The active components derived from Penthorum chinense Pursh protect against oxidative-stress-induced vascular injury via autophagy induction

Journal Pre-proof The active components derived from Penthorum chinense Pursh protect against oxidative-stress induced vascular injury via autophagy induction Xiaolei Sun, Anguo Wu, Betty Yuen Kwan Law, Chaolin Liu, Wu Zeng, Alena Cong Ling Qiu, Yu Han, Yanzheng He, Vincent Kam Wai Wong PII:

S0891-5849(19)31002-0

DOI:

https://doi.org/10.1016/j.freeradbiomed.2019.10.417

Reference:

FRB 14471

To appear in:

Free Radical Biology and Medicine

Received Date: 13 June 2019 Revised Date:

22 October 2019

Accepted Date: 31 October 2019

Please cite this article as: X. Sun, A. Wu, B.Y. Kwan Law, C. Liu, W. Zeng, A.C. Ling Qiu, Y. Han, Y. He, V.K. Wai Wong, The active components derived from Penthorum chinense Pursh protect against oxidative-stress induced vascular injury via autophagy induction, Free Radical Biology and Medicine (2019), doi: https://doi.org/10.1016/j.freeradbiomed.2019.10.417. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier Inc.

The active components derived from Penthorum chinense Pursh protect against oxidative-stress induced vascular injury via autophagy induction Xiaolei Sun#1,2,3, Anguo Wu#1, 4, Betty Yuen Kwan Law1, Chaolin Liu2, Wu Zeng1, Alena Cong Ling Qiu1, Yu Han1, Yanzheng He2,3* & Vincent Kam Wai Wong1* 1

State Key Laboratory of Quality Research in Chinese Medicine, Macau University of Science and

Technology, Macau, China 2

Vascular Surgery Department, Affiliated Hospital of Southwest Medical University, Sichuan

Province, China 3

Key Laboratory of Medical Electrophysiology of Ministry of Education, Collaborative Innovation

Center for Prevention and Treatment of Cardiovascular Disease, Institute of Cardiovascular Research, Southwest Medical University, Sichuan Province, China 4

Sichuan Key Medical Laboratory of New Drug Discovery and Drugability Evaluation, Luzhou

Key Laboratory of Activity Screening and Druggability Evaluation for Chinese Materia Medica, School of Pharmacy, Southwest Medical University, Luzhou, 646000, China #

The authors contribute equally to the works

*Correspondence to: Vincent Kam Wai Wong, Ph.D., Associate Professor, E-mail: [email protected]; Yanzheng He, Ph.D., Professor, E-mail: [email protected]; Both authors have contributed equally. Xiaolei Sun, Ph.D., Associate Professor, E-mail: [email protected]; Anguo Wu, Ph.D., E-mail: [email protected]; Betty Yuen-Kwan Law, Ph.D., Associate Professor, E-mail: [email protected]; Chaolin Liu, Master student, E-mail: [email protected]; Wu Zeng, Ph.D. student, E-mail: [email protected]; Alena Cong Ling Qiu, Ph.D. student, E-mail: [email protected]; Yu Han, Master student, E-mail: [email protected]. 1

[Abstract] Oxidative stress-induced damage has been proposed as a major risk factor for cardiovascular disease and is a pathogenic feature of atherosclerosis. Although autophagy was reported to have a protective effect against atherosclerosis, its mechanism for reducing oxidative stress remains un-elucidated. In this study, we have identified 4 novel autophagic compounds from traditional Chinese medicines (TCMs), which activated the AMPK mediated autophagy pathway for the recovery of mitochondrial membrane potential (MMP) to reduce the production of reactive oxygen species (ROS) in Human umbilical vein endothelial cells (HUVECs). In this study, 4 compounds (TA, PG, TB and PG1) identified from Penthorum chinense Pursh (PCP) were demonstrated for the first time to possess binding affinity to HUVECs cell membranes via cell membrane chromatography (CMC) accompanied by UHPLC-TOF-MS analysis, and the 4 identified compounds induce autophagy in HUVECs. Among the 4 autophagic activators identified from PCP, TA (Pinocembrin dihydrochalcone-7-O-[3''-O-galloyl-4'',6''-hexahydroxydiphenoyl]-glucoside) is the major chemcial component in PCP, which possesses the most potent autophagy effect via a Ca2+ /AMPK-dependent and mTOR-independent pathways. Moreover, TA efficiently reduced the level of ROS in HUVECs induced by H2O2. Additionally, the expression of pro- and cleaved-IL-1β in the aortic artery of ApoE-KO mice were also alleviated at the transcription and post-transcription levels after the administration of TA, which might be correlated to the reduction of oxidative-stress induced inflammasome-related Nod-like receptor protein3 (NLRP3) in the aortic arteries of 2

ApoE-KO mice. This study has pinpointed the novel autophagic role of TA in alleviating the oxidative stress of HUVECs and aortic artery of ApoE-KO mice, and provided insight into the therapeutic application of TA in treatment of atherosclerosis or other cardiovascular diseases.

Keywords: Oxidative stress; Autophagy; Atherosclerosis; Cell membrane chromatography

(CMC);

UHPLC-TOF-MS;

Pinocembrin

dihydrochalcone-7-O-[3''-O-galloyl-4'',6''-hexahydroxydiphenoy]-glucoside.

1. Introduction Atherosclerosis is an incurable disease and contributes to human deaths, which has become the leading cause of morbidity and mortality in developed countries [1]. It is characterized as a chronic inflammatory process involving the accumulation of lipoproteins and infiltration of inflammatory cells. The damage of vascular endothelial cells is recognized as the key initiation step, which elicits the infiltration of inflammatory cells and release of cytoplasmic proinflammatory factors, and finally causes an irreversible change of the structure and function of vascular vessels, inducing the progression and pathogenesis of atherosclerosis [2]. Production of ROS by vascular endothelial cells and smooth muscle cells under stress is one of the most important ways of damage [3]. Oxidative stress is one of the key pathophysiological factor in the process of atherosclerosis, which is reported to induce inflammasome activation involved in redox injury [4, 5]. It is unveiled that ROS could initiate the responses of NLRP3 inflammasome and activate IL-1β to participate in the development of atherosclerosis [6, 7]. Canakinumab, a monoclonal antibody for the

3

inhibition of IL-1β, has demonstrated promising therapeutic potency in the reduction of cardiovascular events in a randomized, double-blind preclinical trial [8].

Emerging evidence has demonstrated the autophagic characteristics in the vascular cells of atherosclerotic plaques [9]. Autophagy alleviated AGEs- and oxLDL-induced damage to vascular endothelial cells [10, 11]. Other study showed that 7-ketocholesterol, an inducer of autophagy, significantly decreased statin-induced death of vascular smooth muscle cells [12]. Several studies have depicted the protective role of autophagy against atherosclerosis by using a series of related gene-knockout atherosclerosis mice models, for example, signs of atherosclerosis was observed in autophagy-related gene Atg5 deficient mice, including activation of inflammasomes and apoptosis, formation of cholesterol crystal under the intimal layer, deficiency of endocytosis and cholesterol efflux in macrophages [13, 14]. More findings have revealed the impact of oxidative stress, especially the oxidation of LDL, in the pathogenesis of atherosclerosis [15]. Autophagy is an adaptive mechanism that protects cells from oxLDL-mediated cell death in the vascular vessels. Recent findings have revealed that a moderate amount of ROS can induce autophagy and thus protect cells from oxidative stress damage. Autophagy deficiency is considered to exert an indispensable impact in the development of atherosclerosis [16]. It is reported that excessive ROS can directly damage the lysosome membrane to release the pro-degradation enzymes into the cytoplasm, leading to autophagy deficiency and induction of caspase signaling and apoptosis [17]. Therefore, regulation of autophagy

4

might be a potent therapeutic approach for the prevention and treatment of atherosclerosis.

Penthorum chinense Pursh, is a traditional Chinese herb. commonly used as folk medicine for the treatment of cholecystitis, jaundice, edema, adiposis hepatica, infectious hepatitis and traumatic injury [18, 19]. With its reported therapeutic effect in diuresis, detoxification and promoting blood circulation [20], further studies have indicated that PCP herb exhibited potent effects in anti-oxidation, anti-hepatitis and anti-tumor [21, 22].

Phytochemical study revealed that the major constituents of PCP include flavonoids, polyphenols, triterpenoids and lignans [18, 23]. Cell membrane chromatography (CMC) has been developed to identify bioactive compounds from TCMs [24], therefore, CMC was applied to identify active compounds with binding affinity to HUVECs cells from PCP for cardiovascular protection. To begin, cell lysates from the PCP -treated HUVECs were analyzed by Ultra High Performance Liquid Chromatography-Time-Of-Flight Mass Spectrometry (UHPLC-TOF-MS). At last, 4 active compounds including TA, PG, TB and PG1, were identified from PCP and with their

autophagic

activities

in

HUVECs

confirmed.

Further

investigations

demonstrated that the most potent autophaic chemcial component, TA, induced autophagy in HUVECs via a Ca2+ /AMPK-dependent and mTOR-independent pathway. Moreover, TA alleviated the ROS level in vitro via induction of autophagy and suppressed the oxidative stress-related inflammasome expression in the aorta vessel of 5

atherosclerotic mice model. Our findings have provided insight into the discovery of novel non-toxic autophagic compounds from TCMs which may benefit for the treatment of atherosclerosis-related diseases in the future.

2. Materials and methods 2.1. Cell culture and reagents U87 cells and HUVEC cells were obtained from the company of American Type Culture Collection (ATCC) (Rockville, MD, USA). Masaaki Komatsu (Juntendo University, Tokyo, Japan) kindly presented us with Atg7 -wild type and -knockout mouse embryonic fibroblasts (MEFs). α-MEM medium containing 10% fetal bovine serum supplemented with 50 µg/mL streptomycin and 50 U/mL penicillin (Invitrogen, Scotland, UK) was used to maintain U87 cells. HUVEC cells were maintained in the DMEM medium containing 10% fetal bovine serum supplemented with 50 µg/mL streptomycin and 50 U/mL penicillin and (Invitrogen, Scotland, UK). HeLa cells which were obtained from the company of American Type Culture Collection (ATCC) (Rockville, MD, USA) were cultured in the Minimum Essential Media (MEM) containing 10% fetal bovine serum supplemented with 50 µg/mL streptomycin and 50 U/mL penicillin (Invitrogen, Scotland, UK). Stable GFP-LC3 U87 cells were also cultured in the α-MEM containing 10% fetal bovine serum supplemented with 50 µg/mL streptomycin and 50 U/mL penicillin (Invitrogen, Scotland, UK). Rapamycin, hydrogen peroxide solution (H2O2), E64d and pepstatin A, AICAR, LY294002, compound C，BAPTA/AM，STO-609 and methyl pyruvate (MP) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Quercetin, gallic acid and pinocembrin were obtained from MUST Bio-technology Company Ltd. (Chengdu, China). MK2206 was 6

obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). LY2584702 was provided by Selleckchem (Houston, Texas, USA). OxLDL was obtained from Biomedical Technologies (Stoughton, MA, USA).

2.2. Preparation of the extract of Penthorum chinense Pursh Chinese medicine herb, Penthorum chinense Pursh, was purchased from the Zi Ning Zhong Yao Ying Pian Co. Ltd. (Chuan 20110407, Sichuan, China). 40 g of the herb was smashed into powder and extracted with its volume of 70% ethanol for 1 h by refluxing method for 10 times for extracting both the water and ethanol soluble components of PCP. All the extracted solutions were then collected, concentrated and dried by a rotatory evaporator under reduced pressure to produce the final herbal ethanol extract (TEE).

The solvent extracting system was then used for the fractionation of the components from PCP. In brief, the total ethanol extract (TEE) of PCP was re-dissolved in water, and then partitioned with n-hexane (1:1 volume/volume) for 3 times. The n-hexane fraction was then collected and with its solvent evaporated. The remaining water layer

was

subsequently

partitioned with ethyl

acetate

(1:1

volume/volume) for 3 times to obtain the ethyl acetate fraction (EF). The EF was collected and with its solvent evaporated. The remaining water layer was then partitioned with n-butanol (1:1 volume/volume) for 3 times to obtain the n-butanol fraction (NF) and water fraction (WF). Finally, the water fraction (WF), n-butanol fractions (NF), ethyl acetate fraction (EF) and n-hexane fraction (HF) of PCP were obtained for further UHPLC-TOF-MS identification and biological activity evaluation. Ethanol, n-butanol, ethyl acetate and n-hexane were obtained from

7

Anaqua Chemicals Supply (Houston, TX, USA). Milli-Q water is prepared via Milli-Q Integral Water Purification System Millipore in our laboratory.

2.3. Cell membrane chromatography (CMC)

HUVECs were incubated with TEE of PCP at a final concentration of 100 µg/mL for 4 h. After incubation, the medium was collected, and the HUVECs were washed by PBS for 5 times and the final PBS washing solution was keep as a control group to confirm these compounds without binding affinity were washed away. After that, citric acid buffer (3 mL, pH 4.0) was added to lyse the HUVECs in plate at 37 ºC for 30 min. Ultrasound sonication would be preferred to facilitate complete cell disruption in the cell suspension. The lysed solution was then centrifuged at 2500 rpm for 5 mins, and the supernatant was collected and all the sample solutions were dried with nitrogen.

Finally, 100 µL of methanol was added to re-dissolved the residue

and the solution was filtered by a 0.22 µm microporous membrane, and 1 µL of sample was injected into UHPLC-TOF-MS instrument for the analysis of the components with binding affinity [25].

2.4. Instruments and chromatographic conditions

Agilent Technologies 1290 Series UHPLC and Agilent Technologies 6230 Time of Flight MS combined with a Jet Stream ion source in negative ion mode, was applied to perform the UHPLC analysis in our experiments.

An Agilent Zorbax Eclipse Plus C-18 50 mm × 2.1 mm column (particle size: 1.8 µm) was used to separate the extracted samples at a flow rate of 0.35 mL/min. The column temperature was set at 40 °C and 1 µL of sample was injected for analysis. 8

Mobile phase A: 0.1% formic acid in water, and mobile phase B (ACN): 0–8 min, 5%–70% (B); 8–11 min, 70%–100% (B); 11–14 min, 100% (B); 14–15 min, 5% (B), were performed by a gradient elution program. The scan mode set from m/z 100 to 3200 Da with 2.0 spectra/s was employed for the UHPLC-TOF-MS data acquisition. Agilent MassHunter Workstation software B.01.03 was used to perform the data analysis.

