The ADH3*2 and CYP2E1 c2 alleles increase the risk of alcoholism in Mexican American men

Available online at www.sciencedirect.com R

Experimental and Molecular Pathology 74 (2003) 183–189

www.elsevier.com/locate/yexmp

The ADH3*2 and CYP2E1 c2 alleles increase the risk of alcoholism in Mexican American men Tamiko Konishi,a Maria Calvillo,b Ai-She Leng,b Jack Feng,c Tony Lee,c Hansen Lee,c James Lafayette Smith,b Shahid H. Sial,c Nancy Berman,d Samuel French,a,b,c,d Viktor Eysselein,c Keh-Ming Lin,b and Yu-Jui Yvonne Wana,* a

Department of Pathology, Harbor-UCLA Research and Education Institute, Torrance, CA 90509, USA Department of Psychiatry, Harbor-UCLA Research and Education Institute, Torrance, CA 90509, USA c Department of Pediatrics Medicine, Harbor-UCLA Research and Education Institute, Torrance, CA 90509, USA d Department of Pediatrics, Harbor-UCLA Research and Education Institute, Torrance, CA 90509, USA b

Received 19 August 2002

Abstract To identify the association between the polymorphisms of genes encoding alcohol metabolizing enzymes and alcoholism, the alcohol dehydrogenase 2 (ADH2), alcohol dehydrogenase 3 (ADH3), aldehyde dehydrogenase 2 (ALDH2), and cytochrome P450 2E1 (CYP2E1) genes were studied in 101 male Mexican American alcoholics. One hundred and four Mexican American nonalcoholic males served as controls. The allele frequency of ADH2*2 (4.3%) and ALDH2*2 (0%), which are considered as protective alleles against alcohol drinking, is very low in Mexican Americans and no association is found between these alleles and alcohol dependence. A strong association was found between ADH3 genotype and alcoholism; the percentage of subjects who carry the ADH3*2 allele was significantly higher in alcoholics (64.4%) than controls (50%). Association was also found between the CYP2E1 RsaI c2 allele and alcohol dependence; the percentage of subjects who carry the RsaI c2 allele was significantly higher in alcoholics (34.7%) than in nonalcoholics (22.1%). The subjects whose alcohol drinking onset age is younger than 25 have much higher CYP2E1 c2 allele frequency than those whose alcohol drinking onset age is older than 25 (22.1% vs 15.7%). Among 101 alcoholics, only 18 subjects carry neither ADH3*2 nor CYP2E1 c2 alleles. For those subjects who have an ADH*1/*1 background, a strong association is found between CYP2E1 RsaI/DraI genotype and alcoholism; the CYP2E1 RsaI c2 and DraI C allele frequencies are much higher in alcoholics than in nonalcoholics (26.4% vs 9.6% for c2 and 27.8% vs 13.5% for C allele). Taken together, ADH3*2 and CYP2E1 c2/C alleles might independently contribute to the development of alcoholism in Mexican American men. © 2003 Elsevier Science (USA). All rights reserved. Keywords: Alcoholism; Mexican; Alcohol dehydrogenase; Aldehyde dehydrogenase; Cytochrome P450 2E1

Introduction The development of alcoholism results from a complex interaction of biological, psychological, sociocultural, and genetic factors. Adoption and twin pair studies have revealed that about 40 – 60% of the individual variation in

* Corresponding author. Department of Pathology, Harbor-UCLA Medical Center, 1000 West Carson Street, Torrance CA, 90509. Fax: ⫹1-310-782-6649. E-mail address: [email protected] (Y.-J.Y. Wan).

alcohol preference and vulnerability to alcoholism is genetic in origin (Heath et al., 1997; Kendler et al., 1997). A number of studies have looked for polymorphic variants in alcohol metabolizing enzymes to explain susceptibility to alcoholism. The results vary depending on ethnic groups studied. Alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) are the principal alcohol metabolizing enzymes responsible for the oxidation of ethanol into acetaldehyde and to acetate in the liver. ADH enzymes are polymorphic at two loci, ADH2 and ADH3, which encode the ␤ and ␥ subunits, respectively. The ADH2*2 allele,

0014-4800/03/$ – see front matter © 2003 Elsevier Science (USA). All rights reserved. doi:10.1016/S0014-4800(03)00006-6

