activity (U, arbitrary units). Error bars indicate 61 standard deviation.
E. Vauleon et al. / Cancer Genetics and Cytogenetics 172 (2007) 33e37 Table 1 Comparison of genotypes allele frequencies in the glioblastoma and control groups Genotype Sample size Genotype AA AG GG Allelotype Allele A Allele G
Controls, no. (%)
GBM patients, no. (%)
n 5 214
n 5 209
63 (29.5) 120 (56.1) 31 (14.5)
63 (30.1) 102 (48.8) 44 (21.1)
246 (57.5) 182 (42.5)
228 (54.5) 190 (45.5)
OR (95% CI)
P
1 0.85 (0.55e1.32) 1.42 (0.80e2.50)
0.16
0.39
Abbreviations: CI, confidence interval; GBM, glioblastoma; OR, odds ratio.
3. Results The 573-bp region containing either 61A or 61G variants was cloned upstream to luciferase reporter gene in pGL3 vector. When expressed in CHO cells, the G variant resulted in a 40% higher activity than the A variant (Fig. 1) (P ! 0.001), which shows that this fragment of the promoter region is functional and that the A/G 61 polymorphism has functional consequences in terms of transcriptional activity. The functional consequences were then investigated in terms of risk factor and prognosis for GBM. The frequency of the EGF variants was as follows: AA 5 63, AG 5 102, GG 5 44 for GBM population and AA 5 63, AG 5 120,
35
GG 5 31 for the control population. A higher frequency of GG (21.1 % versus 14.5 %) and a lower frequency of AG (48.8 % versus 56.1 %) was found in the GBM than in the control population, but the difference did not reach significance (P 5 0.16; c2 test) (Table 1). Allele frequencies did not differ between the GBM (A 5 114, G 5 95) and control (A 5 123, G 5 91) (P 5 0.39) populations (Table 1). The distribution of EGF genotypes was independent of sex (P 5 0.25), age (P 5 0.34), and EGFR amplification status in tumor DNA (P 5 0.85). EGFR amplification was detected in 68 out of 209 tumor DNA samples. PFS differed among genotypes AA (median 5 8.6 months; 95% CI 5 6.7e12.6), AG (median 5 8.2 months; 95% CI 5 6.3e9.6), and GG (median 5 9.55 months; 95% CI 5 7.7e13)dthe last being characterized by a better prognosis (P 5 0.047) (Fig. 2). The difference in PFS was clearer between AG and GG (P 5 0.022), but no difference in PFS was found between allele A and G (AA versus AGþGG, P 5 0.42; GG versus AG þAA, P 5 0.07). The comparison of overall survival among the three genotypes showed no difference (P 5 0.45) (Fig. 3), and no difference in overall survival was found between allele A and G (AA versus AGþGG, P 5 0.357; GG versus AG þAA, P 5 0.64). No significant prognostic impact of EGF genotype was found when the samples were analyzed separately with regards to the extent of resection, age and EGFR status.
1.0
% Progression free survival
0.8
0.6
0.4
AA AG
0.2
GG
0.0 0
20
40
60
80
100
Months Fig. 2. Progression-free survival (PFS) according to genotype. Median PFS was 8.6 months for AA, 8.2 months for AG, and 9.5 months for GG.
E. Vauleon et al. / Cancer Genetics and Cytogenetics 172 (2007) 33e37
36 1.0
0.8
% Survival
0.6
0.4
AA AG 0.2
GG
0.0 0
20
40
60
80
100
120
140
Months Fig. 3. Overall survival (OS) according to genotype. Median OS was 19 months for AA, 16.5 months for AG, and 16.1 months for GG.
On multivariate analysis, age and type of surgery, but not EGF genotype, were related to survival (Table 2).
