The accumulation and composition of essential oil in kumquat peel

Scientia Horticulturae 252 (2019) 121–129

Contents lists available at ScienceDirect

Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti

The accumulation and composition of essential oil in kumquat peel a,b

c

a,b

a,b

Xiaofeng Liu , Binghao Liu , Dong Jiang , Shiping Zhu , Wanxia Shen ⁎ Yang Xuea,b, Mengyu Liua,b, Jingyin Fenga,b, Xiaochun Zhaoa,b, a b c

a,b

, Xin Yu

T

a,b

,

Citrus Research Institute, Southwest University/Chinese Academy of Agricultural Sciences, Chongqing, 400712, PR China National Citrus Engineering Research Center, Chongqing, 400712, PR China Guangxi Key Laboratory of Citrus Biology, Guangxi Academy of Specialty Crops, Guilin, 541004, PR China

A R T I C LE I N FO

A B S T R A C T

Keywords: Kumquat Secretory cavity Volatile compound Gene expression Fruit development

Essential oils are important secondary metabolites, which are mostly synthesized and accumulated in secretory cavities. In this study, the accumulation of essential oil, variation in composition and the pattern of expression of genes related to monoterpene biosynthesis during fruit development were investigated in kumquat peel. The number of cavities per fruit was approximately 2500. The average volumes of cavities were 16.05, 23.13, 32.69, 68.80 and 94.71 nL at 30, 60, 90, 120 and 150 days after flowering (DAF), respectively. During the fruit development, the average volume of the cavities in the peel increased consistently, and the accumulation of essential oil fit a sigmoid curve pattern. Limonene was the most abundant component (67.47–72.98%), followed by myrcene (3.91–4.83%), germacrene-D (1.86–3.00%), linalool (0.48–2.64%) and γ-elemene (1.79–2.12%). The content of compounds associated with disease resistance and pungent odor were reduced (or even disappeared) during fruit ripening. A correlation analysis showed that the expression of DXS2, HDR and IDI were closely related to the accumulation of essential oil in kumquat peel.

1. Introduction Secretory cavities are multicellular structures responsible for the synthesis and accumulation of essential oil and are formed through a schizolysigenous process in cluster gland cells (Chen and Wu, 2010; Thomson et al., 1976; Voo et al., 2012). Secretory cavity initiation occurs at the stage of tissue differentiation (Abbott, 1935), and is usually limited to the early stages of tissue development. However, the process of cavity filling generally continues throughout fruit growth (Knight et al., 2001; Voo et al., 2012). The accumulation of essential oil can be estimated from cavity numbers and volume distribution in the fruit peel (Voo et al., 2012). Essential oil occupy approximately 0.18–6.84% of the fresh weight of fruit peel in different citrus species as measured with the solvent extraction method (Zhang et al., 2017a). They have crucial biochemical and physiological functions in plant interactions with other plants, animals and microbes. For example, the (E)-β-ocimene released from herbivore-infested plants act as a possible plant-to-plant signal to lead plant defense responses of neighboring unattacked plants, (3S)-(E)nerolidol, (E)-β-farnesene, (E)-α-bergamotene and other herbivore-induced sesquiterpenes function as volatile defense signals to attract parasitoids and herbivore enemies, and linalool and linalool oxide are

⁎

involved in antimicrobial defense in flowers (Dudareva et al., 2007). They are also widely used in food, pharmaceutical and chemical industries (Shahidi and Zhong, 2005). To date, hundreds of volatile components of citrus essential oils have been analyzed using Gas Chromatography–Mass Spectrometry (GC-MS) (Ruberto, 2002; Tranchida et al., 2012). It was revealed that monoterpene and sesquiterpene hydrocarbons, their oxygenated derivatives, as well as aliphatic aldehydes, alcohols and esters accounted for approximately 85–99% of the oil (Tranchida et al., 2012; Zhang et al., 2017a). The variety and contents of the volatile components are different and affected by genotype (Hosni et al., 2010), tissue specificity (Lota et al., 2001), development stage (Voo et al., 2012) and seasonal variation (Bourgou et al., 2012; Ellouze et al., 2012). Limonene is a dominant component (approximately 57.7–95.6% of total oil) in most citrus species (Zhang et al., 2017a). However, some components present in small concentrations have been found to play important roles in odor and flavor formation and biochemical activity (Minh Tu et al., 2002; Simas et al., 2017; Zipora et al., 2011). Kumquat (Fortunella spp.) is an important genus closely related to Citrus and Poncirus of the Rutaceae family. Kumquat fruit is favored for its good shape, delicious flavor, nutrition and ability to be eaten without peeling. It is also commonly used as a traditional medicine in

Corresponding author at: Citrus Research Institute/Southwest University, Chinese Academy of Agricultural Sciences, Chongqing, 400712, PR China. E-mail address: [email protected] (X. Zhao).

https://doi.org/10.1016/j.scienta.2019.03.042 Received 21 January 2019; Received in revised form 20 March 2019; Accepted 22 March 2019 0304-4238/ © 2019 Published by Elsevier B.V.

Scientia Horticulturae 252 (2019) 121–129

X. Liu, et al.

China. Recent studies have revealed that kumquat fruit, especially the peel, is rich in flavonoids and essential oils, which have been proven to have effective health-promoting and pharmacological activities (Jayaprakasha et al., 2012; Lou and Ho, 2017; Lou et al., 2016; Wang et al., 2012). Unlike the fruits of other citrus species, kumquat fruit is usually eaten with the peel. The content and composition of essential oil in the peel are important factors affecting the taste, texture and flavor of the fruit. Previous research has reported that essential oils of kumquat are mainly composed of volatile monoterpenoids and sesquiterpenoids (Guney et al., 2015; Koyasako and Bernhard, 1983; Peng et al., 2013; Wang et al., 2012). However, how the variation in essential oil components of the peel can transform the taste from pungent and irritating to sweet and palatable, as well as how the development of cavities is related to the accumulation of essential oil during the fruit development of the kumquat have not been documented. Through an investigation of the dynamic change in the accumulation and composition of essential oil, we provide an overall understanding of the biological process of essential oil production in the peel of kumquat.