184

T. Konishi et al. / Experimental and Molecular Pathology 74 (2003) 183–189

consisting of the atypical ␤2 subunit, exhibits about 100 times more catalytic activity for ethanol oxidation than the usual ADH2*1/*1 allele at physiological pH (Yoshida et al., 1981). The ADH3*1 allele with a ␥1 subunit has a Vmax about twice that of ␥2 encoded by ADH3*2 (Bosron et al., 1988). The prevalence of the ADH2*1 allele is about 90% among most world populations, whereas the ADH2*2 allele is found predominantly in East Asian populations (about 70%). The ADH3*1 allele is prevalent among East Asians and Africans (about 90%) and is about equally distributed with ADH3*2 in whites (Agarwal and Goedde, 1992; Smith, 1986). ALDH2 catalyzes oxidation of acetaldehyde to acetate. A point mutation in the ALDH2 gene produces an atypical ALDH2*2 allele which has little or no catalytic activity (Crabb et al., 1989), resulting in acetaldehyde accumulation in the blood and tissues after alcohol consumption. This appears to have a protective effect against alcoholism (Harada et al., 1982; Mizoi et al., 1983). This atypical allele is present in about 40% of several East Asian populations such as Japanese and Chinese (Bosron et al., 1988; Harada et al., 1982). However, it is rarely seen in the other ethnic groups so far examined (Agarwal and Goedde, 1992). Cytochrome P450 2E1 (CYP2E1) is the major component of the microsomal ethanol oxidizing system. Since it is inducible by alcohol up to 10-fold, CYP2E1 may play a significant role in the pathogenesis of alcohol abuse (Takahashi et al., 1993). In addition to acetaldehyde, CYP2E1 generates free radicals, which react with cell membranes leading to cell damage and to the development of alcoholic liver disease (Castillo et al., 1992; Koop, 1992). Many groups have searched for the possible association between CYP2E1 genetic polymorphisms and the development of alcoholic liver disease. CYP2E1 RsaI allele polymorphism is located in the 5⬘-transcription regulatory region. This allele has been reported to be associated with altered gene expression. Specifically, the more common allele, c1, has lower expression rates compared to the mutant allele (c2). Thus the c2/c2 allele, which lacks the RsaI restriction site, is associated with a higher transcriptional activity (10-fold higher), elevated protein levels, and increased enzymatic activity compared with the more common c1/c1 allele (Hayashi et al., 1991; Tsutsumi et al., 1994). The association between CYP2E1 RsaI polymorphism and drinking behavior or the development of alcohol liver diseases has been examined in many studies with inconsistent findings (Carr et al., 1995; Kato et al., 1995; Parsian et al., 1998). The frequency of the c2 allele is markedly lower among white populations and African Americans (1–5%) compared to Asians (around 25%). Another polymorphism, located in intron 6, is determined using the DraI restriction enzyme. Unlike the c2 mutation, the relationship between this DraI allelic difference and its genetic expression has not been established (Ingelman-Sundberg et al., 1993; Nedelcheva et al., 1996). However, it has been suggested that the mutant allele (C) is related to the risk of developing

alcoholism in Japanese (Iwahashi et al., 1998). In addition, this allele has been reported to have a relationship to the incidence of lung cancer in a Japanese population (Uematsu et al., 1994). Another polymorphism of the CYP2E1 gene is located in intron 7 and can be detected by TaqI (McBride et al., 1987). Although there is no evidence that the TaqI allele has an impact on alcohol metabolism, Wong et al. has reported that the alcoholic liver disease group showed a significantly lower frequency of the less common TaqI allele, 4.9%, compared with the healthy control group, 13.5%, in a Caucasian population (Wong et al., 2000). A recent report has demonstrated that about 18% of Mexican American men are frequent and heavy drinkers (Caetano and Clark, 1998). However, alcohol pharmacogenetic information in this population is sparse. Typically with mixed genetic backgrounds, Mexican Americans carry Spanish, Amerindian, and African genes. It would be important to understand their genetic linkage in association with alcohol metabolism and the development of alcoholism in this unique population.

Materials and methods Subjects One hundred and one male Mexican American alcoholics were recruited for the study (mean age: 37.1 ⫾ 11.8 years). Each subject was diagnosed as alcohol dependence according to Semi-Structured Assessment for the Genetics of Alcoholism (Bucholz et al., 1994). They were either habitual or binge drinkers and consumed more than 80 g of ethanol daily for more than 5 years. One hundred and four male Mexican American nonalcoholic controls in this study were recruited from previous studies (mean age: 32.5 ⫾ 9.2 years) (Mendoza et al., 2001; Wan et al., 1998). All individuals, alcoholics and controls, had homogeneous Mexican backgrounds, defined as having at least three of the four biological grandparents of the same ethnicity. Informed consent was obtained for all of the subjects. Blood DNA was isolated by a rapid nonenzymatic method (Lahiri and Numberger, 1991). Determination of genotype Polymerase chain reaction (PCR) and restriction fragment length polymorphism were performed to determine the single nucleotide polymorphism sites for each gene. For ADH2 genotyping, PCR was performed in a final volume of 50 ␮l containing 500 ng genomic DNA, 250 ␮M each dNTP, 1.5 mM MgCl2, 1.5 U Taq polymerase, and 0.6 ␮M each primer, 5⬘-AATCTTTTCTGAATCTGAACAG-3⬘ and 5⬘-GAAGGGGGGTCACCAGGTTGC-3⬘. PCR products were digested with MaeIII and resolved on 3% gel (Xu et al., 1988). For ADH3 genotyping, PCR was performed in a final volume of 30 ␮l containing 200 ng genomic DNA, 200