4. Discussion The EGF/EGFR-mediated pathway is one of the most critical pathways for glioma tumorigenesis [8], and so functional polymorphisms involving EGF or EGFR may affect glioma development. In the present study, the polymorphism þ61 A/G of the EGF promoter was investigated here from a functional point of view, as a potential risk factor for GBM and as a potential prognostic marker. We found 61G allele to be more active than 61A allele (P ! 0.001), which Table 2 Multivariate analysis of genotype, age, surgery, and postsurgery treatment on survival Variable
RR (95% CI)
P
AA genotype AG genotype GG genotype Age O 56 years Surgerya Postsurgical treatmentb
1 1.28 1.16 1.72 0.6 1
0.19 0.52 0.00077 0.0019 1
(0.885e1.840) (0.735e1.841) (1.255e2.366) (0.435e0.828) (0.403e2.485)
Abbreviations: CI, confidence interval; RR, relative risk. a Total removal versus biopsy þ partial removal. b Both radiotherapy and chemotherapy; radiotherapy alone; chemotherapy alone; or supportive care.
is consistent with the 61G allele correlating with a higher blood EGF concentration [6,7]. Apparently, however, this difference does not result in clinically relevant consequences. The genotype GG, slightly but not significantly more frequent in the GBM population, can neither be retained as a risk factor for GBM nor be considered as a useful prognostic marker for clinical practice, despite its modest impact on PFS. Thus, our data, based on larger and more homogeneous series (containing only de novo GBM), do not confirm previous findings [6]. One may assume that a difference in EGF concentration has little or no clinical consequences because it is not a limiting step in the EGFR-mediated transduction signal pathway. For example, (i) EGFR may be constitutively active because of a truncating mutation resulting in EGFR vIII variant, which affects 25% of GBM [9], or (ii) EGFR may be activated not only by EGF but also by TGFa, or (iii) it may be that the downstream Pi3K pathway is activated by PTEN inactivation, which occurs frequently in GBM. Likewise, melanoma studies have resulted in conflicting results, with a first positive study being contradicted by three successive negative studies, suggesting that this polymorphism is neither a marker of predisposition nor a prognostic factor for melanoma [7,10e12]. In conclusion, we have established a functional difference between the A61 and G61 alleles of the EGF promoter, but one that does not result in risk factor or prognostic consequence for GBM patients and has
E. Vauleon et al. / Cancer Genetics and Cytogenetics 172 (2007) 33e37
therefore no clinical impact. Nevertheless, the finding raises new questions. For example, in silico analysis detects a potential binding site for HNF1 (hepatocyte nuclear factor 1) transcription factor when a G, but not an A, is present at position 61. This could explain the difference of activity between the two variants and the resulting difference in EGF concentration [13]. Additional studies are needed to confirm this hypothesis.
[6]
[7]
[8]
References [1] Ohgaki H, Kleihues P. Epidemiology and etiology of gliomas. Acta Neuropathol (Berl) 2005;109:93e108. [2] Kleihues P, Louis DN, Scheithauer BW, Rorke LB, Reifenberger G, Burger PC, Cavenee WK. The WHO classification of tumors of the nervous system. J Neuropathol Exp Neurol 2002;61:215e25. discussion 226e9. [3] Ohgaki H, Dessen P, Jourde B, Horstmann S, Nishikawa T, Di Patre PL, Burkhard C, Schuler D, Probst-Hensch NM, Maiorka PC, Baeza N, Pisani P, Yonekawa Y, Yasargil MG, Lutolf UM, Kleihues P. Genetic pathways to glioblastoma: a population-based study. Cancer Res 2004;64:6892e9. [4] Rich JN, Hans C, Jones B, Iversen ES, McLendon RE, Rasheed BK, Dobra A, Dressman HK, Bigner DD, Nevins JR, West M. Gene expression profiling and genetic markers in glioblastoma survival. Cancer Res 2005;65:4051e8. [5] Lacroix M, Abi-Said D, Fourney DR, Gokaslan ZL, Shi W, DeMonte F, Lang FF, McCutcheon IE, Hassenbusch SJ, Holland E, Hess K, Michael C, Miller D, Sawaya R. A multivariate analysis of