V=

In each stage, the volume of three hundred cavities were averaged to represent the overall volume of the cavities. The size of cavities were divided into 11 classes by their volume. The percentage of cavities in each class per fruit were calculated to evaluate the volume distribution patterns of cavities during the fruit development (Voo et al., 2012). 2.3. Automated HS-SPME-GC-MS analysis In every stage, thirty fruits were collected for investigation of volatile essential oil components. The flavedo part of the peel was immediately scraped from each fruit and flash-frozen with liquid nitrogen before being stored at −80 °C for headspace solid phase microextraction gas chromatography mass spectrometry (HS-SPME-GC-MS) and gene expression analysis. For the HS-SPME analysis, the sample was placed in a 5 mL centrifuge tube and frozen in liquid nitrogen for 10 min, then ground to fine powder with a tissue pulverizer (Scientz-48, Ningbo, China). Three biological replicates were performed for each stage, with the peel from ten fruits constituting a biological replicate. Three grams of sample powder was put into a 20 mL amber vial and mixed with 3 mL of saturated sodium chloride solution and 2 μL (99.5%) cyclohexanone (internal standard). The vial was hermetically sealed with a screw cap equipped with a Teflon septum and placed on a CombiPal autosampler (CTC Analytics, Zwingen, Switzerland). After equilibration for 15 min with a magnetic stirrer (600 rpm) at 40 °C, the volatiles in the headspace were extracted for 40 min under the same conditions using a 50/30 μm DVB/CAR/PDMS fiber (Supelco, Bellefonte, PA). The volatiles were then desorbed in the injector at 250 °C for 5 min. Analysis of volatile compounds was performed using a 7890 A gas chromatograph with a 5975C mass spectrometer, equipped with a DB-5MS capillary column (30 m × 250 μm i.d., 0.25 μm film thickness) (Agilent Technologies, CA, USA). The following instrumental conditions were employed: helium flow at 50 mL min−1; injector temperature at 250 °C; transfer line temperature at 260 °C; energy of electrons at 70 eV; mass acquisition range at 35–400 m/z; oven temperature program initial at 35 °C for 5 min, ramped to 180 °C at 3 °C min−1, held at 180 °C for 2 min, then subsequently ramped to 240 °C at 5 °C min−1 and held at final temperature for 2 min (Alvarenga et al., 2015; Azam et al., 2013; Cuevas et al., 2017; Qiu and Wang, 2015). The individual components were identified by comparing their MS data to those from the NIST 2008 and Flavour 2.0 mass spectral library and with previous publications (Choi, 2005; Guney et al., 2015; Quijano and Pino, 2009; Sicari and Poiana, 2017; Summo et al., 2016). The odor of each volatile constituent was retrieved from Flavornet (http://www. flavornet.org).

2. Materials and methods 2.1. Materials Fruits of kumquat (Fortunella crassifolia Swing.) were harvested from trees of the same age (12 years old) of nearly uniform size and growth vigor from the National Citrus Germplasm Repository, Chongqing, China during 2016. Fruits were sampled from the outer layer of the canopy at five development stages (S1 to S5) according to the number of days after flowering (DAF), (30, 60, 90, 120 and 150 DAF, respectively). Sixty fruits of similar in size, appearance and without any damage were collected from each stage for the following analyses, and were collected at the same orientation from the sunny side of the trees. 2.2. Morphometric measurements The morphometric measurements were performed according to published methods (Voo et al., 2012). The fruits were selected and labeled to measure the polar diameter (PD) and equatorial diameter (ED). The fruit surface area (S) was calculated based on the following formula:

S = 2πb2 + 2π

ab −1 PD ED sin e ; a = , b= ; e= e 2 2

a2 − b2 a

A piece of pericarp from the middle of each fruit was hand sectioned horizontally to determine the number of cavities in the peel (Fig. 1E). The images were taken with a Leica DFC420 C digital camera mounted on a Leica M165 FC stereomicroscope. The area of pericarp (s) was calculated and the number of cavities (n) counted with Image J 1.50i software. The density of secretory cavities (D) and the total number of cavities per fruit (N) were calculated as follows:

D=

1 πED 2PD 6

2.4. Gene expression analysis Total RNA was extracted from the flavedo of kumquat using an RNAprep Pure Plant Kit with on-column DNase treatment applied according to the manufacturer’s instructions (Code: DP432, TIANGEN, China). RNA quality and concentration were measured by 1% (w/v) agarose gel electrophoresis and NanoDrop 2000 spectrophotometry (Thermo Scientific, USA). DNA-free RNA (1.0 μg) was used to initiate first-strand cDNA synthesis using the Reverse Transcription System A3500 (Promega, USA) according to the manufacturer’s instructions. The reaction mixture was diluted 10-fold to use as the template for realtime PCR analysis. The PCR reactions contained 7.5 μL 2×iTaq Universal SYBR GREEN Supermix (Bio-Rad, USA), 0.3 μL of each primer (10 mM), 1 μL of diluted cDNA and 5.9 μL of PCR-grade water to a total volume of 15 μL. PCR was performed on a CFX96 Real-Time PCR system (Bio-Rad, USA) with the following thermal cycling conditions: initiation at 95 °C for 3 min, 40 cycles of 95 °C for 10 s and 60 °C for 20 s. The relative expression levels of genes were normalized with the expression

n ; N = SD . s

In order to measure the volume of each secretory cavity, the peel of fruits at different stages were cut into blocks (except for the use of whole fruit for S1) and fixed in FAA fixing solution. The blocks were then dehydrated using a graded ethanol series and embedded in paraffin. Trimmed paraffin blocks were cut into 10-μm-thick sections and placed on a glass slide before being stained with safranin-O/fast green and examined with an Olympus IX73 inverted microscope equipped with a DP80 digital camera. The PD and ED of each cavity were measured using the Olympus CellSens software (Zheng et al., 2014). The volume of the cavity (V) was estimated as follows: 122

Scientia Horticulturae 252 (2019) 121–129

X. Liu, et al.

Fig. 1. The morphological measurement of secretory cavities during kumquat fruit development. A, The dimensions and fruit growth during development. PD, polar diameter of fruit; ED, equatorial diameter. B, The number of cavities. C, The curve of cavity density. D, Essential oil yield and peel area of per fruit. E, Example image use to count the number of cavities in the fruit peel. F, Example of an image used to measure the volume of a secretory cavity. G, Volume distribution of cavities in the peel.