2.5. Cytotoxicity assays DMSO was used to dissolve the herbal extracts, isolated herbal fractions and single compound, and then the drug solutions were stored at −40 °C until further use. MTT (3-[4,5-dimethylthiazol-2-yl]- 2,5-diphenyl tetrazolium bromide) method was applied to measure cell viability[26]. In brief, cells were grown in a 96-well microplate for one day before 48 h of treatment with compounds under the indicated concentrations. After treatment, 10 µL of MTT solution at a concentration of 5 µg/mL was added into each well and incubated for 4 h. The crystal violet in each well was dissolved using DMSO. Spectrophotometer was used to determine the colorimetric reading value of the solute mixture at OD 570 nm. The percentage of cell viability was calculated by the formula: % of Cell viability = (OD value of Cells number treated/ OD value of Cells number DMSO control) × 100. IC50 (half maximal inhibitory concentration) values for each of the extracts and identified compounds were calculated by non-linear regression using GraphPad Prism® (version 8.0, La Jolla, CA). Data from 3

independent

experiments

was

analyzed.

3-(4,5-dimethylthiazol-2-yl)-2,5-dimethyltetrazolium bromide (MTT) and dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich (St. Louis, MO, USA). 9

2.6. Transfection and establishment of a stable GFP-LC3 U87 cell line LipofectamineTM 2000 (Invitrogen, Shanghai, China) was used for the transfection of the U87 cells with the GFP-LC3 plasmid. U87 cells expressing GFP-LC3 were then sorted via flow cytometry (Becton Dickinson, US). The stable transfectants were maintained in G418 (GDJ958, Sangon Biotech Co. Ltd, Shanghai, China) at 300 mg/mL. pEGFP-LC3 reporter plasmid was obtained from Tamotsu Yoshimori (Osaka University, Osaka, Japan).

2.7. Quantification of GFP-LC3 puncta formation The formation of GFP-LC3 puncta was quantified according to a method described previously [27]. In brief, coverslips in a 6-well plate were used for stable GFP-LC3 U87 cells seeding. After drug treatment, 4% paraformaldehyde was applied to fix the cells for 20 min at room temperature, followed by PBS wash for twice. FluorSave™ mounting media (Calbiochem, San Diego, CA, USA) was used to mount the air dried slides, and fluorescence microscopy was used to examine the slides. The Nikon ECLIPSE 80i microscope was applied to examine the number of GFP-positive cells with GFP-LC3 puncta formation with 40× magnification. CCD digital camera Spot RT3™ (Diagnostic Instruments, Inc., Melville, NY, USA) was used to capture the representative images. The number of the cells with puncta GFP-LC3 fluorescence formation were counted to calculate the percentage of positive cells. At least150 cells from 3 randomly selected fields were counted with statistical analysis

2.8. Western blot

10

After treatment, 70 µL of RIPA solution (1×) obtained from Cell Signaling Technologies Inc. (Beverly, MA, USA) was used to harvest the treated cells or the treated cells collected from aortic arteries of ApoE-KO mice and C57BL/6J (wild-type) mice.

Bradford reagent (Bio-Rad, Hercules, CA, USA) was applied to measure the protein concentrations. An equal amount of denatured protein was added into each well in the SDS-PAGE. After electrophoresis, the proteins from SDS-PAGE were transferred to PVDF membrane under constant current at 300mA for 2 h. The PVDF membrane with transferred proteins was first blocked for 60 min with 5% non-fat dried milk and then rinsed with TBST (1x) for 3 times. Finally, the membrane was incubated with primary antibodies at 4 °C with constant shaking overnight or in room temperature for 2 h. The membrane was washed 3 times by TBST (1x) before further incubating with HRP-conjugated secondary antibodies for 60 min. ECL Western Blotting Detection Reagents (Invitrogen, Paisley, Scotland, UK) were used to expose and visualize the protein. Band intensities were quantified using densitometric analysis software (Image J) with normalization to β-actin. Antibodies against p-AMPKα1 (2535), AMPK (2532), Beclin-1 (3738), p-mTOR (5536), mTOR (9205), p-P70S6K (9205), P70S6K (9202), PI3K (4249), p-Akt (4060), Akt (4691) were purchased from Cell Signaling Technologies Inc. (Beverly, MA, USA). Antibodies against IL-1β (ab9722) were purchased from Abcam (Cambridge, UK). Antibodies against NLRP3 (MAB7578) were purchased from R&D Systems Inc. (Minneapolis, MN, USA). Antibody against β-actin (sc-47778) was purchased from Santa Cruz 11

Biotechnology (Texas, USA). LC3 (PM036) antibody was purchased form MBL International (MA, USA).

2.9. Determination of the interaction of TA with H2O2

In Brief, 8 µM of TA dissolved in PBS was mixed with 600 µM of H2O2 for 12 h at 37 , meanwhile 8 µM of TA and 600 µM H2O2 were set control, respectively. After that, 10 µL of each sample was injected to the UHPLC-DAD-QTOF-MS/MS instrument for the determination of TA, and the detailed chromatographic condition and MS parameters were set. All the samples were analyzed on a Shimadzu system (Kyoto, Japan) equipped with an LC-3AD solvent delivery system, a SIL-30ACXR auto-sampler, a CTO-30AC column oven, a DGU-20A3 degasser, and a CBM-20A controller, and separated on an Agilent Zorbax Eclipse Plus C18 column (100 mm × 2.1 mm, 1.8 µm, flow rate: 0.35 mL/min). The column oven temperature was set at 40 ℃. The mobile phase was 40% acetonitrile in water with 0.1% formic acid. The UHPLC-QTOF-MS/MS analysis was conducted on a triple TOFTM X500R system with a Duo Spray source in the negative electrospray ion mode (AB SCIEX, Foster City, CA, USA). The electrospray ionization was applied in the negative mode with the following parameters: ion spray voltage, -4500 V; ion source temperature, 500 ℃; curtain gas, 25 psi; nebulizer gas (GS 1), 50 psi; heater gas (GS 2), 50 psi; and declustering potential (DP), -100 V. The mass ranges were set at m/z 60 -2000 Da for the TOF-MS scan. The LC-MS/MS data were analysed using Peak View® 1.4 software (AB SCIEX Foster City, CA, USA). 12

2.10. Cell apoptosis analysis

HUVEC cells were seed on 60 mm dishes for 12 h, and then incubated with H2O2 (600 µM) for 24 h, with or without pre-treatment with TA, PG, TB or PG1 (8µM) for 2 h. The cells were then trypsined, centrifuged and washed twice by PBS. FACSCalibur flow cytometer (BD Biosciences, CA) was used to measure apoptosis by using FITC-conjugated Annexin V and Propidium Iodide (PI, from BD Biosciences, CA). Fluorescent emission of FITC and DNA-PI complexes were measured at 515–545 nm, and 564–606 nm, respectively (with excitation at 488 nm). Annexin V positive combined with PI negative HUVECs cells were demonstrated as early apoptotic stage, while both Annexin V and PI positive cells were demonstrated as late apoptotic stage.

2.11. Evaluation of mitochondrial membrane potential (MMP)

Rhodamine 123 (Invitrogen, Carlsbad, CA) is selectively taken up by mitochondria and the amount of the uptake of this lipophilic cationic fluorescent dye is directly proportional to the MMP ∆Ψm of cells. In brief, HUVEC cells were plated in six-well plates for 12 h. After being incubated with H2O2 (600 µM) for 24 h, with or without the pre-treatment with TA, PG, TB or PG1 (8 µM) for 2 h, the cells were trypsined, resuspended and incubated in 1 µM of Rho-123 solution for 30 min at 37°C. While extracellular Rhodamine 123 was washed away by PBS after incubation, the remaining cells were re-suspended in PBS again. 10,000 cells per sample was counted for the fluorescent measurement of relative MMP ∆Ψm through flow cytometry by using the excitation and emission wavelength at 488 nm and 525–530 nm, respectively.

13

Alternatively, the lipophilic cationic JC-1 which was freely permeable to cells, was a kind of probes used to measure MMP. When it binds to membranes that have an MMP of 80 to 100 mV, JC-1 would transform from a monomer to an aggregate form [28]. The intact membrane potential of mitochondria concentrates JC-1 into aggregates, while de-energized mitochondria cannot concentrate JC-1. JC-1 monomer has an emission at 530 nm (green fluorescence) while JC-aggregates has an emission at 590 nm (red fluorescence). Therefore, the relative mitochondrial membrane polarization state could be indicated by the changes of fluorescence signal of JC-1. µ-Slide 8-well glass bottom plate (#80826, ibidi, Germany) was applied for HUVEC cells grown at a density of 8000 per well. After the incubation with H2O2 (400 µM) for 24 h with or without 2 h pre-treatment with TA or CC, the cells were incubated with 1 ml of PBS containing 10 µg/ml of JC-1 (Thermo Scientific, Waltham, MA, USA) at 37°C for 10 min. Finally, a confocal microscope (Leica TCS SP8, Germany) equipped with a 63x oil immersion objective was used to capture the MMP of the cells at Ex 488/Em 530nm for red fluorescence detection, or Ex 550/Em 600nm for green fluorescence detection. The ratio of red-to-green fluorescence is calculated to quantitate the JC-1 intensity for MMP.

2.12. Measurement of Dynamic of Cytoplasmic Calcium

The FLIPR Calcium 6 Assay Kit (Molecular Devices) was used to measure the intracellular Ca2+ dynamic. Following the manufacturer’s instructions, 96-wells plate with black wall and clear bottom provided by Costar (Tewksbury, MA, United States) were used to plant HUVEC cells at 10000 cells per well for 12 h before treatment. Cells were then incubated with Calcium 6 reagent for 2 h at 37℃. After that, TA, PG, 14

TB or PG1 at 8 µM were automatically added to the cells and immediately subjected to data acquisition a 1-s reading interval by the FLIPR Tetra High-Throughput Cellular Screening System (Molecular Devices).

2.13. Intracellular ROS Detection

10 µM of 2’,7’-dichlorodihydrofluorescein diacetate (DCFH-DA, from Sigma-Aldrich, St. Louis, MO, USA) was used to detect the intracellular level of ROS. HUVEC cells were planted at 6-well plates for 12 h before treatment. To begin, H2O2 (400 or 600 µM) was added to the cells and incubated for 24h, with or without treatment with TA (4 µM). The intracellular esterase could hydrolyze DCFHDA into non-fluorescent DCFH, which was oxidized by intracellular ROS to generate fluorescent DCF. The fluorescence value of the intracellular DCF which reflected the level of intracellular ROS in cells was then measured by spectrophotometer and flow cytometry, with excitation at 488 nm and emission at 525–530 nm, respectively.

2.14. RNA interference of Atg7

The

human

Atg7

siRNA

with

gene

sequence

5’-GGAGUCACAGCUCUUCCUU-3’ (Invitrogen, Scotland, UK), and universal Control siRNA from Santa Cruz Biotechnology (Texas, USA) were used. Lipofectamine 2000 (Invitrogen) was applied to transfect HUVEC cells with the short oligo-RNAs for 4 h. The transfected cells were then incubated for 24h-48h before further experiments.

2.15. Animals and animal care 15

All procedures were in agreement with standards for care and use of laboratory animals as outlined in the ARRIVE guidelines and the U.K. Animals (Scientific Procedures) Act, 1986, and the guidelines of EU Directive 2010/63/EU. Experimental protocols were approved by the Animal Care and Use Committee of the Southwest Medical University (No. 20180620001) before implementation. Procedures were administered in the Animal Experiment Center under the auspices of the Animal Resource Services of the Southwest Medical University.

ApoE-KO mice (male, B6/JNju-Apoeem1Cd82/Nju) and C57BL/6J (male, wide-type) mice were purchased from Nanjing Biomedical Research Institute of Nanjing University (NBRI, Nanjing, Jiangsu, China). Promega Wizard PCR Preps DNA Purification System was applied to isolate the mouse genomic DNA from white blood cells, and PCR amplification was used to confirm the genotype. Primers (forward primer 180, 5′-GCC TAG CCG AGG GAG AGC CG-3′; reverse primer 181, 5′-TGT GAC TTG GGA GCT CTG CAG C-3′; and reverse primer 182, 5′-GCC GCC CCG ACT GCA TCT-3′) indicated by The Jackson Laboratory web page (http://jaxmice.jax.org) were designed to determine the ApoE genotype by PCR. A regular chow diet (NBRI, Nanjing, Jiangsu, China) was used to maintain the C57BL/6J (wild type) from 2 months of age until sacrifice at 3 months. A Cocoa Butter diet (NBRI, Nanjing, Jiangsu, China) containing 1.25% cholesterol and 0.5% cholic acid was used to maintain ApoE-KO mice at 2 months of age for 4 weeks before sacrifice. ApoE-KO mice and C57BL/6J mice controls were treated with TA (0.1mg/kg per day) via intraperitoneal injection for 4 weeks before sacrifice.

2.16. ROS Detection from aortic artery

16

2’,7’-dichlorodihydrofluorescein diacetate (DCFH-DA) was used to detect the intracellular ROS. The cells of aortic arteries of ApoE-KO mice and C57BL/6J (wild-type) mice were collected by nylon sievemesh combined with trypsin. 10 µM 2’,7’-dichlorofluorescin diacetate (DCFH-DA) was used to incubate with the above isolated cells at 37 °C for 30 min. The fluorescence value of the intracellular DCF was then measured by spectrophotometer and flow cytometry with excitation at 488 nm and emission at 525–530 nm. The levels of intracellular ROS in individual cells were reflected by the mean fluorescence intensity.

2.17. Immunohistochemistry (IHC) Aortic arteries were examined in methyl Carnoy’s fixed, paraffin-embedded tissue sections (4 µm) stained by the Periodic Acid–Schiff (PAS) method. Immnunostaining with the antibody against IL-1β was performed on paraffin sections using a microwave-based antigen retrieval technique. After being immunostained with the secondary antibodies, sections were developed with diaminobenzidine to produce a brown color and counterstained with hematoxylin. Images were captured by Aperio® AT2

(Leica

Biosystems,

Wetzlar,

Germany).

Quantification

of

immunohistochemistry images is represented as percentage of area occupied ± SD of 3 independent experiments, and with n = 5 in each experiment.

2.18. Real time-PCR (RT-PCR) Aortic arteries from ApoE-KO mice and C57BL/6J (wild-type) mice were collected and grinded into pieces with liquid nitrogen for gene analysis by quantitative real-time PCR. RNase mini kit (Qiagen, Hilden, Germany) was used to extract the total mRNA, which was reversely transcripted to cDNA by iScript™ cDNA Synthesis 17

Kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The mRNA expression of IL-1β was measured on a Bio-radS1000™ Thermal Cycler (Bio-Rad Laboratories) with the GoTaq Green Master Mix (VWR International, Radnor, PA, USA). Primer sequences of IL-1β with forward sequence of TTCGACACATGGGATAACGA, and reverse sequence of TCTTTCAACACGCAGGACAG were used. Housekeeping gene β-actin was used as an internal standard.