[9]
[10]
[11]
[12]
[13]
37
416 patients with glioblastoma multiforme: prognosis, extent of resection, and survival. J Neurosurg 2001;95:190e8. Bhowmick DA, Zhuang Z, Wait SD, Weil RJ. A functional polymorphism in the EGF gene is found with increased frequency in glioblastoma multiforme patients and is associated with more aggressive disease. Cancer Res 2004;64:1220e3. Shahbazi M, Pravica V, Nasreen N, Fakhoury H, Fryer AA, Strange RC, Hutchinson PE, Osborne JE, Lear JT, Smith AG, Hutchinson IV. Association between functional polymorphism in EGF gene and malignant melanoma. Lancet 2002;359:397e401. Feldkamp MM, Lau N, Guha A. Signal transduction pathways and their relevance in human astrocytomas. J Neurooncol 1997;35: 223e48. Nishikawa R, Ji XD, Harmon RC, Lazar CS, Gill GN, Cavenee WK, Huang HJ. A mutant epidermal growth factor receptor common in human glioma confers enhanced tumorigenicity. Proc Natl Acad Sci U S A 1994;91:7727e31. McCarron SL, Bateman AC, Theaker JM, Howell WM. EGF þ61 gene polymorphism and susceptibility to and prognostic markers in cutaneous malignant melanoma. Int J Cancer 2003;107:673e5. Amend KL, Elder JT, Tomsho LP, Bonner JD, Johnson TM, Schwartz J, Berwick M, Gruber SB. EGF gene polymorphism and the risk of incident primary melanoma. Cancer Res 2004;64: 2668e72. Randerson-Moor JA, Gaut R, Turner F, Whitaker L, Barrett JH, Silva Idos S, Swerdlow A, Bishop DT, Bishop JA. The relationship between the epidermal growth factor (EGF) 50 UTR variant A61G and melanoma/nevus susceptibility. J Invest Dermatol 2004;123: 755e9. Ktistaki E, Talianidis I. Modulation of hepatic gene expression by hepatocyte nuclear factor 1. Science 1997;277:109e12.
The 61 A/G EGF polymorphism is functional but is neither a prognostic marker nor a risk factor for glioblastoma Elodie Vauleona,b, Nathalie Augera,b, Alexandra Benouaich-Amiela,b,c, Florence Laigle-Donadeyc, Gentian Kaloshic, Julie Lejeunec, Jean-Yves Delattrea,b,c, Joe¨lle Thilleta,b, Marc Sansona,b,c,* a
INSERM, U711, Biologie des Interactions Neurones & Glie, 75651 Paris cedex 13, France b Universite´ Pierre et Marie Curie, Faculte´ de Me´decine, Paris, France c Service de Neurologie Mazarin, Groupe Hospitalier Pitie´-Salpeˆtrie`re, 47 boulevard de l’Hoˆpital, 75013 Paris, France Received 6 June 2006; received in revised form 13 July 2006; accepted 24 July 2006
Abstract
The A/G61 polymorphism located in the 50 UTR of the EGF gene has been found to be both a risk factor and a prognostic factor in glioblastoma (GBM), but the functional consequences have not been investigated. Here we show, in vitro, that this polymorphism is functional, in that the G allele promoter is 40% more active than the A variant (P ! 0.001). However, analysis of a large series of 209 GBM patients and 214 control subjects did not confirm that A/G61 polymorphism is a significant risk factor for GBM, despite a trend for higher GG frequency in these patients. Furthermore, A/G61 polymorphism was not a prognostic factor for survival in GBM patients, although it does appear to affect progression-free survival. Ó 2007 Elsevier Inc. All rights reserved.