123

Scientia Horticulturae 252 (2019) 121–129

X. Liu, et al.

Table 1 List of diagnostic primers for qRT-PCR. Gene name

Abbreviation

Gene ID

Forward primer (5’–3’)

Reverse primer (5’–3’)

1-deoxy-D-xylulose-5-phosphate synthase

DXS1 DXS2 DXR CMS CMK MCS HDS HDR1 HDR2 IDI GPS1 GPS2

Cs9g05150 Cs1g20530 Cs5g05440 Cs3g01420 Cs2g28970 Cs5g03050 Cs8g16700 Cs5g28200 Cs8g07020 Cs6g02690 Cs2g08220 Cs2g08230 Cs3g04360 Cs3g07850 Cs2g07240 Cs8g14120 Cs1g05000

GGCTATGGTACAGCCGTTCAG TGGCATTCTGGATGGACCTC GCACAAGGCGGACTTGGTAA CTTGGTGTTCCTGCCAAAGC TAATTGCAGCTGGTCGTGGA GAAGGGTGCACCATCCTCTG TTCAGCGTCGTTCTGGTCAA AAGACCGTGGAATTCCCTCA GTGGGGAAATGCTACGGTGA TGCTGCAGCCATCCTCTGTA CCATGGAAGAGTTCCCTCAA GACATCCGGCATGGAATCAT ATGGAGATGGGCATGGTGTT GGGGAGATGTTCCCAAATCAA CATGGAAGCGCCTAAACCAG AGCAAAAGAGGAGGCCTTGC CCAAGCAGCATGAAGATCAA

GAATGAGGGCATGATCCAGT GCCTTGAGGAGAGCCCTGAT CATGCTGGAACAGGGCTTCT TCACCTGAGGGGTCTGCATT CTGGGGAACCGATACCAACA GAAGAATCAGCGTGGCATCC TTCCGGTGCCTTCAACTGAT TCGGCAGCCAATTTTCTTTC TGATGGGTGGACTGTGAAGG AGCACAAATGCCCAGCTCAT TGCTGTCCTTGCGTTTGTAG GGAATCCTCGAAGCCTTGCT TGCCAGGAGATGCTGTGAAA CCGAATCGAGCACTGTTCATC TCGAGTCTCGGAAGCCTTTG TGATGTTGCCAGGTCATTGG ATCTGCTGGAAGGTGCTGAG

1-deoxy-D-xylulose-5-phosphate reductoisomerase 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase 4-hydroxy-3-methylbut-2-en-1-yl diphosphate reductase isopentyl diphosphate isomerase geranyl diphosphate synthase limonene synthase γ-terpinene synthase linalool synthase α-terpineol synthase actin

　

change was not consistent among the fruit growth phases. A significantly elevated increase was observed at fruit ripening (S4 to S5) compared to fruit growth (S1 to S3). The trends of change were in accordance with a typical sigmoid curve (R2 = 0.9975, Fig. 1D).

of citrus actin gene (Cs1g05000). All candidate genes in this study were selected from the Orange Genome Annotation Project (http://citrus. hzau.edu.cn/orange/index.php), and primers used are listed in Table 1. 3. Results

3.2. Chemical analysis of essential oil in kumquat peel with using HS-SPMEGC-MS

3.1. Investigation of the numbers and volume of secretory cavities in kumquat peel

The profiling of volatiles in the peel at the five growth stages were investigated using HS-SPME-GC-MS. The total amount of volatiles was measured by the total peak area of ion current, which was normalized by the peak area of the internal standard, and the percentage of each compound was calculated by the peak area ratio. The peak area of volatiles were 1.97E + 10, 2.11E + 10, 2.39E + 10, 3.86E + 10 and 5.76E + 10 per gram of fresh flavedo in the five stages, indicating that the contents of the volatile increased rapidly following the ripening of fruit. The identified components accounted for 93.47–96.57% of the total volatiles. A total of 89 volatile constituents were detected and grouped into six classes with 49 terpenes (86.73–93.24%), 16 alcohols (0.95–3.99%), 9 aldehydes (0.29–1.76%), 5 esters (1.09–1.48%), 5 ketones (0.11–0.47%), and 5 others (0.02–0.16%) (Table 2). Among them, the monoterpenoids represented 76.86–80.49% of the total components, the sesquiterpenoids 12.61–15.25%, and other components represented 1.19–2.81%. Of this, 51, 56, 56, 61 and 63 volatile constituents were detected from S1 to S5, respectively, including 33 common components. Another 56 components were observed only in one or several stages. The following components were only present in one of the five stages: camphor in S1; β-ocimene, isolimonene and alloaromadendrene in S2; neoalloocimene and cis-3-tetradecene in S3; cis-3-hexenol, 1,3,8-menthatriene, carvomenthenal, β-guaiene and αselinene in S4; and, 3,4-dimethyl-2,4,6-octatriene, dihydrocarvone, ciscarveol, D-citronellol, dodecanal, epizonarene, agarospirol, β-eudesmol and bulnesol in S5. The 6 components, such as β-citral and decyl acetate, were only found in the peel of growth phase fruit, while another 10 components, such as piperitone and tetradecane, were only present in the peel of ripening phase fruit. The number of volatile constituents was much higher in the ripening period, especially for sesquiterpene hydrocarbons and oxygenated sesquiterpenes. Different variations in volatile constituents were observed among the stages of fruit development. However, accumulation of several major components was found at a high level throughout the all stages. The most abundant component was limonene (67.47–72.98%) in all five stages, followed by myrcene (3.91–4.83%) and germacrene-D (1.86–3.00%). This finding is in agreement with previously published results (Peng et al., 2013; Sicari and Poiana, 2017). Linalool

The development of citrus fruit can be divided into three phases known as slow fruit growth, rapid fruit growth and ripening (Bain, 1958). Phase I is prior to S1, phase II corresponds to S1 to S3, and phase III is S4 to S5. In phase II, fruit grows quickly, with ED and PD rapidly enlarging; however, the color of the peel remains green (Fig. 1A). From S4 to S5 in phase III, the color of peel changes from green to orange, the growth of fruit gradually slows and the fruit reaches full size and maturity in S5 (Fig. 1A). The trend of fruit growth (ED, PD and fruit surface area vs. DAF) follows a semi-logarithmic curve (R2 = 0.9986, 0.9851 and 0.9889, respectively) (Fig. 1A and 1D). During the development of the fruit, ED is always lower than PD, therefore, the shape of the fruit is always in prolate spheroid shape. The cavity numbers per fruit had a large increase from 2358 (S1) to 2628 (S3) and then a small decrease to 2560 (S5) (Fig. 1B), but were not statistically significant between the stages (F = 1.722, p = 0.148). The density of secretory cavities demonstrated an exponential decline in the trend of semilogarithmic function (R2 = 0.9880) during the fruit development (Fig. 1C). To evaluate the cavity volumes during fruit development, the volumes of three hundred cavities were measured at every stage (Fig. 1F). In order to avoid repetitively measuring the same cavity, one section from every 100 sections of the paraffin ribbon was taken for measurement of volume for all 300 cavities. Most cavities had a prolate spheroid shape in S1 and S2, and changed to spheroid shape in S4 and S5. The average ratios of PD/ED of cavities were 1.63, 1.42, 1.31, 1.21 and 1.15 at the 5 different stages, respectively. The average volume of the cavities were 16.05, 23.13, 32.69, 68.80 and 94.71 nL from S1 to S5, respectively. The size of the cavities was assigned to one of 11 categories to represent the changes in the volume of cavity during fruit development (Fig. 1G). The cavity volumes ranged from 0.33–61.05 nL in S1, 0.73–77.80 nL in S2, 2.16–104.70 nL in S3, 10.51–135.64 nL in S4 and 11.35–280.29 nL in S5. The peak distribution of the number of cavities in each category showed an increment of 1 size per stage following fruit development. The cavity numbers per fruit and the average volumes of cavities were used to extrapolate the essential oil yield per fruit in each stage. The oil yield gradually increased during the fruit development, but the 124