2.19. Immunofluorescence Immunofluorescent staining was performed using fixed arcus aortas of ApoE-KO mice and C57BL/6J (wide-type) mice. The slides (30 µm) were incubated with primary antibodies against NLRP3 and IL-1β at 4 °C overnight. These slides were then incubated with corresponding fluorescent dye–conjugated secondary antibodies (Abcam, Cambridge, UK). DAPI (4,6-diamidino-2-phenylindole) was used for nuclear staining. Finally, these slides were subjected to fluorescent microscopy examination using a confocal microscope (Leica TCS SP8, Germany). Analysis of images was performed using ImageJ software.

2.20. Statistical analysis The data was demonstrated as means ± S.D. In order to analyze the difference between groups, Student’s t-test or one-way ANOVA analysis combined with Turkey test was used. Data would be considered as statistically significant while the p-value was < 0.05.

3. Results 3.1. PCP exhibits autophagy effect and protects HUVECs from oxidative injury 18

Penthorum chinense Pursh (PCP, GanHuangCao, Saxifragaceae) is widely distributed in East Asia such as China, Japan, Korea, and eastern Russia [29]. In Luzhou of Sichuan province in China, it is commonly consumed as food or prescribed as traditional Chinese medicines by local residents. Although the metabolites of PCP have been shown to possess anti-oxidant activity [30], the active anti-oxidative compounds which may protect the cardiovascular cells remains unknown. In this study, we therefore tried to identify the active components which may exhibit cardiovascular protective effect via autophagy induction. To begin, the cytotoxicity (IC50 value) of each herbal fraction extracted from flower, stem or leaf part of PCP, respectively, were determined by using the MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) method in both stable GFP-LC3 U87 and HeLa cells. As shown in Fig. 1A and B, the mean IC50 (µg/mL) of PCP-flower, -leaf and -stem parts in U87 cells were 49.4, 91.2, 209.0 (µg/mL), respectively, whereas the mean IC50 (µg/mL) of PCP-flower, -leaf and -stem parts in HeLa cells were 50.9, 94.0, 120.0, respectively. Assay on the evaluation of the autophagic effects of different PCP extracts were performed in stable GFP-LC3 U87 and HeLa autophagy cells. As shown in Fig. 1C, 15 – 60 µg/mL of both the flower and leaf parts of PCP demonstrated a dose-dependent increase in autophagic activity, and with a stronger autophagic effect than the stem part of PCP as demonstrated by the increased percentage of cells with GFP-LC3 II puncta formation. The autophagic effects of all herbal fractions were also assayed in HeLa cells by using the immunoblotting method. Consistently, as shown in 19

Fig. 1D, both the flower and leaf parts of PCP (15 and 30 µg/mL) significantly increased the level of LC3-II to a greater extent when compared to the stem fraction of PCP. The results have indicated that both flower and leaf parts of PCP may contain a higher percentage of the active components responsible for the autophagic effect in HeLa cells. Of note, all tested herbal extracts demonstrated no obvious cytotoxicity in cells under the indicated treatment concentrations (Fig. 1A and B). With the reported protective role of autophagy induction in cardiovascular diseases [31], we therefore determined whether the autophagic effect of PCP components could alleviate atherosclerosis injury. As reactive oxygen species (ROS) are likely to have a pathogenic role in cardiovascular diseases [32, 33], we therefore adopted hydrogen peroxide (H2O2) to induce oxidative stress in HUVEC cells for determining the protective effect of PCP’s extracts by using the cytotoxicity assay. As shown in Fig. 1E, the ethanol extract of flower, leaf and stem parts of PCP (30 µg/mL) displayed a strong anti-oxidant effect, as demonstrated by the increase of cell viability against H2O2-induced HUVEC injury. This finding provides evidence that the PCP’s extracts may contain the active components which could exhibit the anti-oxidative effect upon H2O2 damage In order to identify the major cytoprotective components of PCP, different solvents with different polarities were used for the herbal extraction to yield the water extract fraction (WF), n-butanol extract fraction (NF), ethyl acetate extract fraction (EF) and n-hexane extract fraction (HF) for further biological evaluation. Assay of the autophagic effects on these extractions were further performed by using the HUVEC 20

cells. As reflected by the extent of the increase in the level of LC3-II, the EF extract fraction of flower, leaf and stem of PCP displayed the strongest autophagic effect, when compared to other herbal fractions under the same treatment concentrations. (Fig. 1F). These data indicated that ethyl acetate could be the most appropriate solvent for the extraction of PCP active compounds with autophagic effect. 3.2. Identification of the active components with HUVECs affinity from PCP by using cell membrane chromatography (CMC) To further characterize the major cytoprotective chemical components from active EF fraction of PCP, cell membrane chromatography was used to identify the active compounds which possess binding affinity to cells. Based on the hypothesis that chemical components without binding affinity to cell membranes will be washed away after incubation with cells, the active chemical components which possess binding affinity to cells for biological functions will be collected and retained for chemical analysis by using UHPLC-TOF-MS (Fig. 2A). Based on the strong autophagic effect of EF leaf extract as shown in Fig. 1F, we therefore further analyzed the active components of EF left extract by using CMC method. Under optimized cell incubation and chromatographic condition, cells after incubation with PCP EF leaf extract were analyzed by UHPLC-TOF-MS. The total ion chromatography (TIC) of PCP (EF leaf extract) in negative ion pattern was performed and shown in S4 of Fig. 2B. The chromatogram of S3 showed in Fig. 2B that only C1, C2, C3 and C4 peaks were detected in the HUVECs cell lysate with PCP (EF leaf extract) treatment (S4). Consistently, C1-C4 were not detected in the control cell lysate without treatment of PCP (EF leaf extract) (S2), or the final PBS wash buffer residue solution (S1). This data suggested that the chemical components in C1-C4 of PCP are retained and 21

detected within the HUVECs cells. Furthermore, the mass spectrum in Fig. 2C showed that 4 major peaks were found and matched with the accurate mass (MS) and the molecular formula of known compounds isolated from PCP according to values reported in both literatures [34] and the “Dictionary of Natural Products”[19]. Finally, the chemical components present in the peaks were identified and listed on the Table of Fig. 2C and shown on Fig. 2D as: thonningianin A (TA): Pinocembrin dihydrochalcone-7-O-[3''-O-galloyl-4'',6''-hexahydroxydiphenoyl (HHDP)]-glucoside, PG : Pinocembrin-7-O-[3''-O-galloyl-4'',6''-HHDP]-glucoside, thonningianin B (TB): Pinocembrin

dihydrochalcone-7-O-[4'',6''-HHDP]-glucoside,

PG1:

Pinocembrin-7-O-[4'',6''-HHDP]-glucoside.

3.3. The 4 CMC-identified compounds exhibit autophagic effect in HUVECs We then evaluated the cytotoxicity of the above 4 CMC-identified compounds from PCP in HUVEC cells. As shown in Fig. 3A, the IC50 value (µg/mL) of TA, PG, TB and PG1 in HUVEC cells were 68.2, 72.5, >100 and >100 µg/mL, respectively.

To confirm the autophagic activity of the 4 CMC-identified compounds from PCP, we first monitored the conversion of cytosolic LC3-I to membrane-bound LC3-II, which is essential for the induction of autophagy, by Western blotting [35]. The immunoblotting results confirmed that all 4 CMC-identified compounds from PCP (TA, PG, TB and PG1) increased the conversion of LC3-II in HUVECs in a dose-dependent manner (Fig. 3B), while Rapamycin (Rapa) was applied as a positive control to induce autophagy in HUVECs. Furthermore, both TA and TB triggered a relative stronger conversion of LC3-I to LC3-II than that of PG and PG1 in HUVECs, suggesting that these 2 compounds exhibit stronger autophagic effect.

22

As increased expression of LC3 II can be caused by either the induction of autophagic flux, or the failure of the removal of autophagosomes due to the blockage of fusion between autophagosomes and lysosomes [35, 36], to differentiate between these two possibilities, the expression level of LC3-II was evaluated in the presence of E64d and pepstatin A (lysosomal protease inhibitors). As shown in Fig. 3C, the 4 CMC-identified compounds from PCP further increased the formation rate of LC3-II in the presence of E64d and pepstatin A. The results therefore suggested that the 4 CMC-identified compounds induced autophagic activity through the increase of autophagosome formation.

Atg7 works as a putative regulator of autophagic function through mediating the autophagosomal biogenesis, and the Atg7-deficient cells are resistant to autophagy induction [37]. Here, we therefore investigated the autophagic effect of TA, PG, TB and PG1 (8 µM, respectively) in both Atg7-wild type and -deficient mouse embryonic fibroblasts (MEFs). Our results showed that the 4 CMC-identified compounds from PCP induced autophagy in Atg7-wild type but not in Atg7-deficient MEFs (Fig. 3D). The results suggested that the CMC-identified bioactive compounds of PCP induced autophagy through autophagy related gene 7 (Atg7)-dependent mechanism.

The compounds quercetin (Que) [38, 39], gallic acid (Gal) [40] and pinocembrin (Pin) [22, 41] were reported as the major active components of PCP which exerted multiple bioactive effects on alcoholic fatty liver, antihepatocarcinoma and with Jaundice-Relieving Effects. Therefore, we also verified and compared the autophagic effects of these 3 active compounds (supplementary Fig. 1A) with our 4 newly identified CMC compounds by using the GFP-LC3 HeLa and GFP-LC3 U87 cells. To begin, the cytotoxicity (IC50 value: µg/mL) of Que, Gal, Pin and the 4 PCP 23

compounds identified by CMC were evaluated in GFP-LC3 HeLa and GFP-LC3 U87 cells. (supplementary Fig. 1B)

According to previous studies, Que [42], Gal [43] and Pin [44] were reported to induce autophagy in various cell lines related to multiple diseases, especially in tumors and brain injury. In order to rule out the autophagy effect are solely due to these 3 known reported active compounds (Que, Gal and Pin), we then verified all CMC-identified compounds for their autophagy-inducing effect in both HeLa and GFP-LC3 U87 cells via immunoblotting and immunofluorescence methods. The concentrations of Que, Gal and Pin were selected according to the previous published articles [43, 45] and the mean IC50 values in supplementary Fig. 1B. As shown in supplementary Fig. 1C, 15 µM of Que, Gal and Pin did not show any autophagic effect. However, the positive control, rapamycin, as well as the CMC-identified compounds TA and PG were found to exhibit the dose-dependent increase in autophagy effect.

Consistently, immunofluorescence assay on these compounds was performed by measuring the percentage of cells with GFP-LC3 puncta formation in stable GFP-LC3 U87 cells. As shown in supplementary Fig. 1D, Que, Gal and Pin (30 µM) could not induce GFP-LC3 immunofluorescence puncta formation, while TA, PG, TB and PG1 with concentrations ranging from 2 to 16 µM could dose-dependently increase GFP-LC3 puncta formation. The results confirmed that TA, PG, TB and PG1 are the

24

effective compounds of PCP which induce autophagy in HUVECs, U87 and HeLa cells. 3.4. The protective effect of the 4 CMC-identified compounds from PCP in H2O2 induced redox injury Oxidative stress has been recognized as the major cause in the pathogenesis of atherosclerosis [46]. In this study, H2O2 is employed as the detrimental stimulus to induce the production of reactive oxygen species (ROS) and oxidative stress damage in HUVECs in vitro [47, 48].

Firstly, the cell viability after H2O2-induced redox injury in HUVECs with or without 2h pre-treatment of TA, PG, TB or PG1 were measured. As shown in Fig. 4A, the mean IC50 of H2O2 treated HUVECs is 374 µM, whereas the mean IC50 of H2O2 treated HUVEC in the presence of TA, PG, TB or PG1 were ranged from 807 to 970 µM. The increase of mean IC50 values demonstrated the potential antioxidative effect of the 4 identified active PCP compounds in H2O2-induced redox injury in HUVECs, which were consistent with the results demonstrating the antioxidant effect of PCP extracts in the previous section. To further confirm the protective effect of the 4 CMC-identified compounds from PCP, Annexin V-FITC/PI flow cytometry was applied to analyze the rate of H2O2-induced apoptosis in HUVECs. As shown in Fig. 4B, while H2O2 alone markedly induced the cell death to ~34 %, HUVECs pretreated with 8 µM of TA, PG, TB or PG1 for 2 h showed a significant diminished in the H2O2-induced HUVEC cell death to 10.6 %. These results preliminarily demonstrated that TA, PG, TB and PG1 could alleviate the oxidative stress injury in HUVECs. 25

Mitochondria, commonly referred as the power house of the cell, it plays a vital role in cellular pathophysiology. The majority of cellular energy (ATP) in eukaryotic cells is generated in the mitochondria through oxidative phosphorylation [49]. The mitochondrial electron transport chain creates an electrochemical gradient through a series of redox reactions. This electrochemical gradient generates the mitochondrial membrane potential (MMP) and drives the synthesis of ATP [50], which offer a key parameter for evaluating mitochondrial function [51]. Previous studies showed that an overload of ROS can induce cell death or apoptosis by damaging mitochondria [52]. To further explore the protective mechanism of the 4 CMC-identified compounds from PCP in H2O2-induced HUVEC injury, we investigated whether these compounds can improve cell viability via recovering cells from H2O2-induced loss of mitochondrial membrane potential (MMP). HUVEC cells stained with rhodamine 123 were detected by flow cytometry to examine the variation of MMP in HUVECs in the presence of H2O2 or PCP compounds. As shown in Fig. 4C, the treatment of H2O2 (600 µM) in HUVECs caused prominent collapse of MMP from ~91.7% (DMSO control) to 68.0%, while treatment with 8 µM of TA, PG, TB or PG1 could greatly diminish the loss of MMP induced by H2O2 to resume a maximum value of 85.6%. These results demonstrated that the 4 CMC-identified compounds of PCP might alleviate H2O2-induced oxidative stress damage via maintaining mitochondrial stability. In order to investigate whether the tested compounds in current study can reduce the concentration of externally added hydrogen peroxide, we have performed a 26

determination of TA, one of the test compounds with the best autophagy effect, by using UHPLC-DAD-QTOF-MS/MS after a 12 h interaction of TA and H2O2 in PBS at 37 ℃. The result showed that there is no decrease in peak area of the TA with H2O2 group as compared to TA alone group (supplementary Fig. 2 A, B and C). Furthermore, the pre-treatment of TA also improved the cell viability of HUVECs as TA was removed and only H2O2 was added, which is consistent with the result of the co-treatment of TA with H2O2. Taken together, these data suggested that TA inhibit H2O2 induced cell death in HUVECs through decreasing the generated toxic endogenous ROS level but not the direct interaction with H2O2 (supplementary Fig. 2D and E). 3.5. The 4 CMC-identified compounds induce autophagy via AMPK signaling, but independent to mTOR AMP-activated protein kinase (AMPK) plays a key role in the regulation of energy homeostasis [53]. AMPK is a heterotrimeric complex composed of a catalytic α subunit and regulatory β and γ subunits [54], of which p-AMPKα1 plays an central key importance in autophagy induction [55, 56]. As shown in Fig. 5A, TA, PG, TB and PG1 (8 µΜ) elevated the protein expression of p-AMPKα1 with concomitant up-regulation of LC-3 II conversion compared to DMSO control group, whereas the activator of AMPK, AICAR (500 µM), was used as a positive control. Another key regulator in autophagy induction, Beclin-1 is important for localization of autophagic proteins to a pre-autophagosomal structure [57]. Here, we demonstrated that TA, PG, TB and PG1 (8 µΜ) also elevated the protein expression of Beclin-1 in comparison with DMSO control group (Fig. 5A). 27