1. Introduction With a median survival of 12e15 months, glioblastoma (GBM) is the most frequent (65%) and most malignant histological subtype of glioma [1,2]. None of the most frequent molecular alterations involved in GBM (10q loss, EGFR amplification, TP53 mutation, TP16 deletion, and PTEN mutation [3,4]) serve as clear prognostic markers, in contrast to clinical factors such as age and performance status, which do have a strong effect on survival [5]. The majority of GBMs are sporadic, and little is known about the environmental and genetic risk factors in this context; it is tempting, however, to postulate that functional polymorphisms involving the genes just mentioned may represent risk factors for glioma development. A recent study suggested that a polymorphism located in the 50 UTR of the EGF gene (G in position 61) is both a risk factor for GBM and a prognostic factor in GBM patients [6]; however, these data were based on a small series (42 patients) and have not been confirmed to date. Moreover, it has been supposed, but not demonstrated, that this polymorphism is functional.
* Corresponding author. Tel.: þ33-(0)1-42160573; fax: 33-(0)142160375. E-mail address: [email protected] (M. Sanson). 0165-4608/06/$ e see front matter Ó 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.cancergencyto.2006.07.013
In the present study, we demonstrated that this variant indeed bears functional consequences in vitro. We also analyzed the role of 61 A/G EGF polymorphism as a prognostic factor and a risk factor for GBM in a large case-control study (423 subjects in all). 2. Methods 2.1. EGF-luciferase constructs For the amplification of the 960-1532 EGF gene sequence (GenBank accession no. AF 023155), the following primers were used: forward 50 -GGAAGATCTGAACTATCTTTACTAT-30 and reverse 50 -CCCAAGCTTTCCTGACACCTATGACAA-30 (the nucleotides highlighted in bold italics correspond respectively to the restriction site of BglII and HindIII). The amplification of the 573-bp region containing either A or G variants was performed in a 25-mL reaction containing 200 ng total DNA, 1.5 mL each primer (10 mmol/L), and 10 mL master mix (Eppendorf, Hamburg, Germany). The polymerase chain reaction (PCR) conditions were 5 minutes at 95 C, followed by 35 cycles of 95 C for 30 seconds, 48 C for 30 seconds and 72 C for 3 minutes and finally 72 C for 7 minutes. The PCR products were then purified and cloned in luciferase promoterless expression vector pGL3 by standard methods. Both clones pGL3-EGF A and G were checked by
E. Vauleon et al. / Cancer Genetics and Cytogenetics 172 (2007) 33e37
sequencing on an ABI 3100 genetic analyzer (Applied Biosystems, Foster City, CA). 2.2. Cell culture and transfection CHO Chinese hamster ovary cells (American Type Culture Collection, Rockville,MD) were maintained in F12 HAM (Invitrogen, Carslbad, CA), 10% fetal bovine serum, 10 U/mL penicillin, and 10 mg/mL streptomycin. CHO cells (3e3.5 105) were seeded in six-well plates, incubated for 24 hours, and transfected with 3 mg vectors (pGL3-EGF A, pGL3-EGF G), 0.5 mg pSV 40-b-galactosidase and 10 mL Lipofectin (Invitrogen) in 100 mL serum-free medium. After 48 hours, cells were harvested for assays. Transfections were performed in triplicate. The luciferase activity was measured by using luciferase assay substrate (Promega, Madison, WI) in a Victor luminometer (Wallac, Evry, France). Protein concentration was determined using a bicinchoninic acid assay; b-galactosidase activity was measured at 450 nm after addition of Na2CO3 1 mol/L. 2.3. Patients A total of 209 GBM patients (mean age 55.9, range 22 to 83, overall survival 5 16.5 months) were selected from our neurooncology database out of 849 patients (24.6%) treated for GBM from 1998 to 2004 (mean age 56.2, range 17 to 83, overall survival 5 15 months). The inclusion criteria were a histologic diagnostic of GBM (WHO grade IV), age > 18 years, clinical data and follow-up available on the database, no previous history of glial tumor, informed consent obtained, and blood and tumor sample available. Of these 209 GBM patients, 34 (16%) had a biopsy, 48 (23%) had partial tumor removal, and 127 (61%) had complete tumor removal. Postsurgical treatment consisted of both radiotherapy and chemotherapy for 117 patients (56%), radiotherapy alone for 55 patients (26.3%), chemotherapy alone for 26 patients (12.4%), and supportive care for 11 patients (5.3%). Control DNA was obtained from 214 unrelated healthy white volunteers (mainly laboratory staff), ranging in age from 16 to 75 years (median 5 49.0).