Scientia Horticulturae 252 (2019) 121–129

X. Liu, et al.

Table 2 (continued)

Table 2 Volatile compounds of kumquat peel essential oils during different stages of development. Compound

Terpenes α-Pinene Sabinene Myrcene α-Terpinene Limonene β-Ocimene 3-Carene γ-Terpinene Terpinolene Cosmene 3,4-Dimethyl-2,4,6-octatriene Alloocimene Neoalloocimene 1,3,8-Menthatriene Isolimonene α-Cubebene Ylangene α-Copaene cis-3-Tetradecene β-Elemene 2-Isopropyl-5-methyl-9-methylene[4.4.0] dec-1-ene Germacrene B γ-Elemene β-Cubebene α-Guaiene β-Patchoulene Isoledene Humulene Bicyclosesquiphellandrene γ-Muurolene α-Amorphene Germacrene D α-Selinene Valencene β-Maaliene α-Muurolene δ-Cadinene α-Farnesene Cada-1,4-diene α-Gurjunene β-Cadinene Selina-3,7(11)-diene Elixene β-Panasinsene α-Elemene Alloaromadendrene β-Gurjunene β-Guaiene Epizonarene Alcohols cis-3-Hexenol Cyclohexanol 1-Octanol Linalool 4-Terpineol α-Terpineol cis-Carveol D-Citronellol Geraniol Perillol Elemol Nerolidol Guaiol Agarospirol β-Eudesmol Bulnesol Aldehydes trans-2-Hexenal Decanal

Compound

% S1

S2

S3

S4

S5

0.52 0.15 3.91 0.06 67.47 – 0.23 0.12 0.25 – – 0.04 – – – 0.70 0.17 0.28 – 0.97 1.05

0.44 0.17 3.99 0.11 69.02 0.25 – 0.14 0.29 0.04 – 0.04 – – 0.01 0.96 0.16 0.48 – 0.77 0.76

0.95 0.22 4.05 – 70.39 – – 0.16 0.30 0.04 – 0.03 0.04 – – 0.60 0.16 0.46 0.24 0.80 0.67

0.45 0.17 4.18 – 71.63 – 0.16 0.10 0.25 – – – – 0.02 – 0.90 0.15 0.31 – 0.87 0.73

0.88 0.24 4.83 – 72.98 – 0.12 0.09 0.21 – 0.02 0.01 – – – 0.78 0.15 0.29 – 1.08 0.77

0.06 2.12 0.32 – – 0.22 – 0.77

0.07 1.80 0.11 – – – 0.37 0.55

0.06 1.89

1.29 2.52 – 0.61 0.11 0.58 1.29 0.16 0.14 0.41 – 0.10 – – – – 0.10 – –

0.97 1.86 – 0.81 0.13 0.54 1.04 0.14 0.13 – 0.35 0.10 – – 0.19 0.12 0.09 – –

0.11 1.69 0.62 0.60 0.53 2.01 – 0.27 0.10 0.47 0.96 0.15 0.12 0.45 0.32 0.10 – – 0.04 – 0.07 – –

– 1.95 0.59 0.07 0.42 – 0.55 – 0.13 1.53 2.35 0.11 1.18 – 0.29 1.43 0.27 0.13 0.12 0.48 0.09 0.09 0.07 0.17 – 0.06 0.02 –

– 1.92 0.49 0.06 0.46 0.15 – 0.39 0.18 0.84 3.00 – 0.16 – 0.27 1.04 0.26 0.14 0.48 0.42 0.09 0.10 0.16 – – 0.05 – 0.14

– 0.13 0.16 2.44 0.49 – – 0.05 0.06 0.06 – 0.02 – – –

– 0.21 0.23 2.64 0.10 0.62 – – 0.05 0.05 0.06 – 0.01 – – –

0.00 0.09 0.15 2.19 0.06 0.38 – – 0.05 0.03 0.05 – 0.01 – – –

0.04 – 0.12 1.23 – 0.27 – – 0.03 0.03 0.06 0.10 0.02 – – 0.01

– – 0.04 0.48 – 0.10 0.01 0.01 0.01 0.02 0.08 0.14 0.02 0.02 0.02 0.01

1.03 0.11

1.21 0.12

0.65 0.15

0.27 0.16

– 0.13

0.07

Carvomenthenal β-Citral Citral Perillylaldehyde 1-Perillaldehyde Undecanal Dodecanal Esters Octyl acetate Nonyl acetate Nerol acetate Geranyl acetate Decyl acetate Ketones Camphor trans-Dihydrocarvone Dihydrocarvone Piperitone Carvone Others Methoxy-phenyl oxime 4-Acetyl-1-methylcyclohexene Tridecane Myrcen acetylated Tetradecane Total

% S1

S2

S3

S4

S5

– 0.03 0.07 0.41 – – –

– 0.03 0.04 0.36 – – –

– 0.02 0.03 – 0.39 – –

0.01 – – 0.32 – 0.01 –

– – – 0.10 0.01 0.05

0.09 – 0.09 1.06 0.05

0.14 – 0.10 0.85 0.07

0.14 – 0.10 0.78 0.07

0.15 0.01 0.12 1.20 –

0.15 0.01 0.13 0.91 –

0.01 0.03 – – 0.31

– 0.02 – – 0.44

– – – 0.30

– 0.01 – 0.01 0.22

– 0.01 0.01 0.01 0.09

– 0.02 – – – 93.47

0.12 0.02 – – – 94.55

0.10 – 0.03 – – 95.49

0.07 – 0.04 0.02 0.04 96.57

– – 0.02 0.00 0.02 95.83

(0.48–2.64%), γ-elemene (1.79–2.12%), δ-cadinene (0.96–1.29%), αamorphene (0.53–1.29%), geranyl acetate (0.85–1.20%), β-elemene (0.77–1.08%), 2-isopropyl-5-methyl-9-methylene[4.4.0]dec-1-ene (0.67–1.05%) and α-cubebene (0.60–0.96%) were also among the more abundant components.