T. Konishi et al. / Experimental and Molecular Pathology 74 (2003) 183–189 Table 1 Genotype and allele frequency of six alleles in Mexican American nonalcoholics and alcoholics No. (%) of subjects with genotype 1/1 ADH2 Nonalcoholics 96 (92.3) Alcoholics 96 (95.0) ALDH2 Nonalcoholics 104 (100) Alcoholics 101 (100) ADH3 Nonalcoholics 52 (50.0) Alcoholics* 36 (35.6) CYP2E1 RsaI Nonalcoholics 81 (77.9) Alcoholics 66 (65.3) CYP2E1 DraI Nonalcoholics 75 (72.1) Alcoholics 66 (65.3) CYP2E1 TaqI Nonalcoholics 72 (69.2) Alcoholics 70 (69.3)

1/2

Allele frequency (%)

185

digested with TaqI and analyzed on a 3% agarose-1000 (BRL, Grand Island, NY) gel with DNA ladder markers (BRL). Statistical analysis

2/2

7 (6.7) 4 (4.0)

1 (1.0) 1 (1.0)

4.3 3.0

0 (0.0) 0 (0.0)

0 (0.0) 0 (0.0)

0.0 0.0

33 (31.7) 54 (53.5)

19 (18.3) 11 (10.9)

34.1 37.6

22 (21.1) 34 (33.7)

1 (1.0) 1 (1.0)

11.5 17.8

25 (24.0) 32 (31.6)

4 (3.9) 3 (3.1)

15.9 18.8

29 (27.9) 27 (26.7)

3 (2.9) 4 (4.0)

16.8 17.1

The association of genotype and allele frequencies was tested for significance using the ␹2 test. A P value ⬍ 0.05 was considered statistically significant.

Results

* P ⬍ 0.01, ␹2 ⫽ 10.07, nonalcoholics vs alcoholics.

␮M each dNTP, 2 mM MgCl2, 1 U Taq polymerase, and 0.6 ␮M each primer, 5⬘-GCTTTAATATTAAATATTCTGTCCCC-3⬘ and 5⬘-AATCTACCTCTTTCCGAAGC-3⬘. PCR products were digested with SspI and resolved on 3% gel. (Groppi et al., 1990). PCR for ALDH2 was performed in a final volume of 50 ␮l containing 500 ng genomic DNA, 250 ␮M each dNTP, 1.5 mM MgCl2, 1.5 U Taq polymerase, and 0.6 ␮M each primer, 5⬘-CAAATTACAGGGTCAAGGGCT-3⬘ and 5⬘-CCACACTCACAGTTTTCTCTT-3⬘ (Harada and Zhang, 1993). PCR products was digested with MboII and resolved on 3% gel. PCR assay for the CYP2E1 RsaI allele, located in the 5⬘-flanking region, was performed in a final volume of 50 ␮l using 200 ng genomic DNA, 120 pmol each oligonucleotide primer, 5⬘-CCAGTCGAGTCTACATTGTCA and 5⬘TTCATTCTGTCTTTCTAACTGG, 125 ␮M each dNTP, 1.5 mM MgCl2, and 1.2 U Taq DNA polymerase (Hayashi et al., 1991). PCR product was then digested with RsaI. PCR assay for CYP2E1 DraI, which is located in intron 6, was performed in a final volume of 30 ␮l containing 500 ng genomic DNA, 200 ␮M each dNTP, 1.5 mM MgCl2, 1.5 U Taq DNA polymerase, and 0.5 ␮M each primer, 5⬘-TCGTCAGTTCCTGAAAGCAGG-3⬘ and 5⬘-GAGCTCTGATGGAAGTATCGCA-3⬘ (Wu et al., 1998). PCR products were digested with DraI and the fragments were resolved on 2% gel. PCR for CYP2E1 TaqI, located in intron 7, was performed in a final volume of 25 ␮l using 500 ng genomic DNA, 200 ␮M each dNTP, 1.5 mM MgCl2, 1.25 units Taq DNA polymerase, and 0.25 ␮M each primer, 5⬘-GGGCTTTCATCTTCATTTCGA-3⬘ and 5⬘-CAAAATGTGGGCTTTCATCTG-3⬘ (Wong et al., 2000). PCR products were