2.6. EGFR amplification EGFR amplification of tumor DNA was detected by realtime PCR with an internal probe. The EGFR primers (forward: GTGCAGATCGCAAAGGTAATCAG; reverse: GCAGACCGCATGTGAGGAT; probe: CCCCTCCCCGTATCTC; FAM fluorescein dye labeled) amplified a 79-bp genomic fragment. The reference primers amplified a genomic fragment from RNase P (TaqMan RNase P detection reagents, FAM dye, ref. no. 4316831; Applied Biosystems). Realtime PCR cycles were performed as follows: 50 C for 2 minutes, 95 C for 15 minutes, 40 cycles of 15 seconds at 95 C, and a final 60 C for 1 minute.
2.7. Statistical analysis Chi-square tests were used to compare the genotype distribution between the two groups (GBM and control) and odds ratios were calculated. The associations between qualitative variables were calculated with a c2 test, and the association with continuous variables was calculated with a KruskaleWallis test. Progression-free survival was defined as the time between the diagnosis and recurrence or last follow-up and overall survival was defined as the time between diagnosis and death or last follow-up. Survival curves were obtained by KaplaneMeier methods and were compared using a Log rank test. The following factors were entered as candidate variables in the multivariate Cox proportional hazard regression model analysis: genotype, age, type of surgery, and postoperative treatment. Two-sided P-values ! 0.05 were considered significant.
800
600
U
34
400
2.4. DNA DNAwas extracted from blood and from frozen or paraffin embedded tumor sample according to standard techniques. 2.5. Polymorphism identification PCR amplification was performed as previously published [7]. Uncertain genotypes were confirmed by real-time PCR allelic discrimination with a EGF-Assayon-Demand kit (Applied Biosystems).
200
0
A
G
Fig. 1. Comparison of the two variant promoters, EGF A and EGF G, shows that the G variant results in 40% higher luciferase activity (U, arbitrary units). Error bars indicate 61 standard deviation.
E. Vauleon et al. / Cancer Genetics and Cytogenetics 172 (2007) 33e37 Table 1 Comparison of genotypes allele frequencies in the glioblastoma and control groups Genotype Sample size Genotype AA AG GG Allelotype Allele A Allele G
Controls, no. (%)
GBM patients, no. (%)
n 5 214
n 5 209
63 (29.5) 120 (56.1) 31 (14.5)
63 (30.1) 102 (48.8) 44 (21.1)
246 (57.5) 182 (42.5)
228 (54.5) 190 (45.5)
OR (95% CI)
P
1 0.85 (0.55e1.32) 1.42 (0.80e2.50)
0.16
0.39
Abbreviations: CI, confidence interval; GBM, glioblastoma; OR, odds ratio.
3. Results The 573-bp region containing either 61A or 61G variants was cloned upstream to luciferase reporter gene in pGL3 vector. When expressed in CHO cells, the G variant resulted in a 40% higher activity than the A variant (Fig. 1) (P ! 0.001), which shows that this fragment of the promoter region is functional and that the A/G 61 polymorphism has functional consequences in terms of transcriptional activity. The functional consequences were then investigated in terms of risk factor and prognosis for GBM. The frequency of the EGF variants was as follows: AA 5 63, AG 5 102, GG 5 44 for GBM population and AA 5 63, AG 5 120,
35
GG 5 31 for the control population. A higher frequency of GG (21.1 % versus 14.5 %) and a lower frequency of AG (48.8 % versus 56.1 %) was found in the GBM than in the control population, but the difference did not reach significance (P 5 0.16; c2 test) (Table 1). Allele frequencies did not differ between the GBM (A 5 114, G 5 95) and control (A 5 123, G 5 91) (P 5 0.39) populations (Table 1). The distribution of EGF genotypes was independent of sex (P 5 0.25), age (P 5 0.34), and EGFR amplification status in tumor DNA (P 5 0.85). EGFR amplification was detected in 68 out of 209 tumor DNA samples. PFS differed among genotypes AA (median 5 8.6 months; 95% CI 5 6.7e12.6), AG (median 5 8.2 months; 95% CI 5 6.3e9.6), and GG (median 5 9.55 months; 95% CI 5 7.7e13)dthe last being characterized by a better prognosis (P 5 0.047) (Fig. 2). The difference in PFS was clearer between AG and GG (P 5 0.022), but no difference in PFS was found between allele A and G (AA versus AGþGG, P 5 0.42; GG versus AG þAA, P 5 0.07). The comparison of overall survival among the three genotypes showed no difference (P 5 0.45) (Fig. 3), and no difference in overall survival was found between allele A and G (AA versus AGþGG, P 5 0.357; GG versus AG þAA, P 5 0.64). No significant prognostic impact of EGF genotype was found when the samples were analyzed separately with regards to the extent of resection, age and EGFR status.