3.3. Relationship between gene expression and accumulation of monoterpene in kumquat peel It was well documented that the volatile components are synthesized by converting a common substrate geranyl diphosphate (GPP), which is synthesized mainly via the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway in the chloroplasts (Degenhardt et al., 2009; Rodríguez-Concepción and Boronat, 2002). The expression of 9 genes in MEP pathway (DXS1, DXS2, DXR, CMS, CMK, MCS, HDS, HDR1 and HDR2), 3 prenyltransferases (IDI, GPS1, GPS2), which are related to the biosynthesis of the terpenoid backbone, 2 putative citrus monoterpene synthase (limonene synthase and γ-terpinene synthase) and 2 putative citrus monoterpene alcohol synthase (linalool synthase and α-terpineol synthase) were quantified using the RT-qPCR method to investigate the relative abundance of transcripts in the peels during the development of the fruit. A cluster analysis was carried out to investigate the relationships among these terpene synthesis-related genes based on the abundance of transcript at different fruit development stages (Fig. 2). The results showed that 16 genes could be clustered into 3 groups. Group I consisted of DXS2, IDI, HDR, HDS, GPS1. The rest of the 6 MEP pathway genes, GPS2 and other three terpene synthase genes were placed into Group II. Only limonene synthase fell into Group III. On the other hand, fruit development could be divided into 2 major phases based on gene expression characteristics: the growth period including S1 to S3, and ripening period from S4 to S5. Strong correlations between the expressions of some of the above genes were observed (Table 3). In the MEP pathway, there was significant positive correlation between DXS2 and HDR, and also between DXS1 and MCS, whilst there was a negative correlation between DXR2 and HDS. The expression of IDI was positively correlated with DXS2, 125

Scientia Horticulturae 252 (2019) 121–129

X. Liu, et al.

Fig. 2. Heatmap of the co-expression patterns among the genes related to monoterpene biosynthesis during kumquat fruit development.

4. Discussion

MCS and HDR. Both GPS1 and GPS2 presented a negative correlation with DXR2 and MCS. Only the α-terpineol synthase gene showed a positive correlation with CMK. There was no correlation observed between terpene synthase genes with the MEP pathway or prenyltransferase genes. The correlation between the level of gene expression and the contents of terpenes were analyzed in order to study the effect of those genes on the biosynthesis of terpene during fruit development (Table 4). The results of the Spearman rank analysis indicated that the expression of three MEP pathway genes, DXS2, HDR and IDI, had strong positive correlations with the content of limonene, total terpenes, total esters and total essential oil components, and a negative correlation with linalool, total alcohols and total aldehydes. Despite this, MCS had a negative correlation with linalool and total alcohols, HDS had a positive correlation with γ-terpinene, GPS2 had a positive correlation with total alcohols, total aldehydes and total ketones and the linalool synthase gene had a positive correlation with α-terpineol and total alcohol.

4.1. The accumulation of essential oil during fruit development In this study, the number of cavities per fruit did not significantly increase during development, suggesting that secretory cavities in kumquat fruit peel were mostly formed within 30 DAF (10 mm ED). This result is in agreement with previous reports that showed the number of cavities reached peak levels at approximately 60 mm ED (60 DAF) in “Duncan” grapefruit (Citrus paradisi) (Voo et al., 2012), and at 20 mm ED in “Washington” navel orange (Citrus sinensis L. Osbeck) (Knight et al., 2001). At these periods of time, the fruit development was in the cell division stage (Bain, 1958), with some cells adjacent to the epidermis dividing into dense cell clusters progressively differentiating into secretory cavities (Knight et al., 2001). The progress and potential of cavity expansion was not uniform. Some cavities expanded very fast, some were very slow, and some may cease expansion at an early stage. The large variation in the cavity

Table 3 The degree of pair-wise correlation between genes involved in terpene synthesis during kumquat fruit development. * = P < 0.05, ** = P < 0.01. DXS1

DXS2

DXR1

DXR2

CMS

CMK

MCS

HDS

HDR

IDI

GPS1

GPS2

DXS2 DXR1 DXR2 CMS CMK MCS HDS HDR IDI GPS1 GPS2 Limonene synthase γ-terpinene synthase Linalool synthase a-terpineol synthase

−0.121 −0.560 −0.123 0.837 0.598 −0.431 0.332 −0.188 −0.172 −0.093 0.074 0.294

0.499 −0.704 −0.098 0.345 0.819 0.557 0.963** 0.955* 0.712 −0.798 0.304

0.061 −0.313 −0.462 0.902* 0.007 0.334 0.599 0.223 −0.808 −0.389

−0.271 −0.841 −0.343 −0.893* −0.782 −0.738 −0.935* 0.345 −0.141

0.668 −0.221 0.620 −0.205 0.019 0.220 −0.109 −0.228

−0.099 0.870 0.405 0.370 0.678 −0.066 0.177

0.328 0.694 0.881* 0.545 −0.927* −0.158

0.540 0.683 0.898* −0.449 −0.163

0.892* 0.744 −0.613 0.399

0.830 −0.859 0.014

−0.503 −0.168

0.119

0.105

−0.635

0.209

0.730

0.298

−0.492

−0.170

−0.353

−0.812

−0.483

−0.541

0.042

−0.653

0.341

−0.833

−0.712

0.203

0.445

0.204

−0.846

−0.031

−0.750

−0.729

−0.255

0.775

−0.352

0.384

−0.480

−0.258

0.473

0.843

−0.627

−0.978**

0.138

−0.872

−0.344

−0.324

−0.718

−0.023

−0.035

0.463

126

Limonene synthase

γ-terpinene synthase

Correlation

Linalool synthase

−0.315

Scientia Horticulturae 252 (2019) 121–129

X. Liu, et al.

Table 4 The degree of pair-wise correlations between terpene traits and transcript abundance during kumquat fruit development. * = P < 0.05, ** = P < 0.01. Correlation

DXS1

DXS2

DXR1

DXR2

CMS

CMK

MCS

HDS

HDR

IDI

GPS1

GPS2

Limonene synthase

γ-terpinene synthase

Linalool synthase

aterpineol synthase

Limonene γ-terpinene Linalool a-terpineol Total terpoids Total alcohols Total aldehydes Total esters Total ketones Total others Total volatiles