The genotype and the allele frequencies of ADH2, ADH3, ALDH2, and CYP2E1 genes in alcoholics and nonalcoholics are shown in Table 1. The allele frequency of ADH2*2 (4.3%) and ALDH2*2 (0%) is very low in Mexican American subjects. Therefore, unlike Asians, Mexican Americans do not carry these alleles which are considered to be protective against alcohol drinking. In addition, neither the ADH2*1 nor the ALDH2*1 allele was found to be associated with alcoholism in Mexican American men. ADH3*2 allele frequency is 34.1% in Mexican Americans, which is lower than Caucasians (44%), but much higher than Asians (5– 8%) (Couzigou et al., 1990; Gilder et al., 1993). There is an association between ADH3 genotype and alcoholism (P ⬍ 0.01). The distribution of ADH3*1/*1, ADH3*1/*2, and ADH3*2/*2 is 50.0, 31.7, and 18.2%, respectively, in controls and 35.6, 53.1, and 10.9%, respectively, in alcoholics (Table 1). The ADH3*1 allele is associated with the ADH2*2 allele in nonalcoholics, but not in alcoholics (P ⬍ 0.05, Table 2). The percentage of subjects who carry the ADH3*2 allele is significantly higher in alcoholics than in nonalcoholics (64.4% vs 50.0%, P ⬍ 0.05, Table 3 ). The allele frequency for the CYP2E1 RsaI c2 is 11.5% for Mexican American nonalcoholic men, which is between that for Asians (about 20%) and Caucasians (less than 5%) (Stephens et al., 1994). The percentage of subjects who carry the CYP2E1 RsaI c2 mutant alleles (*1/*2 plus *2/*2) is significantly higher in alcoholics than in nonalcoholics Table 2 The association of ADH3 and ADH2 genotypes in Mexican American nonalcoholics No. (%) of ADH2 subjects

ADH3 Nonalcoholics ADH3 Alcoholics

1/1 1/2 ⫹ 2/2 1/1 1/2 ⫹ 2/2

1/1

1/2 ⫹ 2/2

Allele (%)

45 (86.5) 51 (98.1) 34 (94.4) 62 (95.4)

7 (13.5)* 1 (1.9)* 2 (5.6) 3 (4.6)

7.7** 1.0** 2.3 3.0

* P ⬍ 0.05, ␹2 ⫽ 4.88, ADH2 genotype in nonalcoholics with ADH3*1 vs nonalcoholics with ADH3*2 genotype. ** P ⬍ 0.05, ␹2 ⫽ 5.69, ADH2 allele frequency in nonalcoholics with ADH3*1 vs nonalcoholics with ADH3*2 genotype.

186

T. Konishi et al. / Experimental and Molecular Pathology 74 (2003) 183–189

Table 3 The association between ADH3 and CYP2E1 genotype and alcoholism in Mexican American men No. (%) of subjects with genotype

ADH3 Nonalcoholics Alcoholics* CYP2E1 RsaI Nonalcoholics Alcoholics** CYP2E1 DraI Nonalcoholics Alcoholics CYP2E1 TaqI Nonalcoholics Alcoholics

1/1

1/2 ⫹ 2/2

52 (50.0) 36 (35.6)

52 (50.0) 65 (64.4)

81 (77.9) 66 (65.3)

23 (22.1) 35 (34.7)

75 (72.1) 66 (65.3)

29 (27.9) 35 (34.7)

72 (69.2) 70 (69.3)

32 (30.8) 31 (30.7)

* P ⬍ 0.05, ␹ ⫽ 4.311, nonalcoholics vs alcoholics. ** P ⬍ 0.05, ␹2 ⫽ 3.97, nonalcoholics vs alcoholics. 2

similar to findings in Caucasians (Day et al., 1991). The ALDH2*2 allele is absent in both alcoholic and nonalcoholic Mexican American groups, which is also very similar to the findings in Caucasians and Africans (Day et al., 1991; Goedde et al., 1992). In contrast, this atypical ALDH2*2 allele is present at a frequency of 22% in Han Chinese and 15% in Koreans (Goedde et al., 1992). Studies in Asian populations show that the ADH2*1 and ALDH2*1 alleles are found more frequently in alcoholics than in healthy controls (Chen et al., 1999; Iwahashi et al., 1995). It has also been reported that the risk for alcoholism with ADH2*2/*2 and ALDH2*2/*2 is 100-fold lower than in individuals with ADH2*1/*1 and ALDH2*1/*1 in Chinese (Chen et al., Table 4 Genotype and allele frequency in nonalcoholics and alcoholics with alcohol drinking onset age older or younger than 25 No. (%) of subjects with genotype