1.0
% Progression free survival
0.8
0.6
0.4
AA AG
0.2
GG
0.0 0
20
40
60
80
100
Months Fig. 2. Progression-free survival (PFS) according to genotype. Median PFS was 8.6 months for AA, 8.2 months for AG, and 9.5 months for GG.
E. Vauleon et al. / Cancer Genetics and Cytogenetics 172 (2007) 33e37
36 1.0
0.8
% Survival
0.6
0.4
AA AG 0.2
GG
0.0 0
20
40
60
80
100
120
140
Months Fig. 3. Overall survival (OS) according to genotype. Median OS was 19 months for AA, 16.5 months for AG, and 16.1 months for GG.
On multivariate analysis, age and type of surgery, but not EGF genotype, were related to survival (Table 2).
4. Discussion The EGF/EGFR-mediated pathway is one of the most critical pathways for glioma tumorigenesis [8], and so functional polymorphisms involving EGF or EGFR may affect glioma development. In the present study, the polymorphism þ61 A/G of the EGF promoter was investigated here from a functional point of view, as a potential risk factor for GBM and as a potential prognostic marker. We found 61G allele to be more active than 61A allele (P ! 0.001), which Table 2 Multivariate analysis of genotype, age, surgery, and postsurgery treatment on survival Variable
RR (95% CI)
P
AA genotype AG genotype GG genotype Age O 56 years Surgerya Postsurgical treatmentb
1 1.28 1.16 1.72 0.6 1
0.19 0.52 0.00077 0.0019 1
(0.885e1.840) (0.735e1.841) (1.255e2.366) (0.435e0.828) (0.403e2.485)
Abbreviations: CI, confidence interval; RR, relative risk. a Total removal versus biopsy þ partial removal. b Both radiotherapy and chemotherapy; radiotherapy alone; chemotherapy alone; or supportive care.
is consistent with the 61G allele correlating with a higher blood EGF concentration [6,7]. Apparently, however, this difference does not result in clinically relevant consequences. The genotype GG, slightly but not significantly more frequent in the GBM population, can neither be retained as a risk factor for GBM nor be considered as a useful prognostic marker for clinical practice, despite its modest impact on PFS. Thus, our data, based on larger and more homogeneous series (containing only de novo GBM), do not confirm previous findings [6]. One may assume that a difference in EGF concentration has little or no clinical consequences because it is not a limiting step in the EGFR-mediated transduction signal pathway. For example, (i) EGFR may be constitutively active because of a truncating mutation resulting in EGFR vIII variant, which affects 25% of GBM [9], or (ii) EGFR may be activated not only by EGF but also by TGFa, or (iii) it may be that the downstream Pi3K pathway is activated by PTEN inactivation, which occurs frequently in GBM. Likewise, melanoma studies have resulted in conflicting results, with a first positive study being contradicted by three successive negative studies, suggesting that this polymorphism is neither a marker of predisposition nor a prognostic factor for melanoma [7,10e12]. In conclusion, we have established a functional difference between the A61 and G61 alleles of the EGF promoter, but one that does not result in risk factor or prognostic consequence for GBM patients and has
E. Vauleon et al. / Cancer Genetics and Cytogenetics 172 (2007) 33e37
therefore no clinical impact. Nevertheless, the finding raises new questions. For example, in silico analysis detects a potential binding site for HNF1 (hepatocyte nuclear factor 1) transcription factor when a G, but not an A, is present at position 61. This could explain the difference of activity between the two variants and the resulting difference in EGF concentration [13]. Additional studies are needed to confirm this hypothesis.