The classical pathway that regulates autophagy involves the serine/threonine kinase, mammalian target of rapamycin (mTOR) [56, 58]. Autophagy is negatively regulated by mTOR, whose activity can be inhibited by rapamycin, a lipophilic macrolide antibiotic that is a well-established inducer of autophagy [59]. Thus, it was presumably hypothesized that TA, PG, TB and PG1 might also inhibit the expression of p-mTOR to induce autophagy. However, as shown in Fig. 5B, TA, PG, TB or PG1 did not suppress the expression level of p-mTOR. In contrast, the p-mTOR expression was reduced in response to Rapa (Rapamycin, 0.3 µM) treatment, a classic inhibitor of mTOR [60]. To further confirm this result, the direct downstream effector of mTOR, P70S6K, was also verified. As shown in Fig. 5B, the protein expression of p-P70S6K induced by TA, PG, TB and PG1 (8 µM) was also enhanced, when compared to the level of p-P70S6K after treatment of Rapa (0.3 µM). All the above data demonstrated that TA, PG, TB and PG1 increased the protein expression of mTOR rather than inhibiting mTOR. As it was reported that p70S6K could also induce autophagy [61, 62], our data suggested that the 4 CMC-identified compounds from PCP may induce autophagy in HUVECs via elevation of p-P70S6K, which is deviated from the classical mTOR inhibition pathway in autophagy activation.

By using ultrahigh-performance liquid chromatography-diode array detector-time of flight-mass spectrometry (UHPLC-DAD-TOF-MS), the peak area of TA at 254 nm has indicated that TA constituted 59.77% of total PCP extract (Fig. 5C), suggesting that TA is the major active component in PCP. With similar potency and mechanistic

28

action in autophagy induction, therefore TA was selected for our further mechanistic study for its autophagy and anti-oxidant effect. PI3K/Akt/mTOR signaling pathway is another important machinery in autophagy induction [63]. To investigate whether TA might induce autophagy via PI3K/Akt/mTOR/P70S6K signaling, inhibitors of PI3K, Akt and P70S6K were applied together with the treatment of TA in HUVECs. LY294002 (LY-294) was shown to act in vivo as a highly selective inhibitor of phosphatidylinositol 3 (PI3) kinase, but did not inhibit other lipid and protein kinases such as PI4 kinase, PKC, MAP kinase or c-Src [64]. As shown in Fig. 5D, although 1h pretreatment with LY294 counteracted the elevated protein expression of PI3K induced by TA (8 µM) alone, the LC3 II expression induced by TA alone did not decrease with the presence of LY294. MK-2206 (MK22) acts as an allosteric AKT inhibitor. It is a highly selective inhibitor of all 3 Akt isoforms Akt1, Akt2, and Akt3 [65]. As shown in Fig. 5D (middle panel), although pretreatment of TA (8 µM) in the presence of MK22 inhibitor abolished the protein expression of p-Akt induced by TA, the LC3 II expression induced by TA plus MK22 was unexpectedly up-regulated compared to TA alone.

We then further investigated the effect of P70S6K inhibitor in TA treatment. LY2584702 (LY258) is a selective, ATP-competitive p70S6K inhibitor [66]. As shown in Fig. 5D (right panel), although the TA (8 µM) plus LY258 counteracted the elevated protein expression of p-P70S6K which was induced by TA alone, the LC3 II expression induced by TA was not altered by the addition of LY258. All the above data demonstrated that mediators of PI3K, Akt and P70S6K do not participate in

29

TA-induced autophagy signaling in HUVECs, in other word, TA induces autophagy in HUVECs via mTOR-independent pathway. 3.6. TA induces autophagy via Ca2+-AMPK signaling AMP-activated protein kinase (AMPK) regulates mammalian autophagy via suppression of mTOR activity [67]. Recent studies have addressed 2 new mechanisms for the control of mammalian autophagy by the AMPK [68, 69], including AMPK/ULK1/autophagy signaling and AMPK/ Beclin-1/autophagy signaling pathway.

To confirm the role of AMPK in TA-induced autophagy, we further

verified the alteration of p-AMPK expression via increasing the dosage of TA treatment in HUVECs. Apparently, the protein expression of p-AMPK in HUVECs were dose-dependently elevated by TA (Fig. 6A), and the positive control AICAR (a cell permeable activator of AMPK).

Compound C (CC,), also known as dorsomorphin, has been described as a pharmacological AMPK inhibitor that efficiently blocks metabolic actions of AMPK [70]. Thus, CC (0.5 µM) was applied to study the mechanistic action of TA in HUVECs. As shown in Fig. 6B, CC (0.5 µM) significantly suppressed the TA-induced phosphorylation of AMPK and attenuated the conversion of LC3 I to LC3II induced by TA. Concomitantly, CC (1.25 µM) could also significantly inhibit the TA-induced GFP-LC3 puncta formation when compared with TA treatment alone in stable GFP-LC3 U87 cells (Supplementary Fig. 3A). The result demonstrated that TA induces autophagy via AMPK-dependent signaling pathway in HUVECs.

30

Ca2+/ CaMKK/ AMPK signaling is a major upstream pathway that activates AMPK phosphorylation [71]. BAPTA/AM (BM), a selective chelator of intracellular Ca2+ stores [72], was therefore applied to verify whether TA-induced autophagy in HUVECs occurs via the elevation of cytoplasmic Ca2+ concentration. As shown in Fig. 6C, BM (2 µM) significantly suppressed the TA-induced phosphorylation of AMPK, whereas BM also counteracted the conversion of LC3-I to LC3-II elicited by TA. Concomitantly, BM could also significantly inhibit the identified PCP compounds (TA, TB, PG and PG1)-induced GFP-LC3 puncta formation in stable GFP-LC3 U87 cells (Supplementary Fig. 3B). The result demonstrated that TA activates autophagy via a Ca2+-AMPK-dependent signaling pathway in HUVECs. To address whether the 4 CMC-identified compounds of PCP could increase the cytoplasmic Ca2+ concentration in HUVECs, we therefore applied FLIPR Tetra High-Throughput Cellular Screening System to monitor dynamic calcium alteration using FLIPR Calcium 6 Assay Kit. As shown in Fig. 6D, Ca2+ dynamic change in HUVECs was found upon the treatment of TA, PG, TB or PG1. The extent of the calcium dynamic change of the 4 compounds was ranged from the highest to lowest response as TA > TB > PG > PG1, which was consistent with their ability to induce autophagy. Notably, methyl pyruvate (MP), a stimulator of ATP production [73], could counteract the elevated GFP-LC3 puncta formation in stable GFP-LC3 U87 cells induced by TA, TB, PG and PG1, while an inhibitor of Ca2+/Calmodulin-dependent protein kinase kinase (CaMKK), STO-609 (STO) could not (Supplementary Fig. 3B). These results are consistent with the machinery of autophagy induction by TA in HUVECs, and the other 3 CMC-identified compounds of PCP showed similar autophagic effect as TA.

31

In conclusion, the activation of AMPK is crucial for TA-mediated autophagy induction in HUVECs. Moreover, a chelator of intracellular Ca2+ and a stimulator of ATP generation could counteract TA-induced autophagy in HUVECs. Thus, it was speculated that TA elicits an increase of cytosolic Ca2+ to induce AMPK activation related to AMP:ATP ratio, rather than CaMKK, then motivate autophagosome formation-related modulators, such as Beclin-1 and Atg7, to convert LC3-I to LC3-II, consequently resulting in fusion of autophagosomes with lysosomes to induce autophagy in HUVECs (Fig. 6E). 3.7. The anti-oxidative effect of TA in HUVECs ROS-induced oxidative stress is strongly related to the occurrence and progression of various degenerative diseases, such as atherosclerosis and diabetes [74, 75]. The extraneous challenge of H2O2 could induce intracellular ROS elevation [76, 77]. Thus, we applied ectogenic H2O2 to mimic the oxidative stress in atherosclerosis disease in vitro. Consistent with the results of the antioxidant effect of TA in H2O2-induced oxidative stress in HUVECs, TA (4 µM) and the positive control, catalase (100 u/mL) could significantly inhibit the H2O2- (400 µM and 600µM) induced elevation of ROS in HUVECs as shown by H2DCFDA assay (Fig. 7A). The result demonstrated that TA exhibited the potent anti-oxidative effect as catalase in reducing H2O2-induced oxidative stress of HUVECs by alleviating ROS production. We further applied compound C (CC) to investigate the anti-oxidative role of TA-induced autophagy in H2O2-induced oxidative injury of HUVECs. As shown in Fig. 7B, TA (8 µM) efficiently reduced H2O2- (600 µM) induced oxidative stress in HUVECs as 32

determined by the increase of cell viability. Moreover, the protective effect of TA was diminished in H2O2-induced HUVECs when the TA-induced autophagy was suppressed by the addition of compound C. These results demonstrated that inhibition of autophagy decreased the protective effect of TA in H2O2-induced HUVECs. Furthermore, as Fig. 3D revealed that Atg-7 gene deficiency could eliminate autophagy elicited by the 4 CMC-identified compounds of PCP. As shown in Fig. 7C, while the immunoblotting assay demonstrated that the Atg7 siRNA transfection significantly inhibited the gene expression of Atg7 in HUVECs, siRNA Atg7 greatly decreased the anti-oxidant effect of TA (8 µM) in H2O2-induced in HUVECs. The results confirmed that TA-induced autophagy plays a protective role in H2O2-induced oxidative stress in HUVECs.

In addition, the production of ROS would cause a transient increase of mitochondrial membrane potential (MMP) followed by a drop of MMP [78]. Here, we therefore investigated if TA-induced autophagy could exhibit its anti-oxidative effect via restoring MMP to alleviate the generation of ROS upon H2O2 stimulation. Apparently, H2O2 (400 µM) induced a decline of MMP in HUVECs as shown by the lower intensity of red JC-1 fluorescence signal which was accompanied with the higher intensity of green fluorescence signal (Fig. 7D). Meanwhile, TA (8 µM) efficiently resumed H2O2-elicited collapse of MMP with increased intensity of red fluorescence signal with the decrease of green fluorescence signal (Fig. 7D). Of note, addition of CC abolished the TA-induced recovery of MMP in HUVECs (Fig. 7D).

33

These results demonstrated that TA-induced autophagy exhibits its antioxidant effect in H2O2- HUVECs via restoration of MMP. 3.8. The anti-oxidative effect of TA in ApoE-KO mice oxLDL is a common adverse factor contributed to human atherosclerotic lesion with hyperlipidemia [79], we therefore investigated if TA could also ameliorate the elevated oxidative stress in hyperlipidemia conditions. As shown in Fig. 8A, TA (8 µM) could significantly restore oxLDL-induced cell death and improve cell viability by exhibiting a potent protective effect against oxidative stress in hyperlipidemia condition.

ApoE-KO mice have been widely applied in hyperlipidemia-, hypercholesteremiaand atherosclerosis-related research [80]. The elevated apolipoproteins in ApoE-KO mice have entered into the circulation, endocytosed and accumulated in the aortic vessels with oxidation, the initiation and progress of atherosclerosis occurred. Since atherosclerosis-related fatty streaks could be found in the proximal aorta of 3-month old ApoE-KO mice [81]. In our in vivo studies, we therefore utilized the 2-month old ApoE-KO mice with C57BL/6J mice working as the control group, for the treatment of TA (0.1 mg/kg per day). TA was applied via intraperitoneal injection for one month to evaluate its therapeutic effect in the early stage of atherosclerosis. As shown in Fig. 8B, while the content of ROS in the aortic arteries of ApoE-KO mice increased when compared to those of wild-type C57BL/6J mice, the administration of TA significantly reduced the ROS content in the aortic arteries of ApoE-KO mice. The results

34

demonstrated that TA possessed a potent protective effect in anti-oxidation during the progress of atherosclerosis in aortic artery of ApoE-KO mice.

IL-1β is a critical inflammatory factor in the pathogenesis of atherosclerosis [82, 83], which is recently reported to correlate with the oxidative-stress induced inflammasome activation [13, 84]. Based on the research that autophagy links inflammasome to atherosclerotic progression [13], we proceeded to evaluate the effect of TA on IL-1β expression in the aortic artery of ApoE-KO mice. As observed in Fig. 8C, immunohistochemistry revealed that the administration of TA (0.1 mg/kg per day) could decrease IL-1β expression in the aortic artery of ApoE-KO mice, which confirmed the potential protective role of TA in anti-inflammation. Besides, real-time quantitative PCR confirmed that the IL-1β mRNA level in the aortic artery of ApoE-KO mice was increased significantly, whereas the administration of TA alleviated the transcription level of IL-1β mRNA (Fig. 8D). In addition, NLRP3 was recently reported to take part in the oxidative-stress induced inflammasome formation and thus induced IL-1β activation [85]. To investigate the mechanism of TA in IL-1β expression, we applied the immunofluorescent double labelled staining method with the use of NLRP3 and IL-1β antibodies to assess the expression of these two modulators. As shown in Fig. 8E, red fluorescence NLRP3 expression was obviously increased in combination with elevated green fluorescence IL-1β expression in the arcus aortae vessels, while the administration of TA alleviated the elevation of NLRP3 and IL-1β expression. The result suggested that TA-mediated reduction of IL-1β expression in ApoE-KO mice aortic artery might occur via NLRP3 signaling. 35

There are 2 form of IL-1β, precursor (pro-IL-1β) and mature form (cleaved-IL-1β). The mature-form of IL-1β is reported to be cleaved by the inflammasome-activated caspase-1 and acts as a fundamental factor in the initiation and progress of atherosclerosis [82, 86]. In addition, NLRP3 is the most reported inflammasome regulator in atherosclerosis pathogenesis [84]. Thus, it is important to investigate the variation of active IL-1β expression (mature form) in the aortic arteries of ApoeE-KO mice treated by TA. As shown in Fig. 8F, although the cleaved-IL-1β expression in ApoE-KO mice aortic arteries increased obviously, it was significantly alleviated in mice administrated with TA. The effect of TA in the active IL-1β expression in ApoE-KO mice aortic arteries was also accompanied with the reduction of NLRP3 and precursor of IL-1β. Therefore, it is for the first time that the active compound, TA from PCP, can reduce the oxidative stress level in aortic artery of ApoE-KO mice. The expression of pro- and cleaved-IL-1β in the aortic artery of ApoE-KO mice was also alleviated at the transcription and post-transcription levels by the administration of TA, which

might

be

due

to

the

reduction

of

oxidative-stress

induced

inflammasome-related NLRP3 in the aortic arteries of ApoE-KO mice.

