The abasic site lesions in the human telomeric sequence d[TA(G3T2A)3G3]: A thermodynamic point of view

Biochimica et Biophysica Acta 1820 (2012) 2037–2043

Contents lists available at SciVerse ScienceDirect

Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbagen

The abasic site lesions in the human telomeric sequence d[TA(G3T2A)3G3]: A thermodynamic point of view Antonella Virgilio a, 1, Luigi Petraccone b, 1, Veronica Esposito a, Giuseppe Citarella a, Concetta Giancola b,⁎, Aldo Galeone a,⁎⁎ a b

Dipartimento di Chimica delle Sostanze Naturali, Università degli Studi di Napoli ‘Federico II’, Via D. Montesano 49, I-80131 Napoli, Italy Dipartimento di Chimica ‘P. Corradini’, Università degli Studi di Napoli ‘Federico II’, Via Cintia, I-80126 Napoli, Italy

a r t i c l e

i n f o

Article history: Received 30 March 2012 Received in revised form 6 September 2012 Accepted 14 September 2012 Available online 20 September 2012 Keywords: Quadruplex structure Abasic site Telomere Differential scanning calorimetry (DSC) Thermal difference spectrum (TDS)

a b s t r a c t Background: The abasic sites represent one of the most frequent lesions of DNA and most of the events able to generate such modifications involve guanine bases. G-rich sequences are able to form quadruplex structures that have been proved to be involved in several important biological processes. Methods: In this paper, we report investigations, based on calorimetric, UV, CD and electrophoretic techniques, on 12 oligodeoxynucleotides analogues of the quadruplex forming human telomere sequence d[TA(G3T2A)3G3], in which each guanine has been replaced, one at a time, by an abasic site mimic. Results: Although all data show that the modified sequences preserve their ability to form quadruplex structures, the thermodynamic parameters clearly indicate that the presence of an abasic site decreases their thermal stability compared to the parent unmodified sequence, particularly if the replacement concerns one of the guanosines involved in the formation of the central G-tetrad. Conclusions: The collected data indicate that the effects of the presence of abasic site lesions in telomeric quadruplex structures are site-specific. The most dramatic consequences come out when this lesion involves a guanosine in the centre of a G-run. General significance: Abasic sites, by facilitating the G-quadruplex disruption, could favour the formation of the telomerase primer. Furthermore they could have implications in the pharmacological approach targeting telomere. © 2012 Elsevier B.V. All rights reserved.

1. Introduction The ability of DNA to form higher order secondary structures and, in several cases, the occurrence of proteins able to specifically recognize and interact with them make these structures one of the most attractive research fields in molecular biology. In recent years, amongst the various unusual DNA structures discovered to date, G-quadruplexes (based on the stacking of two or more cyclic arrangements of four guanines, called G-tetrads) have been the focus of several disciplines ranging from structural chemistry to medicinal chemistry [1] and, recently, to nanotechnology [2]. Their spread is probably due to some main peculiar features: 1) an outstanding thermal stability if compared to other DNA structures [3]; 2) the consensus sequence required for their formation (at least four runs of guanines, with at least two guanines per run) that is particularly prone to be identified in genomes by suitable algorithms [4]; 3) their tremendous structural variability [5] and 4) the

⁎ Corresponding author. Tel.: +39 081674266. ⁎⁎ Corresponding author. Tel.: +39 081678542; fax: +39 081678552. E-mail addresses: [email protected] (C. Giancola), [email protected] (A. Galeone). 1 These authors contributed equally to this work. 0304-4165/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.bbagen.2012.09.011

presence of more than 370,000 G-rich sequences in the human genome potentially able to fold in G-quadruplex structures [4]. Particularly, G-rich sequences have been observed in critical segments of eukaryotic and prokaryotic genomes, promoter regions of ribosomal DNAs, as well as telomeres in eukaryotes and immunoglobulin heavy chain switch regions of higher vertebrates [6]. The potential of these sequences to form G-quadruplex structures is related to transient duplex destabilization, a process that accompanies several significant biological events such as transcription, replication and recombination. Taking into account the potential roles that G-quadruplexes could play in many biological processes the sequence integrity of the G-tract is a key factor for their functionality. It is well known that a broad variety of causes renders DNA susceptible to damages and mutations [7,8]. One of the most frequent lesions of DNA is the presence of abasic sites that can arise from spontaneous (such as depurination) [9] and enzymatic processes [10] or chemical damage, for example due to free radicals and alkylating agents promoting the release of bases, often by introducing modifications that destabilize the N-glycosidic bond [11,12]. Since many of the events generating abasic sites involve guanine bases, the investigation of the effects of their presence on G-quadruplex structures for which a biological role has been ascertained or is strongly suspected (such as the structures formed by telomeric sequences) [13], represents