(34.7% vs 22.1%, P ⬍ 0.05) (Table 3). In Mexican American men, the RsaI allele has a linkage disequilibrium with the DraI allele, which is consistent with previous findings (P ⬍ 0.01, Wu et al., 1998). However, the CYP2E1 DraI C genotype is only associated with alcoholics who have the ADH3*1/*1 genotype (Table 5). The allele frequency for CYP2E1 TaqI is 16.8% for Mexican American nonalcoholics, and no association was found between the TaqI allele and alcoholism (Tables 1 and 3). When alcohol drinking onset age is taken into consideration, in some cases the difference in allele frequency becomes more pronounced between nonalcoholics and alcoholics. The ADH2 genotype distribution is significantly different between the subjects who started to drink alcohol before and after age 25 (Table 4). Most alcoholics who carry the ADH2*2 allele started to drink alcohol before age 25 (Table 4). The allele frequencies of nonalcoholics and alcoholics with drinking onset age older and younger than 25 are 34.1, 35.1, and 42.6%, respectively, for the ADH3*2 allele and 11.5, 15.7, and 22.1% for the CYP2E1 c2 allele (Table 4). Among 101 alcoholic subjects studied, 83 subjects carry the ADH3*2 and/or the CYP2E1 c2 allele. Only 18 of 101 subjects have neither the ADH3*2 nor the CYP2E1 c2 allele (Table 5). Furthermore, in subjects who have the ADH3*1/*1 allele, the CYP2E1 RsaI c2 and DraI C allele frequencies are much higher in alcoholics than in nonalcoholics (26.4% vs 9.6% for c2 and 27.8% vs 13.5% for C, P ⬍ 0.05) (Table 5). No such association was found for the TaqI allele. These data strongly indicate that the ADH3*2 and CYP2E1 c2 alleles are the major risk factors that independently contribute to alcoholism in Mexican American men. Discussion Our data indicate that the allele frequency of ADH2*1 in both controls and alcoholics is very high (95%), which is

1/1 ADH2 Nonalcoholics Alcoholicsa Age ⬍ 25 Age ⬎ 25 ALDH2 Nonalcoholics Alcoholics Age ⬍ 25 Age ⬎ 25 ADH3 Nonalcoholics Alcoholics Age ⬍ 25b Age ⬎ 25c CYP2E1 RsaI Nonalcoholics Alcoholics Age ⬍ 25d Age ⬎ 25 CYP2E1 DraI Nonalcoholics Alcoholics Age ⬍ 25 Age ⬎ 25 CYP2E1 TaqI Nonalcoholics Alcoholics Age ⬍ 25 Age ⬎ 25

1/2

Allele frequency (%)

2/2

96 (92.3)

7 (6.7)

1 (1.0)

4.3

30 (88.2) 66 (98.5)

4 (11.8) 0 (0.0)

0 (0.0) 1 (1.5)

5.9 1.5

104 (100)

0 (0.0)

0 (0.0)

0.0

34 (100) 67 (100)

0 (0.0) 0 (0.0)

0 (0.0) 0 (0.0)

0.0 0.0

52 (50.0)

33 (31.7)

19 (18.3)

34.1

10 (29.4) 26 (38.8)

19 (55.9) 35 (52.2)

5 (14.7) 6 (9.0)

42.6 35.1

81 (77.9)

22 (21.1)

1 (1.0)

11.5

19 (55.9) 47 (70.1)

15 (44.1) 19 (28.4)

0 (0.0) 1 (1.5)

22.1e 15.7

75 (72.1)

25 (24.0)

4 (3.9)

15.9

19 (55.9) 47 (70.1)

14 (41.2) 18 (26.9)

1 (2.9) 2 (3.0)

23.5 16.4

72 (69.2)

29 (27.9)

3 (2.9)

16.8

23 (67.7) 47 (70.1)

10 (29.4) 17 (25.4)

1 (2.9) 3 (4.5)

17.6 17.2

P ⬍ 0.05, ␹2 ⫽ 8.64, genotype of alcoholics who began to drink regularly before 25 vs alcoholics who began to drink regularly after 25 years old. b P ⬍ 0.05, ␹2 ⫽ 6.57, genotype of nonalcoholics vs alcoholics who began to drink regularly before 25 years old. c P ⬍ 0.05, ␹2 ⫽ 7.85, genotype of nonalcoholics vs alcoholics who began to drink regularly after 25 years old. d P ⬍ 0.05, ␹2 ⫽ 7.08, genotype of nonalcoholics vs alcoholics who began to drink regularly before 25 years old. e P ⬍ 0.05, ␹2 ⫽ 4.67, allele frequency of nonalcoholics vs alcoholics who began to drink regularly before 25 years old. a

T. Konishi et al. / Experimental and Molecular Pathology 74 (2003) 183–189

187

Table 5 The association of ADH3 and CYP2E1 genotypes in Mexican American nonalcoholics and alcoholics CYP2E1 RsaI

CYP2E1 DraI

No. (%) of subjects 1/1 ADH3 1/1 Nonalcoholics 1/2 ⫹ 2/2 ADH3 1/1 Alcoholics 1/2 ⫹ 2/2

1/2

Allele (%) 2/2

CYP2E1 TaqI

No. (%) of subjects 1/1

1/2

Allele (%) 2/2

No. (%) of subjects 1/1

1/2

Allele (%) 2/2

42 (80.8) 10 (19.2) 0 (0.0)a

9.6b

39 (75.0) 12 (23.1) 1 (1.9)c

13.5d

35 (67.4) 15 (28.8) 2 (3.8)

18.3

39 (75.0) 12 (23.1) 1 (1.9) 18 (50.0) 17 (47.2) 1 (2.8)a,e

13.5 26.4b,f

36 (69.2) 13 (25.0) 3 (5.8) 18 (50.0) 16 (44.4) 2 (5.6)c,g

18.3 27.8d,h

37 (71.2) 14 (26.9) 1 (1.9) 29 (80.5) 5 (13.9) 2 (5.6)