4. Discussion Autophagy has been shown to have a protective effect against the pathogenesis of cardiovascular diseases [87], which have been considered as the major cause of mortality in developed countries [88]. Razani B unraveled that plaques besides classic inflammasome were increased in ATG5-mφKO mice, suggesting autophagy 36

deficiency in atherogenesis partially via oxidative stress and inflammasome activation [13]. Although the detailed mechanism has not been investigated, Martinet W pointed out that macrophage autophagy induction via mTOR-dependent pathways is responsible for stabilizing vulnerable plaque in advanced atherosclerosis [89]. It is also conceivable that endothelial cell dysfunction is the major initiation of atherosclerosis [90, 91]. Endothelial protection via autophagic induction might be promising in atherogenesis [92, 93]. Thus, we investigated if PCP could exhibit a protective effect against atherosclerosis-related inflammatory damage by adopting the H2O2-induced oxidative stress injury in HUVECs.

TCM possessed multiple natural chemical compounds with reported clinical applications, such as ephedrine in anesthesia [94], Artemisinin in Plasmodium falciparum malaria [95] and Curcumin in cancers [96]. However, the identification and isolation of single active component from TCMs is complicated and tedious. In our current study, we have applied CMC [24, 97] in combination with UHPLC-TOF-MS [98] for the screening of effective components from PCP for the accurate identification and isolation of novel autophagic compounds for anti-oxidation in ApoE-KO mice.

Oxidative stress-induced damage has been proposed as a major risk for cardiovascular disease, and increased vessel wall oxidative stress is a pathogenic feature of atherosclerosis and hypertension [46, 99, 100]. Reactive oxygen species (ROS), a by-product of mitochondrial oxidative metabolism, is likely to have a 37

pathogenic role in cardiovascular diseases and other diseases, and is the main source of free radicals in cells which can function as intracellular signal transducers [32, 33, 101, 102]. Thus, ROS is the key index to evaluate the level of oxidative stress in cells or tissues [103]. Severe oxidative stress usually causes the oxidization of cell proteins [104], damages membrane permeability, causes dysfunction of homeostasis and increases death or apoptosis-related stimulators, thus decreasing cell viability [105, 106]. With the addition of compound C, a pharmacological AMPK inhibitor that efficiently blocks metabolic actions of AMPK [70], and Atg7 siRNA, our current study has confirmed that the autophagy induced by TA plays a key role in its antioxidant effect in HUVECs via an AMPK-dependent manner.

Mitochondria are the major organelles in cells for cell metabolism and homeostasis, and are the source of cytoplasmic ROS generation [107, 108]. Under basal or pathological conditions, electron leakage for ROS production is primarily mediated by the electron transport chain and proton motive force consisting of a membrane potential (∆Ψ) and a proton gradient (∆pH) [108]. Thus, we hypothesized that TA-induced autophagy might act on the recovery of the collapse of MMP to reduce the production of ROS in mitochondria of HUVECs. Our preliminary result demonstrated for the first time that autophagy-induced recovery of MMP might play a role on anti-oxidation in HUVECs, although further investigation work is needed to clarify if it is the ROS that cause the MMP collapse or is the MMP collapse that causes ROS.

38

Interestingly, ROS released from damaged mitochondria has been reported to induce autophagy [109]. Of note, our current study also indicated that H2O2 treatment could significantly increase LC3-II expression (Supplementary Fig. 4). Although ROS can act as the intracellular key hub molecule to activate autophagy for removal of damaged mitochondria during the early stage of oxidative stress, the acute and persisting stimulation would seriously damage the organelles and eventually lead to cell death by leakage of degradative enzyme from lysosome, as well as accumulation of LC3-II autophagic marker protein [110-112]. Moreover, the defective of autophagic genes lead to an increased production of ROS and accumulation of damaged organelles and DNA [113]. Here, we demonstrated that both pre-treatment and the co-treatment of TA could improve the cell viability of HUVECs by clearing the damaged mitochondria and its released intracellular ROS level. As shown in Supplementary Fig. 4, the expression level of LC3-II in low concentrations of H2O2-treated HUVECs was significantly increased in the presence of TA, whereas the accumulation of LC3-II in high concentrations of H2O2-treated HUVECs was reduced by TA. This phenomenon could be explained that TA may suppress the H2O2-induced LC3-II expression via decreasing the high intracellular ROS levels and protecting lysosomal normal function. Therefore, the role of TA in the autophagy process modulated by H2O2 with different concentrations is complicated and how TA-induced protective autophagy could override the H2O2-mediated destructive autophagy will be required to clarify in future study.

39

In recent years, NLRP3-related inflammasome is reported to be involved in the inflammation mechanism related to redox injury [4, 5]. New research and literature unveiled that ROS could initiate the NLRP3 (Nod-like receptor protein3) inflammasome and activate caspase-1 to cleave pro-IL-1β into an active mature form which is released via the pores formed by caspase-1-induced Gasdermin D in the cell membrane [6]. IL-1β has also been reported to participate in the development of atherosclerosis. Its inhibitor, canakinumab, a monoclonal antibody, has shown promising results in the reduction of cardiovascular events in a randomized, double-blind preclinical trial involving 10061 patients (CANTOS)[8].

With the novel discovery of several autophagic activator from PCP for their anti-oxidative role in H2O2-induced oxidative stress injury in HUVECs, it is of interest to evaluate the efficacy of TA in modulating the level of IL-1β in the aortic artery vessel of ApoE-KO mice. Our results have demonstrated for the first time that the expression of pro- and cleaved-IL-1β in the aortic artery of ApoE-KO mice was alleviated at the transcription and post-transcription levels by the administration of TA, which

might

be

due

to

the

reduction

of

oxidative-stress

induced

inflammasome-related NLRP3 in the aortic arteries in ApoE-KO mice. However, further study on the specific effect of TA in atherosclerosis is needed.

Taken together, the ellagitannin flavonoids derived from PCP (especially TA) were reported to induce autophagy and possess an antioxidative effect through autophagy via a Ca2+/AMPK-dependent, but mTOR-independent signaling pathway. 40

TA could also alleviate the oxidative level in the aortic wall, ROS-induced NLRP3 and IL-1β protein activation, which might ultimately delay the progress of atherosclerosis in ApoE KO mice. Therefore, the current study provides important evidence that autophagy plays an important role in fighting the diseases which are triggered by oxidative stress and identifying potential compounds with autophagic effects which are essential to protect endothelial cells against redox injury, especially in the field of atherosclerosis-related cardiovascular diseases.

Acknowledgments This study was supported by the Science and Technology Development Fund of Macao, FDCT (Project code: 0022/2018/A1; 0048/2018/A2), Science & Technology Department of Sichuan Province Funded Project (Grant code: 2018JY0400 and 2018JY0474). The National Natural Science Foundation of China (Grant No. 81903829). Health Planning Committee of Sichuan Province Funded Key Project (Grant code: 18ZD019), Luzhou-Southwest Medical University Allied Funded Project (Grant code: 2017LZXNYD-J19 and 2018LZXNYD-YL05), Affiliated Hospital of Southwest Medical University Cultivated Key Project (Grant code: 17124), Collaborative Innovation Center for Prevention and Treatment of Cardiovascular Disease of Sichuan Province Funded Project (Grant code: xtcx2019-20) and

Key

Laboratory of Medical Electrophysiology of Ministry of Education Funded Project (Grant code: KeyME-2018-04). Dr. Xiaolei Sun is supported by the State Scholarship Fund of China Scholarship Council (CSC ID 201808515133). 41

Conflict of interest The authors declared no conflict of interest.

Abbreviations ApoE-KO: Apoe gene-knock out BM: BAPTA/AM CC: Compoud C CMC: Cell membrane chromatography DMSO: Dimethyl sulfoxide DMEM: Dulbecco's Modified Eagle Medium EF: Ethylethanoate fraction Gal: Gallic acid GFP: Green fluorescent protein HHDP: Hexahydroxydiphenoyl H2O2: Peroxide hydrogen solution HUVECs: Human Umbilical Vein Endothelial Cells IC50: Half maximal (50%) inhibitory concentration IHC: Immunohistochemistry IL-1β: Interleukin-1β LY-294: LY294002 LY258: LY2584702 MP: methyl pyruvate 42

MK22: MK-2206 MMP: Mitochondrial membrane potential MTT: 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide NF: n-Butanol fraction NLRP3: Nod-like receptor protein3 PCP: Penthorum chinense Pursh PG: Pinocembrin-7-O-[3''-O-galloyl-4'',6''-HHDP]-glucoside PG1: Pinocembrin-7-O-[4'',6''-HHDP]-glucoside Pin: Pinocembrin Que: Quercetin Rap: Rapamycin ROS: reactive oxygen species RT-PCR: Real time polymerase chain reaction STO: STO-609 TA: Pinocembrin dihydrochalcone-7-O-[3''-O-galloyl-4'',6''-HHDP]-glucoside TB: Pinocembrin dihydrochalcone-7-O-[4'',6''-HHDP]-glucoside TCMs: Traditional Chinese medicines TEE: Total ethanol extract UHPLC-TOF-MS: Ultra High Performance Liquid Chromatography- Time-Of-Flight Mass Spectrometry WF: Water fraction

References 43

[1] D. Mozaffarian, E.J. Benjamin, A.S. Go, D.K. Arnett, M.J. Blaha, M. Cushman, S.R. Das, S. de Ferranti, J.-P. Després, H.J. Fullerton, Heart disease and stroke statistics—2016 update: a report from the American Heart Association, Circulation 133(4) (2016) e38-e360. [2] E. Harja, D.-x. Bu, B.I. Hudson, J.S. Chang, X. Shen, K. Hallam, A.Z. Kalea, Y. Lu, R.H. Rosario, S. Oruganti, Vascular and inflammatory stresses mediate atherosclerosis via RAGE and its ligands in apoE–/–mice, The Journal of clinical investigation 118(1) (2008) 183-194. [3] I.M. Fearon, S.P. Faux, Oxidative stress and cardiovascular disease: novel tools give (free) radical insight, Journal of molecular and cellular cardiology 47(3) (2009) 372-381. [4] D. De Nardo, E. Latz, NLRP3 inflammasomes link inflammation and metabolic disease, Trends in immunology 32(8) (2011) 373-379. [5] W. Liu, Y. Yin, Z. Zhou, M. He, Y. Dai, OxLDL-induced IL-1beta secretion promoting foam cells formation was mainly via CD36 mediated ROS production leading to NLRP3 inflammasome activation, Inflammation Research 63(1) (2014) 33-43. [6] W.-t. He, H. Wan, L. Hu, P. Chen, X. Wang, Z. Huang, Z.-H. Yang, C.-Q. Zhong, J. Han, Gasdermin D is an executor of pyroptosis and required for interleukin-1β secretion, Cell research 25(12) (2015) 1285. [7] X. Sun, X. Jiao, Y. Ma, Y. Liu, L. Zhang, Y. He, Y. Chen, Trimethylamine N-oxide induces inflammation and endothelial dysfunction in human umbilical vein endothelial cells via activating ROS-TXNIP-NLRP3 inflammasome, Biochemical and biophysical research communications 481(1-2) (2016) 63-70. [8] P.M. Ridker, B.M. Everett, T. Thuren, J.G. MacFadyen, W.H. Chang, C. Ballantyne, F. Fonseca, J. Nicolau, W. Koenig, S.D. Anker, Antiinflammatory therapy with canakinumab for atherosclerotic disease, New England Journal of Medicine 377(12) (2017) 1119-1131. [9] I. Perrotta, The use of electron microscopy for the detection of autophagy in human atherosclerosis, Micron 50 (2013) 7-13. [10] X. Jin, M. Chen, L. Yi, H. Chang, T. Zhang, L. Wang, W. Ma, X. Peng, Y. Zhou, M. Mi, Delphinidin℃3℃glucoside protects human umbilical vein endothelial cells against oxidized low℃density lipoprotein℃induced injury by autophagy upregulation via the AMPK/SIRT1 signaling pathway, Molecular nutrition & food research 58(10) (2014) 1941-1951.