2038

A. Virgilio et al. / Biochimica et Biophysica Acta 1820 (2012) 2037–2043

an important and quite unexplored research topic. Recently we investigated the structural, thermodynamic and kinetic properties of parallel G-quadruplex formed by modified sequences d(TG5T) containing an abasic site replacing, one at a time, a guanosine in the sequence [14]. Although all oligonucleotides investigated preserve their ability to form quadruplexes, both spectroscopic and kinetic experiments point to sequence-dependent different effects on the structural flexibility and stability. Afterwards, CD and PAGE investigations concerning the human telomere sequences d[G3(TTAG3)3] [15] and d[A(G3T2A)3G3] [16] containing abasic sites have been reported. In the first study authors found that none of the 12 possible abasic sites hinders the formation of the quadruplex, but all provide the structure with a reduced thermodynamic stability compared to the parent sequence [15]. However, since this study is based on a quadruplex formed by a natural human telomeric sequence never appropriately characterized by specific structural methods of investigation as NMR or X-ray, it is rather difficult to discuss the effects of abasic sites in this sequence without having the unmodified quadruplex structure as a reference. The second study focusses on the effects of molecular crowding on the structure and stability of the quadruplex formed by the human telomere sequences d[A(G3T2A)3G3] [16]. In this case, although structural studies have clearly ascertained [17] that this sequence forms an antiparallel quadruplex in Na+ solution, a detailed characterization of this structure in K+ solution is lacking, probably as it does not form a single G-quadruplex structure in this condition [18]. Taking into account that the K+ solution is usually accepted as a good model of intracellular environments (in which the potassium is much more abundant than sodium) this point represents the major drawback of the study. Even though the structure of the single-stranded telomeric overhang is not known, some important investigations showed that the most plausible structure in solution involves quadruplexes in an alternating hybrid 1–hybrid 2 arrangement [19,20]. For these reasons, investigations concerning the effects of abasic sites on the telomeric structure should mainly involve sequences able to form hybrid 1 or hybrid 2 quadruplex types. The present study is based on the human telomere sequence d[TA(G3T2A)3G3], that has proven to form a major monomolecular quadruplex in potassium ions solutions (hybrid 1), whose structure has been extensively investigated by NMR techniques [21]. Each of the sequences in which a guanine residue has been replaced, one at a time, by an abasic site mimic (Fig. 1, Table 1), has been studied for the first time by calorimetric (DSC: differential scanning calorimetry) and specific UV (TDS: thermal difference spectra) [22] techniques, besides CD and electrophoretic techniques. Our data suggest that the presence

Table 1 Sequences of the modified oligonucleotides containing the abasic site (dS); the unmodified sequence is listed first. Sequence name

Sequences

Nat S1 S2 S3 S4 S5 S6 S7 S8 S9 S10 S11 S12

TAGGGTTAGGGTTAGGGTTAGGG TAdSGGTTAGGGTTAGGGTTAGGG TAGdSGTTAGGGTTAGGGTTAGGG TAGGdSTTAGGGTTAGGGTTAGGG TAGGGTTAdSGGTTAGGGTTAGGG TAGGGTTAGdSGTTAGGGTTAGGG TAGGGTTAGGdSTTAGGGTTAGGG TAGGGTTAGGGTTAdSGGTTAGGG TAGGGTTAGGGTTAGdSGTTAGGG TAGGGTTAGGGTTAGGdSTTAGGG TAGGGTTAGGGTTAGGGTTAdSGG TAGGGTTAGGGTTAGGGTTAGdSG TAGGGTTAGGGTTAGGGTTAGGdS

of the abasic site destabilizes the 3 + 1 hybrid 1 structure and favours the formation of an antiparallel quadruplex with two G-tetrads. A short discussion concerning the biological and pharmacological impact of the presence of abasic sites in the telomere architecture is also included.

2. Materials and methods 2.1. Oligonucleotides synthesis and purification Oligonucleotides reported in Table 1 were synthesized on a Millipore Cyclone Plus DNA synthesizer using solid phase βcyanoethyl phosphoramidite chemistry at 15 μmol scale. The synthesis was performed by using normal 3′-phosphoramidites and a 5′dimethoxytrityl-3′-phosphoramidite-1′,2′-dideoxyribose (dSpacer, dS, Link Technologies) for the introduction of an abasic site mimic moiety in each sequence. For ODN S12 a universal support was also used. The oligomers were detached from the support and deprotected by treatment with concentrated aqueous ammonia at 55 °C overnight. The combined filtrates and washings were concentrated under reduced pressure, redissolved in H2O, analyzed and purified by high-performance liquid chromatography on a Nucleogel SAX column (Macherey–Nagel, 1000-8/46), using buffer A: 20 mM KH2PO4/K2HPO4 aqueous solution (pH 7.0) containing 20% (v/v) CH3CN and buffer B: 1 M KCl, 20 mM KH2PO4/K2HPO4 aqueous solution (pH 7.0) containing 20% (v/v) CH3CN; a linear gradient from 0 to 100% B for 45 min and flow rate at 1 ml/min were used. The fractions of the oligomers were collected and successively desalted by Sep-pak cartridges (C-18). The isolated oligomers proved to be >98% pure by NMR.