16.8 12.5

48 (73.8) 17 (26.2) 0 (0.0)e

13.1f

48 (73.9) 16 (24.6) 1 (1.5)g

13.8h

41 (63.1) 22 (33.8) 2 (3.1)

20

P ⬍ 0.01, ␹ ⫽ 9.83, CYP2E1 RsaI genotype in alcoholics with ADH3*1 vs nonalcoholics with ADH3*1 genotype. P ⬍ 0.01, ␹2 ⫽ 8.70, CYP2E1 RsaI allele frequency in alcoholics with ADH3*1 vs nonalcoholics with ADH3*1 genotype. c P ⬍ 0.05, ␹2 ⫽ 5.95, CYP2E1 DraI genotype in alcoholics with ADH3*1 vs nonalcoholics with ADH3*1 genotype. d P ⬍ 0.05, ␹2 ⫽ 5.60, CYP2E1 DraI allele frequency in alcoholics with ADH3*1 vs nonalcoholics with ADH3*1 genotype. e P ⬍ 0.05, ␹2 ⫽ 6.88, CYP2E1 RsaI genotype in alcoholics with ADH3*1 vs alcoholics with ADH3*2 genotype. f P ⬍ 0.05, ␹2 ⫽ 5.61, CYP2E1 RsaI allele frequency in alcoholics with ADH3*1 vs alcoholics with ADH3*2 genotype. g P ⬍ 0.05, ␹2 ⫽ 6.15, CYP2E1 DraI genotype in alcoholics with ADH3*1 vs alcoholics with ADH3*2 genotype. h P ⬍ 0.05, ␹2 ⫽ 5.89, CYP2E1 DraI allele frequency in alcoholics with ADH3*1 vs alcoholics with ADH3*2 genotype. a

2

b

1999). Unlike in Asians, ADH2*1 and ALDH2*1 are not associated with alcoholism in Mexican American men. However, in Mexican Americans, a significant difference in the ADH3*2 allele was found between alcoholics and controls. Similar to earlier reports, our data showed that ADH3 was in linkage disequilibrium with ADH2 (Chen et al., 1999; Osier et al., 1999). Association was found between ADH2*1 and ADH3*2 (P ⬍ 0.05). Therefore, the reason for the lack of association between ADH2*1 and alcoholism is probably due to the low allele frequency of ADH2*2 in Mexican Americans. The CYP2E1 c2 allele frequency is much higher in Asians (20 –28%) than in those of African and Caucasian (1–5%) backgrounds (Stephens et al., 1994), and this allele is shown as a risk factor for alcoholism and alcoholic liver disease mainly in Asians (Chao et al., 1997; Yoshihara et al., 2000). The c2 allele frequency in Mexican American men is 11.5%, which is between that for Asians and Caucasians. This result is consistent with the Martinez et al. report (1998), which finds that the CYP2E1 c2 allele frequency in Nicaraguans is between that of white Spaniards and Asians (2.5% Spanish, 16.4% Nicaraguans, 22.9% Asians). This intermediate genotype in Mexican Americans reflects the historical fact that they arose from the admixture of two or more population groups that have very different allele frequencies. This genetic mixture might give rise to large interethnic differences at a functional level (Martinez et al., 1998). Most interestingly, having the c2 allele increases the risk of alcoholism in Mexican American men. In subjects who carry the ADH3*1/*1 allele, the mutant c2 allele frequency is almost three times higher in alcoholics than in nonalcoholics. A similar result was found for the DraI allele, which had a linkage disequilibrium with the RsaI

allele, whereas the TaqI allele, which was not in linkage disequilibrium with the RsaI allele, was not associated with alcohol abuse at all. Association studies of alcohol-related gene polymorphism and alcoholism have been conducted mainly on Asians and Caucasians and little information is available in other populations which have a mixed genetic background, such as Mexican Americans. Mexican Americans are estimated to have 31% Native American, 61% Spanish, and 8% African genes (Hanis et al., 1991). Our data show that the allele frequency of ADH3*2 and CYP2E1 c2 in Mexican Americans is between Caucasians and Asians and that those alleles increase the risk of alcoholism, reflecting their mixed genetic background and their unique feature in alcohol pharmacogenetics. Most strikingly, when alcoholic subjects are subtyped according to alcohol drinking onset age, the association between the ADH3*2 and CYP2E1 c2 alleles and alcoholism becomes even more apparent. Furthermore, only 18 of 101 alcoholic subjects have neither the ADH3*2 nor the CYP2E1 c2 allele. In conclusion, our data indicate that ADH3*2 and CYP2E1 c2 play a significant, but independent, role in alcoholism in Mexican Americans. Alcohol addiction-related genes such as dopamine receptor and serotonin transporter genes, which may be the risk factors for those who do not carry the ADH3*2 and CYP2E1 c2 alleles, need to be studied.