−0.09 0.50 0.28 0.37 −0.10 0.17 0.00 −0.20 −0.08 0.42 −0.10

0.98** 0.72 −0.97** −0.61 0.98** −0.95* −0.96* 0.99** −0.64 0.29 0.98**

0.52 0.10 −0.63 −0.81 0.53 −0.72 −0.60 0.51 −0.77 −0.60 0.52

−0.76 −0.79 0.69 −0.13 −0.76 0.52 0.61 −0.65 0.18 −0.41 −0.76

0.03 0.61 0.13 0.46 0.02 0.08 −0.09 −0.21 −0.25 −0.01 0.02

0.42 0.79 −0.27 0.49 0.41 −0.15 −0.31 0.26 −0.01 0.51 0.41

0.84 0.45 −0.90* −0.79 0.84 −0.94* −0.87 0.82 −0.82 −0.28 0.84

0.68 0.89* −0.57 0.22 0.67 −0.47 −0.59 0.46 −0.37 0.12 0.67

0.93* 0.64 −0.93* −0.47 0.93* −0.84 −0.84 0.97** −0.41 0.43 0.93*

0.99** 0.76 −0.99** −0.52 0.99** −0.95* −0.95* 0.93* −0.71 0.05 0.99**

0.81 0.74 −0.78 0.02 0.80 −0.61 −0.66 0.66 −0.34 0.07 0.80

−0.83 −0.65 0.84 0.74 −0.84 0.94* 0.93* −0.77 0.97** 0.23 −0.83

0.14 0.13 −0.09 −0.20 0.15 −0.12 −0.16 0.35 0.18 0.92* 0.15

−0.56 −0.37 0.54 0.05 −0.56 0.38 0.40 −0.66 −0.18 −0.77 −0.56

−0.75 −0.32 0.81 0.93* −0.76 0.89* 0.81 −0.87 0.66 −0.12 −0.76

−0.35 −0.70 0.22 −0.60 −0.34 0.06 0.21 −0.18 −0.09 −0.40 −0.35

2008; Zhang et al., 2017b), apparently decline during the maturation of the fruit, and are almost undetectable in the ripening stage. The contents of other antimicrobial compounds such as alcohols (Sikkema et al., 1995) also decreased from 3.99% at the fruit growth stage to 0.95% at the fruit ripening stage. These results imply that the disease resistance of fruit declines during the ripening stage. The volatile constituents, including mono- and sesquiterpenes, are the most important substrates forming the fruit flavor profiles. Some terpene compounds, even at very low levels, can significantly affect the aroma characteristics and taste of the fruit. They also play an important role in plant-animal interactions such as attraction/repellence of herbivores and seed disseminators (Dudareva et al., 2007; Goff and Klee, 2006; Schwab et al., 2008). In this study, the volatile constituents presenting a pungent odor, such as camphene (with camphor odor), αphellandrene (turpentine and spice odor), caryophyllene (wood and spice odor) and α-bisabolol (spice odor) in the fruit peel of other citrus species (Liu et al., 2012; Simas et al., 2017; Zhang et al., 2017a) were not detected in the peel of ripened kumquat fruit. Some pungent odor compounds of camphor (camphor odor) and 4-acetyl-1-methylcyclohexene (spice odor) only existed in the peels of the fruit before the middle growth stage. This might be the reason that the ripe fruit of kumquat is preferred to be eaten with the peel.

volume during fruit development identified from measurement of 300 cavities showed significant difference in each stage, with 186-, 107-, 48-, 12- and 24-fold differences between the largest and smallest cavities in the S1 to S5 stages, respectively. The change in the level of difference between stages showed a characteristic descending pattern during fruit growth (S1 to S3) and then ascending during fruit ripening (S4 to S5). This was in partial agreement with the results obtained from grapefruit (Voo et al., 2012); however, the level of difference observed in kumquat was much lower than that seen in grapefruit. This discrepancy suggests that the development of cavities in kumquat is more consistent than in grapefruit. The cavities expanded throughout fruit development with the average cavity volume gradually increasing. When comparing the average volume of cavities in S1 to the other 4 stages, the volume increased to be 1.44, 2.04, 4.29, and 5.9 times larger, respectively. This was also demonstrated by the increased yield of essential oil per fruit in the late stages of fruit development. The results indicate that the ripening of fruit is the time of mass production of essential oil in kumquat peel. These results were similar to those of grapefruit (Voo et al., 2012) and navel orange (Knight et al., 2001). The pattern of essential oil accumulation was not synchronous with the process of fruit development. As observed in this study, the rates of fruit growth and surface area gain were faster during fruit growth than in the ripening stage. Meanwhile, the rate of essential oil accumulation was obviously slower during growth than in the ripening stage. We speculated that the allocation of carbohydrates and the biological function of volatiles were the two important factors regulating essential oil synthesis in nature. At the growth stage, there are high competing demands for carbohydrates (Iglesias et al., 2007), therefore, generating the fruit peel should remain the main function for photosynthesis. At the ripening stage, fruit growth was gradually arrested, chlorophyll synthesis decreased and eventually stopped. Large amounts of essential oils were synthesized to provide information and communicate with other organisms such as to attract herbivores for dissemination of seeds (Baldwin, 2010).

4.3. Relationship between gene expression and essential oil accumulation in kumquat peel In this study, monoterpenoids (76.86–80.49%) and sesquiterpenoids (12.61–15.25%) are the major accumulated components of essential oils in the secretory cavities of kumquat fruit peel. In particular, monoterpenes, derived primarily from the MEP pathway, occupied approximately 72.75–79.38% of total kumquat peel essential oils. As for the downstream terpene products, the yield of essential oils are found to be strongly influenced by the genetic factors on the pathway of terpene biosynthesis (Webb et al., 2013; Xu et al., 2018). Overexpression of some genes in the terpene biosynthesis pathway, such as DXS, DXR, IDI and GPPS could lead to the higher terpene product accumulation in the transgenic lines compared to the wild type (Lange et al., 2011; Muñoz-Bertomeu et al., 2006; Yin et al., 2016; Zhang et al., 2018). In this study, our results indicated that three MEP pathway genes, DXS2, HDR and IDI had strong positive correlations with the content of limonene, total terpenes and total essential oil components, suggesting that these may be the key genes controlling the production of essential oils in kumquat peel. Limonene is a major component for most essential oils in citrus peel (Zhang et al., 2017a) and the limonene synthase gene is expressed at high levels throughout fruit development (Voo et al., 2012). In our study, the expression of the limonene synthase gene increased constantly until reaching the highest level at the fruit coloring stage, before declining at maturation. The proportion of limonene remained stable at

4.2. Variation in volatile constituents in fruit peel during fruit development Previous research has indicated that terpenes can interfere with the lipid layer of the microbial cell membrane, rendering them permeable and leading to leakage of cell contents (Burt, 2004; De Carvalho and Fonseca, 2007). Terpenes are the main components of essential oils in kumquat as in other citrus species. Citrus essential oils also possess potent antimicrobial activity (Fisher and Phillips, 2008; Wang et al., 2012). The variation of volatile constituents could induce a change in antimicrobial activity during fruit development (Bourgou et al., 2012). In this study, the contents of some antibacterial compounds, such as linalool, α-terpineol, geraniol, trans-2-hexenal, carvone, β-maaliene, citral and camphor (Barros et al., 2013; Burt, 2004; Fisher and Phillips, 127

Scientia Horticulturae 252 (2019) 121–129

X. Liu, et al.

about 70% of essential oil content during fruit development. However, the correlation analysis showed that the level of expression of the limonene synthase gene had no significant correlation with the content of limonene, total terpenes or total volatile essential oil components.