2.2. Circular dichroism

Fig. 1. Schematic representation of dSpacer and d[TA(G3T2A)3G3] quadruplex structure. Left: structure of the tetrahydrofuranyl analogue, dSpacer (dS), introduced in ODNs in Table 1 as an abasic site mimic. Right: quadruplex structure adopted by the sequence d[TA(G3T2A)3G3] (Nat). Non-G residues have been omitted for clarity. Anti and syn residues are in black and grey, respectively. Guanosines have been labelled according the residues replaced by a dS in ODNs listed in Table 1.

CD (circular dichroism) spectra and CD melting curves were registered on a Jasco 715 circular dichroism spectrophotometer in a 0.1 cm pathlength cuvette and the wavelength was varied from 220 to 320 nm. The spectra were recorded with a response of 16 s at 2.0 nm bandwidth and normalized by subtraction of the background scan with buffer. The temperature was kept constant at 20 °C with a thermoelectrically controlled cell holder (Jasco PTC-348). For all the sequences the strand concentration was 25 μM. CD melting curves were registered as a function of temperature from 20 to 80 °C at 294 nm with a scan rate of 1 °C min−1. The CD melting curves were modelled by a two-state transition according to the van't Hoff analysis [23]. The melting temperature (Tm) and the enthalpy change (ΔH°) values (Table 2) provide the best fit of the experimental melting data.

A. Virgilio et al. / Biochimica et Biophysica Acta 1820 (2012) 2037–2043 Table 2 Thermodynamic parameters for the unfolding processes of the studied quadruplexes obtained by the van't Hoff analysis of the CD melting curves. Sequences

Tm (°C) (±1)

ΔHv.H. (kJ mol−1 )a

Nat S1 S2 S3 S4 S5 S6 S7 S8 S9 S10 S11 S12

66 49 38 47 48 42 48 48 40 47 45 41 47

210 158 128 155 167 114 143 163 112 149 156 119 160

a

2039

data interval of 1 nm. The difference between the UV spectrum at high temperature (90 °C) and the UV spectrum at low temperature (20 °C) is defined as the thermal difference spectrum (TDS) and represents the spectral difference between the unfolded and the folded form. The temperature was kept constant at 20 °C or at 90 °C with a thermoelectrically-controlled cell holder (Jasco PTC-348). 2.5. Gel electrophoresis Modified oligonucleotides and their natural counterpart were analyzed by non-denaturing PAGE. Samples were prepared at 50 μM strand concentration in a buffer 20 mM KH2PO4, 70 mM KCl and 0.2 mM EDTA, pH = 7 and were loaded on a 20% polyacrylamide gel containing Tris–Borate-EDTA (TBE) 2.5× and KCl 20 mM. The run buffer was TBE 1× pH = 7.5 containing 70 mM KCl. For all samples, a solution of glycerol/TBE 1×–70 mM KCl 2:1 was added just before loading. Electrophoresis was performed at 9.2 V cm −1 at a temperature close to 5 °C. Bands were visualized by UV shadowing.

The error on ΔHv.H. is within the 10%.

2.3. Differential scanning calorimetry

3. Results and discussion

Differential scanning measurements were performed on a last generation nano-DSC (TA Instruments). The excess molar heat capacity function ΔCP was obtained after a baseline subtraction, assuming that the baseline is given by the linear temperature dependence of the native-state heat capacity. A buffer versus buffer scan was subtracted from the sample scan. All systems were tested for reversibility by running the heating and cooling curves at the same scan rate of 1°min−1. The process enthalpies, ΔH°, were obtained by integrating the area under the heat capacity versus the temperature curves. Tm is the temperature corresponding to the maximum of each DSC peak. Entropy values were obtained by integrating the curve ΔCp/T versus T (where ΔCp is the molar heat capacity and T is the temperature in Kelvin). The thermodynamic parameters in Table 3 represent averages of heating curves from three to five experiments. The reported errors for thermodynamic parameters are the standard deviations of the mean from the multiple determinations. The measurements were performed with a DNA strand concentrations in the range 50–100 μM.