[6]
[7]
[8]
References [1] Ohgaki H, Kleihues P. Epidemiology and etiology of gliomas. Acta Neuropathol (Berl) 2005;109:93e108. [2] Kleihues P, Louis DN, Scheithauer BW, Rorke LB, Reifenberger G, Burger PC, Cavenee WK. The WHO classification of tumors of the nervous system. J Neuropathol Exp Neurol 2002;61:215e25. discussion 226e9. [3] Ohgaki H, Dessen P, Jourde B, Horstmann S, Nishikawa T, Di Patre PL, Burkhard C, Schuler D, Probst-Hensch NM, Maiorka PC, Baeza N, Pisani P, Yonekawa Y, Yasargil MG, Lutolf UM, Kleihues P. Genetic pathways to glioblastoma: a population-based study. Cancer Res 2004;64:6892e9. [4] Rich JN, Hans C, Jones B, Iversen ES, McLendon RE, Rasheed BK, Dobra A, Dressman HK, Bigner DD, Nevins JR, West M. Gene expression profiling and genetic markers in glioblastoma survival. Cancer Res 2005;65:4051e8. [5] Lacroix M, Abi-Said D, Fourney DR, Gokaslan ZL, Shi W, DeMonte F, Lang FF, McCutcheon IE, Hassenbusch SJ, Holland E, Hess K, Michael C, Miller D, Sawaya R. A multivariate analysis of
[9]
[10]
[11]
[12]
[13]
37
416 patients with glioblastoma multiforme: prognosis, extent of resection, and survival. J Neurosurg 2001;95:190e8. Bhowmick DA, Zhuang Z, Wait SD, Weil RJ. A functional polymorphism in the EGF gene is found with increased frequency in glioblastoma multiforme patients and is associated with more aggressive disease. Cancer Res 2004;64:1220e3. Shahbazi M, Pravica V, Nasreen N, Fakhoury H, Fryer AA, Strange RC, Hutchinson PE, Osborne JE, Lear JT, Smith AG, Hutchinson IV. Association between functional polymorphism in EGF gene and malignant melanoma. Lancet 2002;359:397e401. Feldkamp MM, Lau N, Guha A. Signal transduction pathways and their relevance in human astrocytomas. J Neurooncol 1997;35: 223e48. Nishikawa R, Ji XD, Harmon RC, Lazar CS, Gill GN, Cavenee WK, Huang HJ. A mutant epidermal growth factor receptor common in human glioma confers enhanced tumorigenicity. Proc Natl Acad Sci U S A 1994;91:7727e31. McCarron SL, Bateman AC, Theaker JM, Howell WM. EGF þ61 gene polymorphism and susceptibility to and prognostic markers in cutaneous malignant melanoma. Int J Cancer 2003;107:673e5. Amend KL, Elder JT, Tomsho LP, Bonner JD, Johnson TM, Schwartz J, Berwick M, Gruber SB. EGF gene polymorphism and the risk of incident primary melanoma. Cancer Res 2004;64: 2668e72. Randerson-Moor JA, Gaut R, Turner F, Whitaker L, Barrett JH, Silva Idos S, Swerdlow A, Bishop DT, Bishop JA. The relationship between the epidermal growth factor (EGF) 50 UTR variant A61G and melanoma/nevus susceptibility. J Invest Dermatol 2004;123: 755e9. Ktistaki E, Talianidis I. Modulation of hepatic gene expression by hepatocyte nuclear factor 1. Science 1997;277:109e12.