Acknowledgments The work is supported by grants from NIAAA RO1 AA12081 and RO1 AA12081-02S1 as well as by GCRC (MO1RR 00425).

188

T. Konishi et al. / Experimental and Molecular Pathology 74 (2003) 183–189

References Agarwal, D.P., Goedde, H.W., 1992. Pharmacogenetics of alcohol metabolism and alcoholism. Pharmacogenetics 2, 48 – 62. Bosron, W.F., Lumeng, L., Li, T.K., 1988. Genetic polymorphism of enzymes of alcohol metabolism and susceptibility to alcohol liver disease. Mol. Aspects Med. 10, 147–158. Bucholz, K.K., Cadoret, R., Cloninger, C.R., Dinwiddie, S.H., Hesselbrock, V.M., Numberger Jr., J.I., Reich, T., Schmidt, I., Schuckit, M.A., 1994. A new, semi-structured psychiatric interview for use in genetic linkage studies: a report on the reliability to the SSAGA. J. Stud. Alcohol 55, 149 –158. Caetano, R., Clark, C.L., 1998. Trends in alcohol consumption patterns among whites, blacks and Hispanics: 1984 and 1995. J. Stud. Alcohol 59, 659 – 668. Carr, L.G., Hartleroad, J.Y., Liang, Y., Mendenhall, C., Morits, T., Thomassor, H., 1995. Polymorphism at the P450IIE1 locus is not associated with alcoholic liver disease in Caucasian men. Alcohol Clin. Exp. Res. 19, 182–184. Castillo, T., Koop, D.R., Kaminura, S., Triadafilopoulos, G., Tsukamoto, H., 1992. Role of cytochrome P-450 2E1 in ethanol-carbon tetrachloride-and iron-dependent microsomal lipid peroxidation. Hepatology 16, 992–996. Chao, Y-C., Young, T-H., Tang, H-S., Hsu, C-T., 1997. Alcoholism and alcoholic organ damage and genetic polymorphisms of alcohol metabolizing enzymes in Chinese patients. Hepatology 25, 112–117. Chen, C.C., Lu, R.B., Chen, Y.C., Wang, M.F., Chang, Y.C., Li, T.K., Yin, S.J., 1999. Interaction between the functional polymorphisms of the alcohol-metabolism genes in protection against alcoholism. Am. J. Hum. Genet. 65, 795– 807. Couzigou, P., Fleury, B., Groppi, A., Cassaigne, A., Begueret, J., Iron, A., 1990. Genotyping study of alcohol dehydrogenase class I polymorphism in French patients with alcoholic cirrhosis. Alcohol Alcohol. 25, 623– 626. Crabb, D.W., Edenberg, H.J., Bosron, W.F., Li, T-K., 1989. Genotypes for aldehyde dehydrogerase deficiency and alcohol sensitivity: the inactive ALDH22 allele is dominant. J. Clin. Invest. 83, 314 –316. Day, C.P., Bashir, R., Japes, O.F., Bassendine, M.F., Crabb, D.W., Thomasson, H.R., Li, T.K., Edenberg, H.J., 1991. Investigation of the role of polymorphisms at the alcohol and aldehyde dehydrogenase loci in genetic predisposition to alcohol-related end-organ damage. Hepatology 14, 798 – 801. Gilder, F.J., Hodgkinson, S., Murray, R.M., 1993. ADH and ALDH genotype profiles in Caucasians with alcohol-related problems and controls. Addiction 88, 383–388. Goedde, H.W., Agarwal, D.P., Fritze, G., Meier-Tackmann, D., Singh, S., Beckmann, G., Bhatia, K., 1992. Distribution of ADH2 and ALDH2 genotypes in different populations. Hum. Genet. 88, 344 –346. Groppi, A., Begueret, J., Iron, A., 1990. Improved methods for genotype determination of human alcohol dehydrogenase (ADH) at ADH 2 and ADH 3 loci by using polymerase chain reaction-directed mutagenesis. Clin. Chem. 36, 1765–1768. Hanis, C.L., Hewett-Emmett, D., Bertin, T.K., Schull, W.J., 1991. Origins of U.S. Hispanics. Implications for diabetes. Diabetes Care 14, 618 – 627. Harada, S., Agarwal, D.P., Goedde, H.W., Tagaki, S., Ishikawa, B., 1982. Possible protective role against alcoholism for aldehyde dehydrogenase isozyme deficiency in Japan. Lancet 2, 827. Harada, S., Zhang, S., 1993. New strategy for detection of ALDH2 mutant. Alcohol Supply 1A, 11–13. Hayashi, S.I., Watanabe, J., Kawajiri, K., 1991. Genetic polymorphism in the 5⬘-flanking region change transcriptional regulation of the human cytochrome P450 IIE1 gene. J. Biochem. 110, 559 –565. Heath, A.C., Bucholz, K.K., Madden, P.A., Dinwiddie, S.H., Slutske, W.S., Beirut, D.J., Stathan, D.J., Donne, M.P., Whitfield, J.B., Martin, N.G., 1997. Genetic and environmental contributions to alcohol depen-