3.1. CD spectra and CD thermal analysis

2.4. UV-thermal difference spectra (TDS) UV samples of oligonucleotides reported in Table 1 were prepared using a buffer solution 10 mM lithium cacodylate at pH 7.2 supplemented with 70 mM KCl. For each oligonucleotide sample, an UV spectrum was recorded above and below its melting temperature (Tm). All experiments were performed on a JASCO V-530 UV/Vis spectrophotometer using quartz cuvettes with an optical pathlength of 1 cm and at 25 μM strand concentration. Absorbance spectra were recorded in the 220–320 nm range, with a scan speed of 200 nm min−1 and with a Table 3 Thermodynamic parameters for the unfolding processes of the studied quadruplexes measured by the differential scanning calorimetry. Sequences

Tcal (°C) (±1)

ΔHcal (kJ mol−1)

ΔS° (kJ mol−1 K−1)

Nat S1 S2 S3 S4 S5 S6 S7 S8 S9 S10 S11 S12

67 53 37 49 49 37 49 48 34 46 46 39 49

242 ± 9 144 ± 7 98 ± 5 164 ± 4 178 ± 5 121 ± 6 92 ± 4 114 ± 7 131 ± 6 156 ± 7 144 ± 6 115 ± 3 142 ± 5

0.73 ± 0.04 0.44 ± 0.02 0.31 ± 0.02 0.51 ± 0.03 0.56 ± 0.03 0.38 ± 0.02 0.28 ± 0.01 0.38 ± 0.02 0.42 ± 002 0.49 ± 0.02 0.45 ± 0.03 0.37 ± 0.01 0.44 ± 0.02

The starting sequence for this study was the 23-mer d[TA(G3T2A)3G3] oligonucleotide. The CD spectrum in K+-containing solution (Fig. 2) shows the characteristic profile of the hybrid 1 quadruplex conformation with a positive band around 290 nm, a shoulder around 265 nm and a negative band at 240 nm [24]. Most of the CD spectra for the sequences containing the abasic site show a profile different from that of natural sequence and are characterized by a main positive band at 295 nm, a second positive band at about 250 nm and a minimum at 264 nm. These spectral features are close to those reported for the antiparallel structure formed by the human telomeric DNA in Na+ solution [25] and suggest that the introduction of the abasic site drastically changes the DNA conformation and most likely induces a conformational transition from the initial hybrid conformation to an antiparallel conformation. This hypothesis is also in agreement with recent interpretations of CD spectra of DNA G-quadruplexes, based on different stacking orientations between adjacent G-tetrads [26,27]. It is reasonable to assume that these antiparallel quadruplex structures contain only two G-tetrads, as the introduction of an abasic site in the unmodified sequence directly affects the formation of one G-tetrad. This hypothesis is supported by observation that the human telomeric sequence is able to form stable antiparallel structure with only two G-tetrads [28]. Further, antiparallel structures containing only two G-tetrads have been reported also for other telomeric sequences having CD spectra very similar to those observed for the modified sequences of this study [29,30]. Specifically, Phan and co-workers found by NMR that the Giarda telomeric sequence d(TAGGG)4, where a guanine was substituted with an inosine, adopts in K + solution a predominant two-G-tetrad conformation. The corresponding CD profile was characterized by two positive peaks at around 245 and 295 nm and a negative peak at 265 nm [24]. The same CD signature was observed for most of the spectra of modified quadruplexes of the present study. A possible model of two-tetrads intramolecular antiparallel quadruplex structures for an ODN containing an abasic site (S6) is shown in Fig. S1 in Supplementary material. To evaluate the effect of the introduction of the abasic site on the G-quadruplex thermal stability the melting and annealing of modified oligonucleotides were followed by CD experiments and compared with the melting and the annealing of the unmodified oligonucleotide in the same solution conditions. The melting and annealing curves are superimposable (data not shown), indicating a fast and reversible process for the quadruplex formation. The melting temperatures and enthalpy change values obtained by the van't Hoff analysis of CD melting curves are shown in Table 2.

2040

A. Virgilio et al. / Biochimica et Biophysica Acta 1820 (2012) 2037–2043

Fig. 2. Circular dichroism profiles of the ODNs studied. CD spectra of all the DNA sequences employed in this study recorded at 20 °C; all the solutions contain 20 mM phosphate with 70 mM KCl, 0.1 mM EDTA, at pH 7.0. The CD spectrum of the TBA intramolecular antiparallel quadruplex structure (TBA) containing two G-tetrads is also included for comparison.