44

[11] Y. Xie, S.-J. You, Y.-L. Zhang, Q. Han, Y.-J. Cao, X.-S. Xu, Y.-P. Yang, J. Li, C.-F. Liu, Protective role of autophagy in AGE-induced early injury of human vascular endothelial cells, Molecular medicine reports 4(3) (2011) 459-464. [12] J.K. Salabei, A. Balakumaran, J.C. Frey, P.J. Boor, M. Treinen-Moslen, D.J. Conklin, Verapamil stereoisomers induce antiproliferative effects in vascular smooth muscle cells via autophagy, Toxicology and applied pharmacology 262(3) (2012) 265-272. [13] B. Razani, C. Feng, T. Coleman, R. Emanuel, H. Wen, S. Hwang, J.P. Ting, H.W. Virgin, M.B. Kastan, C.F. Semenkovich, Autophagy links inflammasomes to atherosclerotic progression, Cell metabolism 15(4) (2012) 534-544. [14] X. Liao, J.C. Sluimer, Y. Wang, M. Subramanian, K. Brown, J.S. Pattison, J. Robbins, J. Martinez, I. Tabas, Macrophage autophagy plays a protective role in advanced atherosclerosis, Cell metabolism 15(4) (2012) 545-553. [15] Z. Ding, S. Liu, X. Wang, M. Khaidakov, Y. Dai, J.L. Mehta, Oxidant stress in mitochondrial DNA damage, autophagy and inflammation in atherosclerosis, Scientific reports 3 (2013) 1077. [16] S.K. Hur, S.H. Park, G.T. Oh, The Role of Autophagy in the Pathogenesis of Atherosclerosis, Journal of Lipid and Atherosclerosis 5(1) (2016) 1-10. [17] Y. Luo, S. Lu, P. Zhou, Q.-D. Ai, G.-B. Sun, X.-B. Sun, Autophagy: an exposing therapeutic target in atherosclerosis, Journal of cardiovascular pharmacology 67(3) (2016) 266-274. [18] T. Zhang, Y.M. Chen, G.L. Zhang, Novel neolignan from Penthorum chinense, Journal of integrative plant biology 49(11) (2007) 1611-1614. [19] C.-g. Feng, H.-w. Wang, Q.-s. Ren, Analysis of the volatile components of Penthorum chinese by gas chromatography-mass spectrometry, CHINESE PHARMACEUTICAL JOURNAL-BEIJING- 38(5) (2003) 340-341. [20] X.-Y. Luo, H. Ikeda, Effects of four rice herbicides on seed germination and seedling growth of a threatened vascular plant Penthorum chinense Pursh, Bulletin of environmental contamination and toxicology 75(2) (2005) 382-389. [21] L.-Q. Wang, J. Yang, E. Deng, G.-B. Wang, Z.-S. Peng, Optimizing the shoot proliferation protocol of Penthorum chinense by axillary buds, Biotechnology letters 30(12) (2008) 2199-2203. [22] Q. Lu, M.-H. Jiang, J.-G. Jiang, R.-F. Zhang, M.-W. Zhang, Isolation and identification of compounds from Penthorum chinense Pursh with antioxidant and 45

antihepatocarcinoma properties, Journal of agricultural and food chemistry 60(44) (2012) 11097-11103. [23] H.-W. Wang, Y.-Q. Liu, C.-G. Feng, Isolation and identification of a novel flavonoid from Penthorum chinense P. Note, Journal of Asian natural products research 8(8) (2006) 757-761. [24] Y. Bu, X. He, Q. Hu, C. Wang, X. Xie, S. Wang, A novel cell membrane affinity sample pretreatment technique for recognition and preconcentration of active components from traditional Chinese medicine, Sci Rep 7(1) (2017) 3569. [25] L. Feng, Y.-h. Xu, S.-s. Wang, W. Au-Yeung, Z.-g. Zheng, Q. Zhu, P. Xiang, Competitive binding between 4, 4′-diphenylmethane-bis (methyl) carbamate and RAGE ligand MG-H1 on human umbilical vein endothelial cell by cell membrane chromatography, Journal of Chromatography B 881 (2012) 55-62. [26] T.L. Riss, R.A. Moravec, A.L. Niles, S. Duellman, H.A. Benink, T.J. Worzella, L. Minor, Cell viability assays, (2016). [27] D.J. Klionsky, K. Abdelmohsen, A. Abe, M.J. Abedin, H. Abeliovich, A. Acevedo Arozena, H. Adachi, C.M. Adams, P.D. Adams, K. Adeli, Guidelines for the use and interpretation of assays for monitoring autophagy, Autophagy 12(1) (2016) 1-222. [28] A. Cossarizza, M. Baccaranicontri, G. Kalashnikova, C. Franceschi, A new method for the cytofluorometric analysis of mitochondrial membrane potential using the J-aggregate forming lipophilic cation 5, 5′, 6, 6′-tetrachloro-1, 1′, 3, 3′-tetraethylbenzimidazolcarbocyanine iodide (JC-1), Biochemical and biophysical research communications 197(1) (1993) 40-45. [29] H. Ikeda, K. Itoh, Germination and water dispersal of seeds from a threatened plant species Penthorum chinense, Ecological Research 16(1) (2001) 99-106. [30] T. Mahesh, V.P. Menon, Quercetin allievates oxidative stress in streptozotocin℃ induced diabetic rats, Phytotherapy Research 18(2) (2004) 123-127. [31] S. Lavandero, M. Chiong, B.A. Rothermel, J.A. Hill, Autophagy in cardiovascular biology, The Journal of clinical investigation 125(1) (2015) 55-64. [32] K.S. Kim, C.G. Song, P.M. Kang, Targeting Oxidative Stress Using Nanoparticles as a Theranostic Strategy for Cardiovascular Diseases, Antioxidants and Redox Signaling (ja) (2017). [33] J.F. Passos, T. Von Zglinicki, Oxygen free radicals in cell senescence: are they signal transducers?, Free radical research 40(12) (2006) 1277-1283.

46

[34] W. Guo, Y. Jiang, X. Chen, P. Yu, M. Wang, X. Wu, D. Zhang, Identification and quantitation of major phenolic compounds from Penthorum chinense pursh. by HPLC with tandem mass spectrometry and HPLC with diode array detection, Journal of separation science 38(16) (2015) 2789-2796. [35] N. Mizushima, T. Yoshimori, How to interpret LC3 immunoblotting, Autophagy 3(6) (2007) 542-545. [36] I. Tanida, N. Minematsu-Ikeguchi, T. Ueno, E. Kominami, Lysosomal turnover, but not a cellular level, of endogenous LC3 is a marker for autophagy, Autophagy 1(2) (2005) 84-91. [37] G. Juhász, B. Érdi, M. Sass, T.P. Neufeld, Atg7-dependent autophagy promotes neuronal health, stress tolerance, and longevity but is dispensable for metamorphosis in Drosophila, Genes & development 21(23) (2007) 3061-3066. [38] Y.-h. Shang, Y. Liu, L.-x. Peng, C. LIU, Determination of quercetin content in Penthorum chinese Pursh. by RP-HPLC, West China Journal of Pharmaceutical Sciences 20(6) (2005) 559. [39] Y. Yuan, X. Hu, X. Ou, Comparative study on prevention effects of Penthorum chinense Pursh and quercetin on alcoholic fatty liver, Chin. Pharm. J 46 (2011) 1635-1638. [40] B.-t. YU, X.-c. WU, Q. LIAO, Study on the extraction technology of gallic acid from Penthorum chinense by orthogonal-test method [J], West China Journal of Pharmaceutical Sciences 6 (2011) 023. [41] S. Kapoor, Comment on isolation and identification of compounds from Penthorum chinense Pursh with antioxidant and antihepatocarcinoma properties: pinocembrin and its rapidly emerging neuroprotective effects, Journal of agricultural and food chemistry 61(6) (2013) 1416-1416. [42] K. Wang, R. Liu, J. Li, J. Mao, Y. Lei, J. Wu, J. Zeng, T. Zhang, H. Wu, L. Chen, Quercetin induces protective autophagy in gastric cancer cells: involvement of Akt-mTOR-and hypoxia-induced factor 1α-mediated signaling, Autophagy 7(9) (2011) 966-978. [43] F. Pietrocola, G. Mariño, D. Lissa, E. Vacchelli, S.A. Malik, M. Niso-Santano, N. Zamzami, L. Galluzzi, M.C. Maiuri, G. Kroemer, Pro-autophagic polyphenols reduce the acetylation of cytoplasmic proteins, Cell cycle 11(20) (2012) 3851-3860. [44] G. Zhao, W. Zhang, L. Li, S. Wu, G. Du, Pinocembrin protects the brain against ischemia-reperfusion injury and reverses the autophagy dysfunction in the penumbra area, Molecules 19(10) (2014) 15786-15798. 47

[45] J.-H. Moon, S.K. Eo, J.H. Lee, S.-Y. Park, Quercetin-induced autophagy flux enhances TRAIL-mediated tumor cell death, Oncology reports 34(1) (2015) 375-381. [46] U. Forstermann, N. Xia, H. Li, Roles of Vascular Oxidative Stress and Nitric Oxide in the Pathogenesis of Atherosclerosis, Circulation research 120(4) (2017) 713-735. [47] C.-L. Kao, L.-K. Chen, Y.-L. Chang, M.-C. Yung, C.-C. Hsu, Y.-C. Chen, W.-L. Lo, S.-J. Chen, H.-H. Ku, S.-J. Hwang, Resveratrol protects human endothelium from H2O2-induced oxidative stress and senescence via SirT1 activation, Journal of atherosclerosis and thrombosis 17(9) (2010) 970-979. [48] J.M. Wood, H. Decker, H. Hartmann, B. Chavan, H. Rokos, J. Spencer, S. Hasse, M.J. Thornton, M. Shalbaf, R. Paus, Senile hair graying: H2O2-mediated oxidative stress affects human hair color by blunting methionine sulfoxide repair, The FASEB Journal 23(7) (2009) 2065-2075. [49] B. Chance, G. Williams, The respiratory chain and oxidative phosphorylation, Adv Enzymol Relat Areas Mol Biol 17 (1956) 65-134. [50] P. Mitchell, Coupling of phosphorylation to electron and hydrogen transfer by a chemi-osmotic type of mechanism, Nature 191(4784) (1961) 144-148. [51] L.B. Chen, Mitochondrial membrane potential in living cells, Annual review of cell biology 4(1) (1988) 155-181. [52] D. Qian, Z. Li, Y. Zhang, Y. Huang, Q. Wu, G. Ru, M. Chen, B. Wang, Response of mouse zygotes treated with mild hydrogen peroxide as a model to reveal novel mechanisms of oxidative stress-induced injury in early embryos, Oxidative medicine and cellular longevity 2016 (2016). [53] D.G. Hardie, The AMP-activated protein kinase pathway–new players upstream and downstream, Journal of cell science 117(23) (2004) 5479-5487. [54] D. Carling, The AMP-activated protein kinase cascade–a unifying system for energy control, Trends in biochemical sciences 29(1) (2004) 18-24. [55] S. Obba, Z. Hizir, L. Boyer, D. Selimoglu-Buet, A. Pfeifer, G. Michel, M.-A. Hamouda, D. Gonçalvès, M. Cerezo, S. Marchetti, The PRKAA1/AMPKα1 pathway triggers autophagy during CSF1-induced human monocyte differentiation and is a potential target in CMML, Autophagy 11(7) (2015) 1114-1129. [56] J. Kim, M. Kundu, B. Viollet, K.-L. Guan, AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1, Nature cell biology 13(2) (2011) 132.

48

[57] S. Pattingre, A. Tassa, X. Qu, R. Garuti, X.H. Liang, N. Mizushima, M. Packer, M.D. Schneider, B. Levine, Bcl-2 antiapoptotic proteins inhibit Beclin 1-dependent autophagy, Cell 122(6) (2005) 927-939. [58] D.C. Rubinsztein, J.E. Gestwicki, L.O. Murphy, D.J. Klionsky, Potential therapeutic applications of autophagy, Nature reviews Drug discovery 6(4) (2007) 304. [59] D.D. Sarbassov, S.M. Ali, D.M. Sabatini, Growing roles for the mTOR pathway, Current opinion in cell biology 17(6) (2005) 596-603. [60] S. Sarkar, B. Ravikumar, R. Floto, D. Rubinsztein, Rapamycin and mTOR-independent autophagy inducers ameliorate toxicity of polyglutamine-expanded huntingtin and related proteinopathies, Cell death and differentiation 16(1) (2009) 46. [61] D.J. Klionsky, A.J. Meijer, P. Codogno, T.P. Neufeld, R.C. Scott, Autophagy and p70S6 kinase, Autophagy 1(1) (2005) 59-61. [62] E. Datan, A. Shirazian, S. Benjamin, D. Matassov, A. Tinari, W. Malorni, R.A. Lockshin, A. Garcia-Sastre, Z. Zakeri, mTOR/p70S6K signaling distinguishes routine, maintenance-level autophagy from autophagic cell death during influenza A infection, Virology 452 (2014) 175-190. [63] S. Saiki, Y. Sasazawa, Y. Imamichi, S. Kawajiri, T. Fujimaki, I. Tanida, H. Kobayashi, F. Sato, S. Sato, K.-I. Ishikawa, Caffeine induces apoptosis by enhancement of autophagy via PI3K/Akt/mTOR/p70S6K inhibition, Autophagy 7(2) (2011) 176-187. [64] S.I. Gharbi, M.J. Zvelebil, S.J. Shuttleworth, T. Hancox, N. Saghir, J.F. Timms, M.D. Waterfield, Exploring the specificity of the PI3K family inhibitor LY294002, Biochemical Journal 404(1) (2007) 15-21. [65] H. Hirai, H. Sootome, Y. Nakatsuru, K. Miyama, S. Taguchi, K. Tsujioka, Y. Ueno, H. Hatch, P.K. Majumder, B.-S. Pan, MK-2206, an allosteric Akt inhibitor, enhances antitumor efficacy by standard chemotherapeutic agents or molecular targeted drugs in vitro and in vivo, Molecular cancer therapeutics 9(7) (2010) 1956-1967. [66] S.-H. Yan, N.-W. Zhao, Z.-R. Geng, J.-Y. Shen, F.-M. Liu, D. Yan, J. Zhou, C. Nie, C.-C. Huang, Z.-Y. Fang, Modulations of Keap1-Nrf2 signaling axis by TIIA ameliorated the oxidative stress-induced myocardial apoptosis, Free Radical Biology and Medicine 115 (2018) 191-201. [67] M.M. Mihaylova, R.J. Shaw, The AMPK signalling pathway coordinates cell growth, autophagy and metabolism, Nature cell biology 13(9) (2011) 1016.

49

[68] M. Zhao, D.J. Klionsky, AMPK-dependent phosphorylation of ULK1 induces autophagy, Cell metabolism 13(2) (2011) 119-120. [69] Y. Matsui, H. Takagi, X. Qu, M. Abdellatif, H. Sakoda, T. Asano, B. Levine, J. Sadoshima, Distinct roles of autophagy in the heart during ischemia and reperfusion: roles of AMP-activated protein kinase and Beclin 1 in mediating autophagy, Circulation research 100(6) (2007) 914-922. [70] G. Zhou, R. Myers, Y. Li, Y. Chen, X. Shen, J. Fenyk-Melody, M. Wu, J. Ventre, T. Doebber, N. Fujii, Role of AMP-activated protein kinase in mechanism of metformin action, The Journal of clinical investigation 108(8) (2001) 1167-1174. [71] A. Woods, K. Dickerson, R. Heath, S.-P. Hong, M. Momcilovic, S.R. Johnstone, M. Carlson, D. Carling, Ca2+/calmodulin-dependent protein kinase kinase-β acts upstream of AMP-activated protein kinase in mammalian cells, Cell metabolism 2(1) (2005) 21-33. [72] Q. Tang, M.-W. Jin, J.-Z. Xiang, M.-Q. Dong, H.-Y. Sun, C.-P. Lau, G.-R. Li, The membrane permeable calcium chelator BAPTA-AM directly blocks human ether a-go-go-related gene potassium channels stably expressed in HEK 293 cells, Biochemical pharmacology 74(11) (2007) 1596-1607. [73] L. Vilà, N. Roglans, V. Perna, R.M. Sánchez, M. Vázquez-Carrera, M. Alegret, J.C. Laguna, Liver AMP/ATP ratio and fructokinase expression are related to gender differences in AMPK activity and glucose intolerance in rats ingesting liquid fructose, The Journal of nutritional biochemistry 22(8) (2011) 741-751. [74] H. Kaneto, N. Katakami, M. Matsuhisa, T.-a. Matsuoka, Role of reactive oxygen species in the progression of type 2 diabetes and atherosclerosis, Mediators of inflammation 2010 (2010). [75] G. Kojda, D. Harrison, Interactions between NO and reactive oxygen species: pathophysiological importance in atherosclerosis, hypertension, diabetes and heart failure, Cardiovascular research 43(3) (1999) 652-671. [76] M. Shirai, R. Yamanishi, J.-H. Moon, K. MUROTA, J. TERAO, Effect of quercetin and its conjugated metabolite on the hydrogen peroxide-induced intracellular production of reactive oxygen species in mouse fibroblasts, Bioscience, biotechnology, and biochemistry 66(5) (2002) 1015-1021. [77] C. Osera, M. Amadio, S. Falone, L. Fassina, G. Magenes, F. Amicarelli, G. Ricevuti, S. Govoni, A. Pascale, Pre℃exposure of neuroblastoma cell line to pulsed electromagnetic field prevents H2O2℃induced ROS production by increasing MnSOD activity, Bioelectromagnetics 36(3) (2015) 219-232.