promoting cell separation with terpenes. FEMS Microbiol. Ecol. 61, 406–413. Degenhardt, J., Köllner, T.G., Gershenzon, J., 2009. Monoterpene and sesquiterpene synthases and the origin of terpene skeletal diversity in plants. Phytochemistry 70, 1621–1637. Dudareva, N., Negre, F., Nagegowda, D.A., Orlova, I., 2007. Plant volatiles: recent advances and future perspectives. Crit. Rev. Plant Sci. 25, 417–440. Ellouze, I., Abderrabba, M., Sabaou, N., Mathieu, F., Lebrihi, A., Bouajila, J., 2012. Season’s variation impact on Citrus aurantium leaves essential oil: chemical composition and biological activities. J. Food Sci. 77, T173–T180. Fisher, K., Phillips, C., 2008. Potential antimicrobial uses of essential oils in food: is citrus the answer? Trends Food Sci. Tech. 19, 156–164. Goff, S.A., Klee, H.J., 2006. Plant volatile compounds: sensory cues for health and nutritional value? Science 311, 815–819. Guney, M., Oz, A.T., Kafkas, E., 2015. Comparison of lipids, fatty acids and volatile compounds of various kumquat species using HS/GC/MS/FID techniques. J. Sci. Food Agric. 95, 1268–1273. Hosni, K., Zahed, N., Chrif, R., Abid, I., Medfei, W., Kallel, M., Brahim, N.B., Sebei, H., 2010. Composition of peel essential oils from four selected Tunisian Citrus species: evidence for the genotypic influence. Food Chem. 123, 1098–1104. Iglesias, D.J., Cercos, M., Colmeneroflores, J.M., Naranjo, M.A., Rios, G., Carrera, E., Ruizrivero, O., Lliso, I., Morillon, R., Tadeo, F.R., 2007. Physiology of citrus fruiting. Braz. J. Plant Physiol. 19, 333–362. Jayaprakasha, G.K., Murthy, K.N.C., Demarais, R., Patil, B.S., 2012. Inhibition of prostate Cancer (LNCaP) cell proliferation by volatile components from nagami kumquats. Planta Med. 78, 974–980. Knight, T.G., Klieber, A., Sedgley, M., 2001. The relationship between oil gland and fruit development in Washington Navel orange (Citrus sinensis L. Osbeck). Ann. BotLondon 88, 1039–1047. Koyasako, A., Bernhard, R.A., 1983. Volatile constituents of the essential oil of kumquat. J. Food Sci. 48, 1807–1812. Lange, B.M., Mahmoud, S.S., Wildung, M.R., Turner, G.W., Davis, E.M., Lange, I., Baker, R.C., Boydston, R.A., Croteau, R.B., 2011. Improving peppermint essential oil yield and composition by metabolic engineering. P. Natl. Acad. Sci. U.S.A. 108, 16944–16949. Liu, C., Cheng, Y., Zhang, H., Deng, X., Chen, F., Xu, J., 2012. Volatile constituents of wild citrus Mangshanyegan (Citrus nobilis Lauriro) peel oil. J. Agric. Food Chem. 60, 2617–2628. Lota, M.-L., de Rocca Serra, D., Tomi, F., Casanova, J., 2001. Chemical variability of peel and leaf essential oils of 15 species of mandarins. Biochem. Syst. Ecol. 29, 77–104. Lou, S.N., Ho, C.T., 2017. Phenolic compounds and biological activities of small-size citrus: kumquat and calamondin. J. Food Drug Anal. 25, 162–175. Lou, S.N., Lai, Y.C., Hsu, Y.S., Ho, C.T., 2016. Phenolic content, antioxidant activity and effective compounds of kumquat extracted by different solvents. Food Chem. 197, 1–6. Minh Tu, N.T., Onishi, Y., Choi, H.S., Kondo, Y., Bassore, S.M., Ukeda, H., Sawamura, M., 2002. Characteristic odor components of Citrus sphaerocarpa Tanaka (Kabosu) coldpressed peel oil. J. Agric. Food Chem. 50, 2908–2913. Muñoz-Bertomeu, J., Arrillaga, I., Ros, R., Segura, J., 2006. Up-regulation of 1-deoxy-Dxylulose-5-phosphate synthase enhances production of essential oils in transgenic spike lavender. Plant Physiol. 142, 890–900. Peng, L.W., Sheu, M.J., Lin, L.Y., Wu, C.T., Chiang, H.M., Lin, W.H., Lee, M.C., Chen, H.C., 2013. Effect of heat treatments on the essential oils of kumquat (Fortunella margarita Swingle). Food Chem. 136, 532–537. Qiu, S., Wang, J., 2015. Application of sensory evaluation, HS-SPME GC-MS, E-Nose, and E-Tongue for quality detection in Citrus fruits. J. Food Sci. 80, 2296–2304. Quijano, C.E., Pino, J.A., 2009. Volatile compounds of round kumquat (Fortunella Japonica Swingle) peel oil from Colombia. J. Essent. Oil Res. 21, 483–485. Rodríguez-Concepción, M., Boronat, A., 2002. Elucidation of the methylerythritol phosphate pathway for isoprenoid biosynthesis in bacteria and plastids. A metabolic milestone achieved through genomics. Plant Physiol. 130, 1079–1089. Ruberto, G., 2002. Analysis of volatile components of Citrus fruit essential oils. In: Jackson, J.F., Linskens, H.F. (Eds.), Analysis of Taste and Aroma. Springer, Berlin, Heidelberg, pp. 123–157. Schwab, W., Davidovich㏑Ikanati, R., Lewinsohn, E., 2008. Biosynthesis of plant-derived flavor compounds. Plant J. 54, 712–732. Shahidi, F., Zhong, Y., 2005. Citrus oils and essences. In: shadihi, F. (Ed.), Bailey’s Industrial Oil and Fat Products. John Wiley and Sons, pp. 49–66. Sicari, V., Poiana, M., 2017. Comparison of the volatile component of the essential oil of kumquat (Fortunella margarita swingle) extracted by supercritical carbon dioxide, hydrodistillation and conventional solvent extraction. J. Essent. Oil Bear. Pl. 20, 87–94. Sikkema, J., de Bont, J.A., Poolman, B., 1995. Mechanisms of membrane toxicity of hydrocarbons. Microbiol. Rev. 59, 201–222. Simas, D.L.R., de Amorim, S.H.B.M., Goulart, F.R.V., Alviano, C.S., Alviano, D.S., da Silva, A.J.R., 2017. Citrus species essential oils and their components can inhibit or stimulate fungal growth in fruit. Ind. Crop Prod. 98, 108–115. Summo, C., Trani, A., Faccia, M., Caponio, F., Gambacorta, G., 2016. Volatiles and acceptability of liqueurs from kumquat and Grapefruit. Ital. J. Food Sci. 28, 258–270. Thomson, W.W., Plattaloia, K.A., Endress, A.G., 1976. Ultrastructure of oil gland development in leaf of Citrus sinensis l. Bot. Gaz. 137, 330–340. Tranchida, P.Q., Bonaccorsi, I., Dugo, P., Mondello, L., Dugo, G., 2012. Analysis of Citrus essential oils: state of the art and future perspectives. A review. Flavour Frag. J. 27, 98–123. Voo, S.S., Grimes, H.D., Lange, B.M., 2012. Assessing the biosynthetic capabilities of secretory glands in Citrus peel. Plant Physiol. 159, 81–94. Wang, Y., Zeng, W., Xu, P., Lan, Y., Zhu, R., Zhong, K., Huang, Y., Gao, H., 2012.