Inspection of Table 2 reveals that the introduction of the abasic site results in lower Tm and ΔH values for all the modified sequences in comparison with the unmodified DNA and the degree of destabilization is dependent on the position of the abasic site. Particularly, the destabilizing effect is greater in the sequences (S2, S5, S8, and S11) where the abasic site replaces a guanine residue of the central G-tetrad in the unmodified sequence. 3.2. DSC thermodynamic analysis The complete thermodynamic characterization relative to the quadruplex melting process was accomplished by differential scanning calorimetry (DSC). Fig. 3 shows the calorimetric profiles for the S1, S2 and S3 sequences. Inspection of the DSC profiles clearly shows that the destabilizing effect is greater in sequence S2 where the abasic site replaces a guanine residue of the central G-tetrad in the unmodified sequence. Similar results were observed for the modified oligonucleotides S5, S8 and S11 in which the other guanines of the central G-tetrad have been replaced (Fig. S2 in Supplementary material). Further, the DSC peaks of these sequences are clearly lower and larger if compared with the peaks for the other sequences. This could be due to the intrinsic lower enthalpy change of the corresponding transition but also to the presence of multiple G-quadruplex conformation having similar melting temperatures. The complete thermodynamic parameters for all the studied oligonucleotides are reported in Table 3. The melting temperatures are in good agreement with those obtained by CD measurements for most of the sequences and larger differences in the Tm evaluated by the two methods (ΔTm = +5–6 °C) were observed only for S5 and S8 further suggesting the presence of multiple species for this two sequences. Comparison between Tables 2 and 3 reveals significant differences in the ΔHv.H. and ΔHcal values for S2, S6 and S7 indicating that the corresponding quadruplexes do not melt in a simple two-state process, as observed by other authors for the human telomeric sequence AG3(T2AG3)3 [31]. The value of enthalpy change for the unmodified sequence (242 kJ mol−1) is consistent with the formation of three G-quartet planes, evaluating the contribution for tetrad formation about 70–80 kJ mol−1 [32]. The enthalpy change values measured for the modified sequences vary in the range 100–180 kJ mol−1 depending on the position of the abasic site. The lower ΔH values observed in the

modified sequence compared with the unmodified one are consistent with the loss of one G-tetrad due to the presence of the abasic site. The S1, S3, S4, S9 and S10 sequences have the highest melting temperatures and enthalpy changes revealing that the extra stability of the corresponding quadruplex structures is due to a higher number of interactions. On the other hand, these sequences show also the highest values of the entropy change for the unfolding process suggesting that their folded structures are the more rigid and well structured in comparison with the other modified quadruplexes. Furthermore, both the enthalpy and entropy changes of S1 and S12 are very similar indicating that the introduction of an abasic site at the 3′-end or at the 5′-end has the same effect.

Fig. 3. Differential scanning calorimetry profiles for the S1, S2 and S3 sequences. All the solutions contain 20 mM phosphate with 70 mM KCl, 0.1 mM EDTA, at pH 7.0.

A. Virgilio et al. / Biochimica et Biophysica Acta 1820 (2012) 2037–2043

2041

3.3. Thermal difference spectra (TDS) A thermal difference spectrum (TDS) of an oligonucleotide can be obtained by the difference between the UV absorbance spectra of the unfolded and folded states, then, at temperatures above and below the melting temperature of the formed structure (Tm) [22]. Since the TDS shows a specific shape that is unique for each type of nucleic acid structure we have used this technique in the analysis of structures formed by the ODNs containing abasic sites. Taking into account that the TDS shape reflects the subtleties of base stacking interactions, we reasoned that this technique could allow us to obtain structural insight, particularly considering the influence of an abasic site on this type of interactions being crucial for the structural stability of a quadruplex. Fig. S3 (see Supplementary material) shows the TDS for all ODNs investigated. Although most of the spectra show profiles different from that of the natural sequence, all profiles preserve the positive peak at ~ 273 nm observed in most quadruplex structures [22]. It is interesting to note that the normalized TDS profiles of ODNs S6, S7, S9 and S10 (Fig. 4) appear very similar, thus suggesting that the introduction of an abasic site replacing a guanosine residue that connects the stem to edge-wise loops in the original structure, could lead to structural arrangements with similar stacking interactions. Particularly, this datum is corroborated by the comparable Tm values of ODNs S6 and S7, on one hand, and S9 and S10 on the other hand, in which the abasic sites flank a lateral loop in both cases (Table 3). 3.4. Gel electrophoresis The ODNs containing an abasic site (S1–S12) were further investigated by PAGE and compared to their natural counterpart. The electrophoretic profile (Fig. 5) clearly shows that most of the ODNs form quadruplex structures with electrophoretic motilities quite similar to that of the natural telomeric sequence. The comparison of their electrophoretic motilities with that of T23 suggests that all the modified ODNs adopt monomolecular conformations. It should be noted that ODNs in which the abasic site has replaced a guanosine involved in the formation of the central tetrad (namely S2, S5, S8 and S11) show slightly lower electrophoretic motilities. This datum could be tentatively explained taking into account the lower thermal stability of these ODNs (Tables 2 and 3) favouring the presence of slower migrating conformations characterized by a significant extent of fraying or, alternatively, the slight diversity in migration could be due to conformations adopting different loop arrangements. Interestingly, an electrophoretic experiment performed at much higher DNA