50

[78] P.F. Li, R. Dietz, R. Von Harsdorf, p53 regulates mitochondrial membrane potential through reactive oxygen species and induces cytochrome c℃independent apoptosis blocked by Bcl℃2, The EMBO journal 18(21) (1999) 6027-6036. [79] J. Lu, S. Guo, X. Xue, Q. Chen, J. Ge, Y. Zhuo, H. Zhong, B. Chen, M. Zhao, W. Han, T. Suzuki, M. Zhu, L. Xia, C. Schneider, T.S. Blackwell, N.A. Porter, L. Zheng, S. Tsimikas, H. Yin, Identification of a novel series of anti-inflammatory and anti-oxidative phospholipid oxidation products containing the cyclopentenone moiety in vitro and in vivo: Implication in atherosclerosis, The Journal of biological chemistry 292(13) (2017) 5378-5391. [80] J. Jawien, P. Nastalek, R. Korbut, Mouse models of experimental atherosclerosis, Journal of Physiology and Pharmacology 55(3) (2004) 503-517. [81] T.J. Laboratory, B6.129P2-Apoetm1Unc/J, https://www.jax.org/strain/002052. (Accessed 02.05.2018 2018).

2018.

[82] H. Kirii, T. Niwa, Y. Yamada, H. Wada, K. Saito, Y. Iwakura, M. Asano, H. Moriwaki, M. Seishima, Lack of interleukin-1β decreases the severity of atherosclerosis in ApoE-deficient mice, Arteriosclerosis, thrombosis, and vascular biology 23(4) (2003) 656-660. [83] F.J. Sheedy, K.J. Moore, IL-1 signaling in atherosclerosis: sibling rivalry, Nature immunology 14(10) (2013) 1030. [84] P. Duewell, H. Kono, K.J. Rayner, C.M. Sirois, G. Vladimer, F.G. Bauernfeind, G.S. Abela, L. Franchi, G. Nunez, M. Schnurr, NLRP3 inflammasomes are required for atherogenesis and activated by cholesterol crystals, Nature 464(7293) (2010) 1357. [85] S. Koka, M. Xia, Y. Chen, O.M. Bhat, X. Yuan, K.M. Boini, P.L. Li, Endothelial NLRP3 inflammasome activation and arterial neointima formation associated with acid sphingomyelinase during hypercholesterolemia, Redox biology 13 (2017) 336-344. [86] L. Agostini, F. Martinon, K. Burns, M.F. McDermott, P.N. Hawkins, J. Tschopp, NALP3 forms an IL-1β-processing inflammasome with increased activity in Muckle-Wells autoinflammatory disorder, Immunity 20(3) (2004) 319-325. [87] J.M. Bravo-San Pedro, G. Kroemer, L. Galluzzi, Autophagy and Mitophagy in Cardiovascular Disease, Circulation research 120(11) (2017) 1812-1824. [88] D. Aune, N. Keum, E. Giovannucci, L.T. Fadnes, P. Boffetta, D.C. Greenwood, S. Tonstad, L.J. Vatten, E. Riboli, T. Norat, Nut consumption and risk of cardiovascular disease, total cancer, all-cause and cause-specific mortality: a systematic review and dose-response meta-analysis of prospective studies, BMC medicine 14(1) (2016) 207.

51

[89] W. Martinet, G.R. De Meyer, Autophagy in atherosclerosis: a cell survival and death phenomenon with therapeutic potential, Circulation research 104(3) (2009) 304-317. [90] M.A. Gimbrone, Jr., G. Garcia-Cardena, Endothelial Cell Dysfunction and the Pathobiology of Atherosclerosis, Circulation research 118(4) (2016) 620-36. [91] B. Tesfamariam, Endothelial Repair and Regeneration Following Intimal Injury, Journal of cardiovascular translational research 9(2) (2016) 91-101. [92] F. Luchetti, R. Crinelli, E. Cesarini, B. Canonico, L. Guidi, C. Zerbinati, G. Di Sario, L. Zamai, M. Magnani, S. Papa, L. Iuliano, Endothelial cells, endoplasmic reticulum stress and oxysterols, Redox biology 13 (2017) 581-587. [93] A.C. Vion, M. Kheloufi, Autophagy is required for endothelial cell alignment and atheroprotection under physiological blood flow, 114(41) (2017) E8675-e8684. [94] J.M. McGrath, D.H. Chestnut, R.D. Vincent, C.S. DeBruyn, B.L. Atkins, D.J. Poduska, P. Chatterjee, Ephedrine remains the vasopressor of choice for treatment of hypotension during ritodrine infusion and epidural anesthesia, Anesthesiology 80(5) (1994) 1073-81; discussion 28A. [95] R.N. Price, F. Nosten, C. Luxemburger, F. Ter Kuile, L. Paiphun, T. Chongsuphajaisiddhi, N. White, Effects of artemisinin derivatives on malaria transmissibility, The Lancet 347(9016) (1996) 1654-1658. [96] J. Han, X.-Y. Pan, Y. Xu, Y. Xiao, Y. An, L. Tie, Y. Pan, X.-J. Li, Curcumin induces autophagy to protect vascular endothelial cell survival from oxidative stress damage, Autophagy 8(5) (2012) 812-825. [97] X. Wu, X. Chen, J. Dan, Y. Cao, S. Gao, Z. Guo, P. Zerbe, Y. Chai, Y. Diao, L. Zhang, Characterization of anti-leukemia components from Indigo naturalis using comprehensive two-dimensional K562/cell membrane chromatography and in silico target identification, Sci Rep 6 (2016) 25491. [98] A.-G. Wu, V.K.-W. Wong, W. Zeng, L. Liu, B.Y.-K. Law, Identification of novel autophagic Radix Polygalae fraction by cell membrane chromatography and UHPLC-(Q) TOF-MS for degradation of neurodegenerative disease proteins, Scientific Reports 5 (2015) 17199. [99] F. Liao, A. Andalibi, J.-H. Qiao, H. Allayee, A.M. Fogelman, A.J. Lusis, Genetic evidence for a common pathway mediating oxidative stress, inflammatory gene induction, and aortic fatty streak formation in mice, The Journal of clinical investigation 94(2) (1994) 877-884.

52

[100] S. Rajagopalan, S. Kurz, T. Münzel, M. Tarpey, B.A. Freeman, K.K. Griendling, D.G. Harrison, Angiotensin II-mediated hypertension in the rat increases vascular superoxide production via membrane NADH/NADPH oxidase activation. Contribution to alterations of vasomotor tone, The Journal of clinical investigation 97(8) (1996) 1916-1923. [101] A. Takahashi, N. Ohtani, K. Yamakoshi, S.-i. Iida, H. Tahara, K. Nakayama, K.I. Nakayama, T. Ide, H. Saya, E. Hara, Mitogenic signalling and the p16 INK4a–Rb pathway cooperate to enforce irreversible cellular senescence, Nature cell biology 8(11) (2006) 1291. [102] M.B. Azad, Y. Chen, S.B. Gibson, Regulation of autophagy by reactive oxygen species (ROS): implications for cancer progression and treatment, Antioxidants & redox signaling 11(4) (2009) 777-790. [103] U. Förstermann, N. Xia, H. Li, Roles of vascular oxidative stress and nitric oxide in the pathogenesis of atherosclerosis, Circulation research 120(4) (2017) 713-735. [104] T. Patinen, S. Adinolfi, C.C. Cortes, J. Harkonen, A. Jawahar Deen, A.L. Levonen, Regulation of stress signaling pathways by protein lipoxidation, Redox biology (2019) 101114. [105] Z.V. Varga, Z. Giricz, L. Liaudet, G. Haskó, P. Ferdinandy, P. Pacher, Interplay of oxidative, nitrosative/nitrative stress, inflammation, cell death and autophagy in diabetic cardiomyopathy, Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease 1852(2) (2015) 232-242. [106] S. Maharjan, M. Oku, M. Tsuda, J. Hoseki, Y. Sakai, Mitochondrial impairment triggers cytosolic oxidative stress and cell death following proteasome inhibition, Scientific reports 4 (2014) 5896. [107] H.-U. Simon, A. Haj-Yehia, F. Levi-Schaffer, Role of reactive oxygen species (ROS) in apoptosis induction, Apoptosis 5(5) (2000) 415-418. [108] Y.-R. Chen, J.L. Zweier, Cardiac mitochondria and reactive oxygen species generation, Circulation research 114(3) (2014) 524-537. [109] G. Filomeni, E. Desideri, S. Cardaci, G. Rotilio, M.R. Ciriolo, Under the ROS...thiol network is the principal suspect for autophagy commitment, Autophagy 6(7) (2010) 999-1005. [110] J. Xu, J.T.F. Wise, L. Wang, K. Schumann, Z. Zhang, X. Shi, Dual Roles of Oxidative Stress in Metal Carcinogenesis, J Environ Pathol Toxicol Oncol 36(4) (2017) 345-376.

53

[111] W.J. Huang, X. Zhang, W.W. Chen, Role of oxidative stress in Alzheimer's disease, Biomed Rep 4(5) (2016) 519-522. [112] S.K. Hur, S.H. Park, G.T. Oh, The Role of Autophagy in the Pathogenesis of Atherosclerosis, Journal of Lipid and Atherosclerosis 5(1) (2016) 1-10. [113] A. Simonsen, R.C. Cumming, A. Brech, P. Isakson, D.R. Schubert, K.D. Finley, Promoting basal levels of autophagy in the nervous system enhances longevity and oxidant resistance in adult Drosophila, Autophagy 4(2) (2008) 176-184.

Fig. 1. PCP extract exhibits autophagic effect and protects HUVECs from oxidative injury. (A) Cytotoxicity and mean IC50 values of the flower, leaf and stem extracts from PCP herb in stable GFP-LC3 U87 cells after 48 h of treatment. (B) Cytotoxicity and mean IC50 values of the flower, leaf and stem extracts from PCP herb in HeLa cells after 48 h of treatment. (C) Flower, leaf and stem extracts from PCP herb increased GFP-LC3 puncta formation in stable GFP-LC3 U87 cells. Stable GFP-LC3 U87 cells were incubated with different parts of PCP (flower, leaf or stem) extracted with 70% ethanol under the indicated concentrations (15 µg/mL, 30 µg/mL or 60 µg/mL) for 4 h. The percentages of cells with GFP-LC3 puncta formation (≧10 puncta/cell) was calculated. Representative images with GFP-LC3 puncta formation were captured. Magnification, ×40, scale bar: 30 µm. Bar chart indicated the percentage

54

of cells with GFP-LC3 puncta formation. S.D. *** P≤ 0.001. (D) Flower, leaf and stem extracts from PCP herb increased LC3-II conversion in HeLa cells. HeLa cells were treated with different parts of PCP under the indicated concentrations (15 µg/mL or 30 µg/mL) for 24 h. After treatment, the cells were harvested for analysis of LC3 I/II and β-actin protein levels using Western blotting. Bar chart indicated the relative protein expression of LC3-II/β-actin; bars, S.D. ***p < 0.001; **p < 0.01. (E) Cyto-protective effect of the flower, leaf and stem extracts from PCP herb in H2O2-induced HUVECs. HUVECs were treated with H2O2 (400 µM) for 48h, with or without pre-treatment with 30 µg/mL of parts of PCP (flower, leaf or stem) for 2h. After treatment, the cell cytotoxicity was measured by MTT assay. Bar chart indicated the percentage of cell viability of HUVECs; bars, S.D. *** P≤ 0.001. (F) Flower, leaf and stem extracts from PCP herb increased LC3-II conversion in HUVECs. HUVECs cells were treated with water extract fraction (WF, 500 µg/mL), n-butanol extract fraction (NF, 30 µg/mL), ethyl acetate extract fraction (EF, 30 µg/mL) and n-hexane extract fractin (HF, 30 µg/mL) for 24 h. After treatment, the cells were harvested for analysis of LC3 I/II and β-actin protein levels using Western blotting. Bar chart indicated the relative protein expression of LC3-II/β-actin; bars, S.D. ***p < 0.001; *p < 0.05.

Fig. 2. Identification of the active components with HUVECs affinity by using cell membrane chromatography (CMC). (A) Schematic diagram for identification of novel active components from PCP via a cell membrane chromatography (CMC) method. (B) Total Ion Chromatogram (TIC) of the CMC samples of leaf extract of PCP herb with HUVECs. The cluster of peaks (C1, C2, C3 and C4) represents the chemical 55

components that have binding affinity with HUVECs. (C) The MS chromatogram of the main components in C1, C2, C3 and C4. The retention time, chemical name, accurate MS and molecular weight of the 4 main compounds are listed in the table. (D) The chemical structures of the newly identified compounds (TA, PG, TB and PG1) from PCP herb. The red part displays flavonone or chalcone and the blue part shows the glycosyl group.