5. Conclusions The results of this study showed that the secretory cavities were formed under the flavedo at the early stage of fruit development. The expansion of the cavities continued throughout the whole period of fruit development. The cavity volume was the major factor to influence the accumulation of essential oil in the peel during fruit development. Limonene was the most abundant component of the essential oils, with a stable proportion of about 70% at any stage of fruit development. The content of the compounds related to disease resistance and pungent odor declined during the late stages of fruit development. The gene expression analysis showed that DXS2, HDR and IDI may be the important genes controlling the biosynthesis of essential oils in kumquat peel. Author contribution statement ZXC and LXF conceived and designed the experiment. LBH, JD and ZSP performed the trait investigation. SWX and YX contributed mass spectrometry analyses. XY and LMY carried out the gene expression analyses. FJY provided the plant material. LXF wrote the manuscript. All authors read and approved the manuscript. Conflict of interest The authors declare that they have no conflict of interest. Acknowledgements This study was supported by the Earmarked Fund for China Agriculture Research System (CARS-27), the Earmarked Fund for Chongqing Special & Economic Agriculture Research System on Late Maturation Citrus, Cooperative Research Program for Agriculture Science & Technology Development (Project No. PJ01211201), the "Double World-classes" Development Plan of Southwest University, and Guangxi Key Laboratory of Citrus Biology (SYS2015K003). References Abbott, C.E., 1935. Blossom-bud differentiation in Citrus trees. Am. J. Bot. 22, 476–485. Alvarenga, I.C.A., Boldrin, P.F., Pacheco, F.V., Silva, S.T., Bertolucci, S.K.V., Pinto, J.E.B.P., 2015. Effects on growth, essential oil content and composition of the volatile fraction of Achillea millefolium L. Cultivated in hydroponic systems deficient in macro- and microelements. Sci. Hortic. 197, 329–338. Azam, M., Jiang, Q., Zhang, B., Xu, C., Chen, K., 2013. Citrus leaf volatiles as affected by developmental stage and genetic type. Int. J. Mol. Sci. 14, 17744–17766. Bain, J.M., 1958. Morphological, anatomical, and physiological changes in the developing fruit of the Valencia orange, Citrus sinensis (L) Osbeck. J. Appl. Anim. Res. 40, 154–162. Baldwin, I.T., 2010. Plant volatiles. Curr. Biol. 20, 392–397. Barros, J., Becerra, J., González, C., Martínez, M., 2013. Antibacterial metabolites synthesized by psychrotrophic bacteria isolated from cold-freshwater environments. Folia Microbiol. (Praha) 58, 127–133. Bourgou, S., Rahali, F.Z., Ourghemmi, I., Saïdani Tounsi, M., 2012. Changes of peel essential oil composition of four Tunisian citrus during fruit maturation. Sci. World J.l 2012, 528593. Burt, S., 2004. Essential oils: their antibacterial properties and potential applications in foods—a review. Int. J. Food Microbiol. 94, 223–253. Chen, Y., Wu, H., 2010. Programmed cell death involved in the schizolysigenous formation of the secretory cavity in Citrus sinensis L. (Osbeck). Sci. Bull. (Beijing) 55, 2160–2168. Choi, H.S., 2005. Characteristic odor components of kumquat (Fortunella japonica Swingle) peel oil. J. Agri. Food Chem. 53, 1642–1647. Cuevas, F., Morenorojas, J.M., Ruizmoreno, M.J., 2017. Assessing a traceability technique in fresh oranges (Citrus sinensis L. Osbeck) with an HS-SPME-GC-MS method. Towards a volatile characterisation of organic oranges. Food Chem. 221, 1930–1938. De Carvalho, C.C.C.R., Fonseca, M.M.R.D., 2007. Preventing biofilm formation:

128

Scientia Horticulturae 252 (2019) 121–129

X. Liu, et al.

Chem. 230, 316–326. Zhang, J., Tian, H., Sun, H., Wang, X., 2017b. Antifungal activity of Trans-2-hexenal against Penicillium cyclopium by a membrane damage mechanism. J. Food Biochem. 41, e12289. Zhang, T., Sun, M., Guo, Y., Shi, X., Yang, Y., Chen, J., Zheng, T., Han, Y., Bao, F., Ahmad, S., 2018. Overexpression of LiDXS and LiDXR from Lily (Lilium‘Siberia’) enhances the terpenoid content in tobacco flowers. Front. Plant Sci. 9, 909. Zheng, P., Bai, M., Chen, Y., Liu, P.W., Gao, L., Liang, S.J., Wu, H., 2014. Programmed cell death of secretory cavity cells of citrus fruits is associated with Ca 2+ accumulation in the nucleus. Trees 28, 1137–1144. Zipora, T., Anne, P., Elazar, F., Efraim, L., Ron, P., 2011. Taste and aroma of fresh and stored mandarins. J. Sci. Food Agric. 91, 14–23.

Chemical composition and antimicrobial activity of the essential oil of kumquat (Fortunella crassifolia swingle) peel. Int. J. Mol. Sci. 13, 3382–3393. Webb, H., Lanfear, R., Hamill, J., Foley, W.J., Külheim, C., 2013. The yield of essential oils in Melaleuca alternifolia (Myrtaceae) is regulated through transcript abundance of genes in the MEP pathway. PLoS One 8, e60631. Xu, Q., He, Y., Yan, X., Zhao, S., Zhu, J., Wei, C., 2018. Unraveling a crosstalk regulatory network of temporal aroma accumulation in tea plant (Camellia sinensis) leaves by integration of metabolomics and transcriptomics. Environ. Exp. Bot. 149, 81–94. Yin, J.L., Wong, W.S., Jang, I.C., Chua, N.H., 2016. Co-expression of peppermint geranyl diphosphate synthase small subunit enhances monoterpene production in transgenic tobacco plants. New Phytol. 213, 1133–1144. Zhang, H., Xie, Y., Liu, C., Chen, S., Hu, S., Xie, Z., Deng, X., Xu, J., 2017a. Comprehensive comparative analysis of volatile compounds in citrus fruits of different species. Food

129