Fig. 5. Gel electrophoresis of the ODNs studied. Polyacrylamide gel electrophoresis of the abasic sites containing ODNs S1–S12 and their natural counterpart d[TA(G3T2A)3G3] (Nat). ODN T23 has been introduced as a reference. 20% polyacrylamide gel containing Tris–Borate-EDTA (TBE) 2.5× and KCl 20 mM. The run buffer was TBE 1× pH=7.5 containing 70 mM KCl. Samples were prepared at 50 μM ODN concentration.

concentrations (~1000 μM) reveals the formation of intermolecular quadruplexes for the S2, S5 and S8 sequences (Fig. S4 in Supplementary material). In fact, for ODNs S2, S5 and S8 the bands corresponding to the quadruplex structure are less definite. Furthermore, these ODNs show a relative more evident smearing than the other ones, particularly if compared to the intensity of the main bands. To further explore the nature of these intermolecular complexes, we collected CD spectra of these sequences after incubation of the sample at 20 °C for one day and at high DNA concentration (1000 μM). We found that, after this procedure, the CD spectra of the S2, S5 and S8 sequences (Fig. S5 in Supplementary material) significantly differ from the ones presented in Fig. 2 for the presence of an intense CD band at about 264 nm. Further, after heat denaturation and renaturation of the samples the 264 nm band disappears and the spectra previously observed at low DNA concentration are recovered (Fig. S5). Furthermore, at lower single strand concentration (20 and 50 μM), several hours of incubation are required to observe a small increase of the CD signal at 264 nm (Fig. S6 and S7). All together these data suggest that the S2, S5 and S8 sequences can form complexes of high molecularity (maybe bi or tetra-molecular parallel quadruplexes) with slow formation kinetics when incubated at high concentration (at room temperature). However, it should be noted that the formation of such species should be considered an artifact (due to higher DNA concentration and long incubation time) and then, not representative of the physiological conditions. 4. Conclusions

Fig. 4. UV-thermal difference spectra of selected ODNs. TDS profiles for ODNs S6 (blue), S7 (green), S9 (red) and S10 (yellow), normalized, giving a value of +1 for the highest positive peak. All the solutions contain 10 mM lithium cacodylate with 70 mM KCl, at pH 7.2.

The present investigation is concerned with the effects of abasic sites in the human telomeric sequence forming G-quadruplex d[TA(G3T2A)3G3]. Although all sequences examined (Table 1) preserve their ability to form quadruplex structures, the calorimetric analysis has established that they show minor thermodynamic stabilities than the unmodified parent quadruplex. Interestingly, the amount of this effect is clearly sequence-dependent. According to the melting temperatures obtained from both the van't Hoff analysis of the CD melting curves (Table 2) and the differential scanning calorimetry measurements (Table 3), the most deleterious effects on the structural stability have been found when an abasic site replaces a guanine involved in the formation of the central tetrad of the original quadruplex structure. Particularly, the whole of the data indicate that guanine residues G10 and G16, corresponding to central residues of the more inner G-runs (ODNs S5 and S8, respectively) are quite critical for the structural stability. Our data suggest a possible role of the abasic DNA lesions in the telomeric biology and pharmacology. According to the model proposed by Cech and co-authors [33] the human protein POT1 (hPOT1) may function by

2042

A. Virgilio et al. / Biochimica et Biophysica Acta 1820 (2012) 2037–2043

Fig. 6. Possible biological implications of abasic sites. Proposed scheme for the effects of an abasic site on the equilibrium quadruplex-single strand in the telomere functionality. The protein hPOT1 trapping the unfolded single-stranded form and other proteins involved have been omitted for clarity. See text for details.