Fig. 3. The 4 CMC-identified compounds exhibit autophagic effect in HUVECs. (A) The mean IC50 values of CMC-identified compounds TA, PG, TB and PG1 from PCP herb after 48 h of treatment in HUVECs. (B) The 4 CMC-identified compounds from PCP increased LC3-II conversion. HUVECs were treated with TA, PG, TB, PG1 or Rapamycin (Rapa) under the indicated concentrations for 24h. After treatment, the cells were harvested for analysis of LC3 I/II and β-actin protein levels using Western blotting. Bar chart indicated the relative protein expression of LC3-II/β-actin; bars, S.D. ***p < 0.001; **p < 0.01. (C) The lysosomal protease inhibitors increased LC3-II accumulation in TA, PG, TB or PG1 treated HUVECs. HUVECs were treated with 8 µM of TA, PG, TB and PG1 with or without the presence of lysosomal protease inhibitors (E64d and pepstatin A, 10 µg/mL) for 24 h. After treatment, the cells were harvested for analysis of LC3 I/II and β-actin protein levels using Western blotting. Bar chart indicated the relative protein expression of LC3-II/β-actin; bars, S.D. ***p < 0.001; **p < 0.01. (D) TA, PG, TB and PG1 induce autophagy in a Atg7 gene-dependent manner. Atg7 wild type and deficient MEF cells were treated with 8 µM of TA, PG, TB, PG1 or Rapamycin for 24 h. After treatment, the cells were 56

harvested for analysis of LC3 I/II and β-actin protein levels using Western blotting. Bar chart indicated the relative protein expression of LC3-II/β-actin; bars, S.D. ***p < 0.001.

Fig. 4. The protective effect of the 4 CMC-identified compounds from PCP in H2O2 induced redox injury. (A) The 4 CMC-identified compounds increased cell viability of H2O2-treated HUVECs. HUVECs were pretreated with or without TA (4, 8 µM), PG (4, 8 µM), TB (4, 8 µM) or PG1 ((4, 8 µM) for 2 h, followed by a co-incubation with H2O2 for 24 h. After treatment, cell viability of HUVECs were then determined by MTT assay. (B) The 4 CMC-identified compounds inhibited apoptosis in H2O2–treated HUVECs. HUVECs cells were pretreated with or without TA (8 µM), PG (8 µM), TB (8 µM) or PG1 (8 µM) for 2h, followed by a co-incubation with 600 µM of H2O2 for 24 h. After treatment, cell apoptosis were then detected by flow cytometry analysis using annexin V-FITC/PI. Bar chart indicated the percentage of cell death of HUVECs under these treatments. bars, S.D. ***p < 0.001. (C) The 4 CMC-identified compounds inhibited the loss of mitochondrial membrane potential (MMP) in H2O2 -treated HUVECs. HUVECs cells were pretreated with or without TA (8 µM), PG (8 µM), TB (8 µM) or PG1 (8 µM) for 2h, followed by a co-incubation with 600 µM of H2O2 for 24 h. After treatment, Cells were stained with rhodamine 123 and examined by flow cytometry. Bar chart indicated the percentage of MMP in HUVECs under these treatments. Data from the flow cytometry analysis is represented as means ± S.D. of three independent experiments. bars, S.D. ***p < 0.001.

57

Fig. 5. The 4 CMC-identified compounds induce autophagy via AMPK signaling, but independent to mTOR signaling pathway. (A) Effect of the 4 CMC-identified compounds on the phosphorylation of p-AMPK, Beclin-1 and LC3 in HUVECs. HUVECs were treated with 8 µM of TA, PG, TB, PG1 or AICAR (500 µM), an activator of AMP-activated protein kinase, AMPK, as a positive control group) for 24 h. After treatment, HUVECs were harvested and the cell lysate were then subjected to Western blot analysis using the antibodies against p-AMPKα1, total AMPK, Beclin-1, LC3 I/II and β-actin. Bar chart indicated the relative protein expression of p-AMPK/β-actin and Beclin-1/β-actin; bars, S.D. ***p < 0.001; **p < 0.01; *p < 0.05. (B) Effect of the 4 CMC-identified compounds on the phosphorylation of mTOR and p70S6K in HUVECs. HUVECs were treated with 8 µM of TA, PG, TB or PG1 or Rapa (0.3 µM) for 24 h. HUVECs were harvested and the cell lysates were then subjected to Western blot analysis using the antibodies against p-mTOR, mTOR, p-P70S6K, P70S6K and β-actin. Bar chart indicated the relative protein expression of p-mTOR/β-actin and p-p70S6K/β-actin; bars, S.D. **p < 0.01; *p < 0.05. (C) The relative percentage of TA in total ethanol extract of PCP herb measured by UHPLC-DAD-TOF-MS. The relative percentage of TA is determined to be 59.77% by calculating its peak area to total peak area at 254 nm. (D) TA induces autophagy independent of mTOR signaling pathway. HUVECs were treated with TA (8 µM), with or without 1 h of pretreatment of either LY-294 (LY294002, 10 µM, an inhibitor of PI3K), MK-22 (MK2206, 5 µM, an inhibitor of Akt1/2/3) or LY258 (LY2584702, 5 µM,

58

an inhibitor of p70S6K) for 24 h. Bar chart indicated the relative protein expression of LC3-II/β-actin; bars, S.D.

Fig. 6. TA induces autophagy via Ca2+-AMPK signaling. (A) TA increased p-AMPK protein expression in a dose-dependent manner. HUEVCs were treated with TA (4 µM, 8 µM, 16 µM and 32 µM) and AICAR (500 µM) for 24 h. After treatment, HUVECs were harvested and the cell lysates were then subjected to Western blot analysis using the antibodies against p-AMPK and AMPK. Bar chart indicated the relative intensity of p-AMPK to AMPK; bars, S.D. ***p < 0.001; *p < 0.01; **p < 0.01; *p < 0.05. (B & C) AMPK inhibitor and calcium chelator abolish TA-induced autophagy in HUVECs. HUVECs were treated with TA (8 µM) with or without 1h pretreatment of compound C (CC, 0.5 µM) or BAPTA/AM (BM, 2 µM) for 24 h. Bar chart indicated the relative intensity of p-AMPK to AMPK. Bars are representatives of three independent experiments. Bars, S.D. ***p < 0.001; **p < 0.01. (D) Calcium dynamic change of TA, PG, TB or PG1 treated HUVECs. HUVEC cells stained with FLIPR Calcium 6 Assay Kit were treated with 8 µM of TA, PG, TB or PG1, then immediately subjected to calcium dynamic measurement by FLIPR Tetra High-Throughput Cellular Screening System. Data from the chart represents mean values ± SD of three independent experiments. (E) The specific machinery of TA induces autophagy in HUVECs via a Ca2+/AMPK-dependent and mTOR-independent signaling pathways.

Fig. 7. TA exerts anti-oxidative effect via autophagy induction in HUVECs. (A) TA and catalase decreases intracellular ROS levels. HUVECs were pre-incubated with 59

H2DCFDA-AM (10 µM) and incubated for 1 h, followed by a 1 h of H2O2 treatment (400 µM or 600µM) with or without 2 h pretreatment of TA (4 µM) or Catalase (100 U/mL). After treatment, the fluorescence intensity of cells was detected by a spectrophotometer using the excitation wavelength 488 nm and the emission wavelength of 530 nm. Bar chart indicated the fluorescence intensity. Bars are representatives of three independent experiments. Bars, S.D. ***p < 0.001. (B) CC abolished the protective effect of TA in H2O2-treated HUVECs. HUVECs were stained with crystal violet solution for visualization of cell density after 48 h of H2O2 treatment (600 µM), with or without 2 h presence of TA (8 µM) and/or CC (0.5 µM). Representative bright field images were captured (magnification: ×10). Scale bar: 800 µm. Bar chart indicated the percentage of cell viability. Bars are representatives of three independent experiments. Bars, S.D. ***p < 0.001. (C) TA increased the cell viability of H2O2-treated HUVECs via Atg7 gene. The efficiency of siRNA knockdown of Atg7 in HUVECs was validated by Western blotting. HUVECs transfected with vector or siRNA Atg7 were pretreated with or without 2 h of TA (8 µM), followed by the treatment of H2O2 (600 µM) for 24 h. After treatment, the cell viability of HUVECs was measured by MTT method. Bar chart indicated the percentage of cell viability. Bars are representatives of three independent experiments. Bars, S.D. ***p < 0.001. (D) TA inhibited the loss of MMP in H2O2-treated HUVECs. HUVECs were pretreated with or without the TA (8 µM) and/or CC (0.5 µM) for 2 h, followed by the treatment of H2O2 (400 µM) for 24 h. After treatment, the cells were then subjected to JC-1 staining.

60

Representative images with JC-1 fluorescence (indicating mitochondrial depolarization) were detected by laser confocal microscopy. Magnification, ×63, scale bar: 100 µm.

Fig. 8. TA anti-oxidative effect of TA in ApoE-KO mice. (A) TA alleviated oxLDL-induced cell death in HUVECs. HUVECs were pretreated with or without TA (8 µM), followed by the treatment of oxLDL (50 µg/mL) for 48 h. After treatment, the cells were stained with crystal violet for visualization of cell density. Bar chart indicated the percentage of cell viability. Bars are representatives of three independent experiments. Bars, S.D. ***p < 0.001. (B) TA reduced the ROS levels in the aortic artery of ApoE-KO mice. The cells were collected from the aortic vessels by nylon sievemesh combined with trypsin, and then were labeled with H2DCFDA-AM (10 µM) for 1 h and the fluorescence intensity of cells were detected by using a spectrophotometer with an excitation wavelength of 488 nm and emission wavelength of 530 nm. The fluorescent values were standardized by 100000 cells per group. Bar chart indicated the fluorescence intensity. Bars are representatives of three independent experiments. Bars, S.D. ***p < 0.001. (C) The expression of IL-1β in the aortic artery of TA-treated ApoE-KO mice. Representative images of immunohistochemistry analysis of IL-1β of ApoE-KO mice and C57BL/6J mice administrated with TA. Magnification, 40×, scale bar: 100 µm. (D) The mRNA expression of IL-1β in aortic artery of TA-treated ApoE-KO mice and C57BL/6J mice administrated with TA. (E) TA reduced the expression of NLRP3 and IL-1β in aortic arteries of ApoE KO mice. Immunofluorescent double labelled staining method was applied to assess the expression of NLRP3 and IL-1β in the arcus aortae vessels of each group. 61

Representative images stained with NLRP3, IL-1β and DAPI were detected by laser confocal microscopy. Magnification, ×10, scale bar: 300 µm. (F) TA reduced the expression of NLRP3 and IL-1β in aortic arteries of ApoE-KO mice. Bar chart indicated the relative density of cleaved-IL-1β to β-actin. Data from the chart represents mean values ±SD of three independent experiments, Bars, S.D. ***p < 0.001.

Supplementary Fig. 1. Comparison of three reported autophagic compounds with the four newly isolated compounds from PCP herb in HeLa and stable GFP-LC3 U87 cells. (A) The chemical structures of Quercetin (Que), Gallic acid (Gal), Pinocembrin (Pin) reported in PCP. (B) Cytotoxicity and mean IC50 values of Que, Gal and Pin and the CMC-identified compounds (TA, PG, TB and PG1) from PCP herb in HeLa cells and U87 cells after 48 h of treatments. (C) The autophagic effect of TA, PG, Que, Gal and Pin in HeLa cells. HeLa cells were treated with the indicated concentrations of TA, PG, Que, Gal, Pin or Rapa (Rapamycin) for 24 h. Cell lysates were then harvested and analyzed for LC3 I/II and β-actin. Bar chart indicated the relative density of LC3-II to β-actin. Data from the chart represents mean values ±SD of three independent experiments, Bars, S.D. ***p < 0.001; **p < 0.01. (D) The autophagic effect of TA, PG, Que, Gal and Pin in stable GFP-LC3 U87 cells. Stable GFP-LC3 U87 cells were treated with the indicated concentrations of Que, Gal, Pin, TA, PG, TB or PG1 for 24 h. After treatment, the percentage of cells with GFP-LC3 puncta formation were calculated as the number of cells with GFP-LC3 puncta ( ≧ 10 puncta/cell). Representative images with GFP-LC3 puncta formation were captured.

62

Magnification, ×40, scale bar: 30 µm. Representative images with GFP-LC3 puncta formation were captured. Bars, S.D. ***p < 0.001; **p < 0.01.

Supplementary Fig. 2. The interaction of TA with H2O2. (A) The TIC of TA with H2O2, H2O2 and TA alone. (B) The diode array detector (DAD) chromatogram of TA with H2O2, H2O2 and TA alone. All chromatograms were obtained using a Shimadzu liquid system equipped with a triple TOFTM X500R system in negative electrospray ion mode. (C) Bar chart indicated the peak area of TA in the samples of TA alone and TA with H2O2. Non-significance: ns. (D, E) Both pre-treatment and co-treatment of TA improves cell viability of HUVECs. (D) Pre-treatment of TA improves cell viability of H2O2 induced HUVECs. HUVECs seeded in 96-well plates were pre-treated with TA under the indicated concentrations for 12 h, TA was then removed and HUVECs was treated with 600 µM H2O2 for another 12 h. After treatment, cell viability was determined by MTT method. (E) Co-treatment of TA improves cell viability of HUVECs. HUVECs seeded in 96-well plates were co-treated with TA with H2O2 under the indicated concentrations for 24 h. After treatment, cell viability was determined by MTT method. Bar charts indicated the cell viability of HUVECs. ***P ≤ 0.001.

Supplementary Fig. 3. Autophagy effect of TA in the presence or absence of Ca2+-CaMKK-AMPK inhibitors in stable GFP-LC3 U87 cells. (A) The autophagic effect of TA in the presence or absence of CC (1.25 µM) for 24 h in stable GFP-LC3 U87 cells. (B) The autophagic effect of TA, PG, TB and PG1 in the presence or absence 63

of BM (10 µM), STO (25 µM) or MP (10 mM) in stable GFP-LC3 U87 cells for 24 h. After treatment, the percentage of cells with GFP-LC3 puncta formation were calculated as the number of cells with GFP-LC3 puncta ( ≧ 10 puncta/cell). Representative images with GFP-LC3 puncta formation were captured. Magnification, ×40, scale bar: 30 µm. Representative images with GFP-LC3 puncta formation were captured. Bars, S.D. ***p < 0.001.

Supplementary Fig. 4. The expression of LC3-II in HUVECs treated with H2O2 alone or H2O2 and TA with the indicated concentrations. HUVECs were treated with the indicated concentrations of H2O2 for 24h, with or without the 2h pretreatment of TA (4 µM). The cells were then harvested and analyzed for LC3 I/II and β-actin. Bar chart indicated the relative protein expression of LC3-II/β-actin; Data from the chart represents mean values ±SD of three independent experiments, Bars, S.D. ***p < 0.001; **p < 0.01.

64

Highlights 1. Four autophagic inducers were firstly identified from PCP herb via HUVECs-based CMC method. 2. TA induces autophagy via a Ca2+/AMPK-dependent and mTOR-independent pathways. 3. TA exhibits potent anti-oxidative effect in HUVECs, which was proved to be closely associated with autophagy induction. 4. TA shows anti-oxidative effect and suppresses the expression of IL-1β in aortic arteries of ApoE-KO mice.