trapping the unfolded single-stranded forms of the telomeric overhang (representing the telomerase primers) in equilibrium with the quadruplex structures. Furthermore the authors proposed an additional role for hPOT1 in telomere maintenance related to its ability to disrupt G-quadruplex structures [33,34] in telomeric DNA, thereby allowing proper elongation by telomerase. Since it has been proven that an abasic site clearly reduces the quadruplex stability, its presence in telomeric sequences could shift the equilibrium single strand-quadruplex or could facilitate the G-quadruplex disruption by hPOT1, thus favouring the telomeric unstructured form and then, the formation of the telomerase primer (Fig. 6). In addition, the effects of abasic sites on the telomeric sequences could have implications in the pharmacological approach targeting telomere [35]. In fact, taking into account that the presence of an abasic site leads to the formation of G-quadruplex structures less stable than and different from the original one, the ability of anticancer drugs expressly developed to interact with and stabilize the telomeric quadruplexes [36] could be significantly reduced thus rendering them partially or totally ineffective (Fig. 6). Acknowledgements The authors are grateful to ‘Centro di Servizi Interdipartimentale di Analisi Strumentale’, C.S.I.A.S., for supplying technical support in CD measurements. The authors are also grateful to Pasquale Paciello, Luisa Cuorvo and Francesca Brandi for their collaboration. Appendix A. Supplementary data Proposed models for an ODN containing an abasic site; differential scanning calorimetry profiles for the sequences S4–S12; thermal difference spectra for the sequences S1–S12; PAGE performed at higher ODN concentrations, CD profiles of S2, S5, S8 and S11 at higher ODN concentrations. Supplementary data to this article can be found online at http://dx.doi.org/10.1016/j.bbagen.2012.09.011.

References [1] G.W. Collie, G.N. Parkinson, The application of DNA and RNA G-quadruplexes to therapeutic medicines, Chem. Soc. Rev. 40 (2011) 5867–5892. [2] M.S. Kaucher, W.A.J. Harrell, J.T. Davis, The G-quartet in supramolecular chemistry and nanoscience, in: S. Neidle, S. Balasubramanian (Eds.), Quadruplex Nucleic Acids, RSC Publishing, London, 2006, pp. 253–296. [3] J.L. Mergny, J. Gros, A. De Cian, A. Bourdoncle, F. Rosu, B. Sacca, L. Guittat, S. Amrane, M. Mills, P. Alberti, M. Takasugi, L. Lacroix, Energetics, kinetics and dynamics of quadruplex folding, in: S. Neidle, S. Balasubramanian (Eds.), Quadruplex Nucleic Acids, RSC Publishing, London, 2006, pp. 31–80. [4] J.L. Huppert, S. Balasubramanian, Prevalence of quadruplexes in the human genome, Nucleic Acids Res. 33 (2005) 2908–2916. [5] A.T. Phan, V. Kuryavyi, K.N. Luu, D.J. Patel, Structural diversity of G-quadruplex scaffolds, in: S. Neidle, S. Balasubramanian (Eds.), Quadruplex Nucleic Acids, RSC Publishing, London, 2006, pp. 81–99. [6] N. Maizels, Dynamic roles for G4 DNA in the biology of eukaryotic cells, Nat. Struct. Mol. Biol. 13 (2006) 1055–1059. [7] J.C. Delaney, J.M. Essigmann, Biological properties of single chemical-DNA adducts: a twenty year perspective, Chem. Res. Toxicol. 21 (2008) 232–252. [8] M.P. Stone, H. Huang, K.L. Brown, G. Shanmugam, Chemistry and structural biology of DNA damage and biological consequences, Chem. Biodivers. 8 (2011) 1571–1615. [9] L.A. Loeb, B. Preston, Mutagenesis by apurinic/apyrimidinic sites, Annu. Rev. Genet. 20 (1986) 201–230. [10] B. Weiss, L. Grossman, Phosphodiesterases involved in DNA repair, Adv. Enzymol. Relat. Areas Mol. Biol. 60 (1987) 1–34. [11] T. Lindahl, Instability and decay of the primary structure of DNA, Nature 362 (1993) 709–715. [12] T. Lindahl, B. Nyberg, Rate of depurination of native deoxyribonucleic acid, Biochemistry 11 (1972) 3610–3618. [13] A.T. Phan, Human telomeric G-quadruplex: structures of DNA and RNA sequences, FEBS J. 277 (2010) 1107–1117. [14] V. Esposito, L. Martino, G. Citarella, A. Virgilio, L. Mayol, C. Giancola, A. Galeone, Effects of abasic sites on structural, thermodynamic and kinetic properties of quadruplex structures, Nucleic Acids Res. 38 (2010) 2069–2080. [15] P. Skolakova, K. Bednarova, M. Vorlickova, J. Sagi, Quadruplexes of human telomere dG3(TTAG3)3 sequences containing guanine abasic sites, Biochem. Biophys. Res. Commun. 399 (2010) 203–208. [16] T. Fujimoto, S. Nakano, D. Miyoshi, N. Sugimoto, The effects of molecular crowding on the structure and stability of G-quadruplexes with an abasic site, J. Nucleic Acids (2011) 857149 (9 pp.). [17] Y. Wang, D.J. Patel, Solution structure of the human telomeric repeat d[AG3(T2AG3)3] G-tetraplex, Structure 1 (1993) 263–282. [18] A. Ambrus, D. Chen, J.X. Dai, T. Bialis, R.A. Jones, D.Z. Yang, Human telomeric sequence forms a hybrid-type intramolecular G-quadruplex structure with mixed

A. Virgilio et al. / Biochimica et Biophysica Acta 1820 (2012) 2037–2043

[19] [20]

[21]

[22]

[23] [24] [25]

[26]

[27]

parallel/antiparallel strands in potassium solution, Nucleic Acids Res. 34 (2006) 2723–2735. L. Petraccone, J.O. Trent, J.B. Chaires, The tail of the telomere, J. Am. Chem. Soc. 130 (2008) 16530–16532. L. Petraccone, C. Spink, J.O. Trent, N.C. Garbett, C.S. Mekmaysy, C. Giancola, J.B. Chaires, Structure and stability of higher-order human telomeric quadruplexes, J. Am. Chem. Soc. 133 (2011) 20951–20961. A.T. Phan, K.N. Luu, D.J. Patel, Different loop arrangements of intramolecular human telomeric (3+1) G-quadruplexes in K+ solution, Nucleic Acids Res. 34 (2006) 5715–5719. J.L. Mergny, J. Li, L. Lacroix, S. Amrane, J.B. Chaires, Thermal difference spectra: a specific signature for nucleic acid structures, Nucleic Acids Res. 33 (2005) (e138/1-e138/6). L.A. Marky, K.J. Breslauer, Calculating thermodynamic data for transitions of any molecularity from equilibrium melting curves, Biopolymers 26 (1987) 1601–1620. J. Dai, M. Carver, D. Yang, Polymorphism of human telomeric quadruplex structures, Biochimie 90 (2008) 1172–1183. C.S. Mekmaysy, L. Petraccone, N.C. Garbett, P.A. Ragazzon, R. Gray, J.O. Trent, J.B. Chaires, Effect of O6-methylguanine on the stability of G-quadruplex DNA, J. Am. Chem. Soc. 130 (2008) 6710–6711. S. Masiero, R. Trotta, S. Pieraccini, S. De Tito, R. Perone, A. Randazzo, G.P. Spada, A non-empirical chromophoric interpretation of CD spectra of DNA G-quadruplex structures, Org. Biomol. Chem. 8 (2010) 2683–2692. A.I. Karsisiotis, N.M. Hessari, E. Novellino, G.P. Spada, A. Randazzo, M. Webba da Silva, Topological characterization of nucleic acid G-quadruplexes by UV absorption and circular dichroism, Angew. Chem. Int. Ed. 50 (2011) 10645–10648.

2043

[28] K.W. Lim, S. Amrane, S. Bouaziz, W. Xu, Y. Mu, D.J. Patel, K.N. Luu, A.T. Phan, Structure of the human telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers, J. Am. Chem. Soc. 131 (2009) 4301–4309. [29] S. Amrane, R.W. Ang, Z.M. Tan, C. Li, J.K. Lim, J.M. Lim, K.W. Lim, A.T. Phan, A novel chair-type G-quadruplex formed by a Bombyx mori telomeric sequence, Nucleic Acids Res. 37 (2009) 931–938. [30] L. Hu, K.W. Lim, S. Bouaziz, A.T. Phan, Giardia telomeric sequence d(TAGGG)4 forms two intramolecular G-quadruplexes in K+ solution: effect of loop length and sequence on the folding topology, J. Am. Chem. Soc. 131 (2009) 16824–16831. [31] M. Bončina, J. Lah, I. Prislan, G. Vesnaver, Energetic basis of human telomeric DNA folding into G-quadruplex structures, J. Am. Chem. Soc. 134 (2012) 9657–9663. [32] L. Petraccone, E. Erra, V. Esposito, A. Randazzo, L. Mayol, L. Nasti, G. Barone, C. Giancola, Stability and structure of telomeric DNA sequences forming quadruplexes containing four G-tetrads with different topological arrangements, Biochemistry 43 (2004) 4877–4884. [33] A.J. Zaug, E.R. Podell, T.R. Cech, Human POT1 disrupts telomeric G-quadruplexes allowing telomerase extension in vitro, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 10864–10869. [34] H. Wang, G.J. Nora, H. Ghodke, P.L. Opresko, Single molecule studies of physiologically relevant telomeric tails reveal POT1 mechanism for promoting G-quadruplex unfolding, J. Biol. Chem. 286 (2011) 7479–7489. [35] M. Folini, L. Venturini, G. Cimino-Reale, N. Zaffaroni, Telomeres as targets for anticancer therapies, Expert Opin. Ther. Targets 15 (2011) 579–593. [36] S. Neidle, Human telomeric G-quadruplex: the current status of telomeric G-quadruplexes as therapeutic targets in human cancer, FEBS J. 277 (2010) 1118–1125.