dence risk in a national twin sample: consistency of findings in women and men. Psychol. Med. 27, 1381–1384. Ingelman-Sundberg, M., Johansson, I., Yin, H., Terelius, Y., Eliasson, E., Clot, P., Albano, E., 1993. Ethanol-inducible cytochrome P4502E1: genetic polymorphism, regulation, and possible role in the etiology of alcohol-induced liver disease. Alcohol 10, 447– 452. Iwahashi, K., Ameno, S., Ameno, K., Okada, N., Kinoshita, H., Sakae, Y., Nakamura, K., Watanabe, M., Ijiri, I., Harada, S., 1998. Relationship between alcoholism and CYP2E1 C/D polymorphism. Neuropsychobiology 38, 218 –221. Iwahashi, K., Matsuno, Y., Suwaki, H., Nakamura, K., Ichikawa, Y., 1995. CYP2E1 and ALDH2 genotype and alcohol dependence in Japanese. Alcohol Clin. Exp. Res. 19, 564 –566. Kato, S., Onda, M., Matsukura, N., Tokunaga, A., Tajiri, T., Kim, D.Y., Tsuruta, H., Matsuda, N., Yamashita, K., Shields, P.G., 1995. Cytochrome P4502E1 (CYP2E1) genetic polymorphism in a case-control study of gastric cancer and liver disease. Pharmacogenetics 5, S141– S144. Kendler, K.S., Heath, A.C., Neale, M.C., Kessler, R.C., Eaves, L.J., 1997. A population-based twin study of alcoholism in women. J. Am. Med. Assoc. 268, 1877–1882. Koop, D.R., 1992. Oxidative and reproductive metabolism by cytochrome P4502E1. FASEB J. 6, 724 –730. Lahiri, D.K., Nurnberger Jr., J.I., 1991. A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Res. 19, 5444. Martinez, C., Agundez, J.A.G., Olivera, M., Lerena, A., Ramirez, R., Hernandez, M., Benitez, J., 1998. Influence of genetic admixture on polymorphisms of drug-metabolizing enzymes: analyses of mutations on NAT2 and CYP2E1 genes in a mixed Hispanic populations. Clin. Pharm. Ther. 63, 623– 628. McBride, O.W., Umeno, M., Gelboin, H.V., Gonzalez, F.J., 1987. A Taq I polymorphism in the human P450 IIE1 gene chromosome 10 (CYP2E). Nucleic Acids Res. 15, 10071. Mendoza, R., Wan, Y.J., Poland, R.E., Smith, M., Zheng, Y., Berman, N., Lin, K.M., 2001. CYP2D6 polymorphism in a Mexican American population. Clin. Pharmacol. Ther. 70, 552–560. Mizoi, Y., Tatsuno, Y., Adachi, J., Kogame, M., Fukunaga, T., Fujiwara, S., Hishida, S., Ijiri, I., 1983. Alcohol sensitivity related to polymorphism of alcohol-metabolizing enzyme in Japanese. Pharmacol. Biochem. Behav. 18, 127–133. Nedelcheva, V., Persson, I., Ingelman-Sundberg, M., 1996. Genetic polymorphism of human cytochrome P450 2E1. Methods Enzymol. 272, 218 –225. Osier, M., Pakstis, A.J., Kidd, J.R., Lee, J.F., Yin, S.J., Ko, H.C., Edenberg, H.J., Lu, R.B., Kidd, K.K., 1999. Linkage disequilibrium at the ADH2 and ADH3 loci and risk of alcoholism. Am. J. Hum. Genet. 64, 1147–1157. Parsian, A., Cloninger, C.R., Zhang, Z.H., 1998. Association studies of polymorphisms of CYP2E1 gene in alcoholics with cirrhosis, antisocial personality, and normal controls. Alcohol Clin. Exp. Res. 22, 888 – 891. Smith, M., 1986. Genetic of human alcohol and aldehyde dehydrogenases. Adv. Hum. Genet. 15, 249 –290. Stephens, E.A., Taylor, J.A., Kaplan, N., Yang, C-H., Hsieh, L., Lucier, G.W., Bell, D.A., 1994. Ethnic variation in the CYP2E1 gene: polymorphism analysis of 695 African-Americans, European-Americans and Taiwanese. Pharmacogenetics 4, 185–192. Takahashi, T., Lasker, J.M., Rosman, A.S., Lieber, C.S., 1993. Induction of cytochrome P-4502E1 in the human liver by ethanol is caused by a corresponding increase in encoding messenger RNA. Hepatology 17, 236 –245. Tsutsumi, M., Wang, J.S., Takase, S., Takada, A., 1994. Hepatic messenger RNA contents of cytochrome P4502E1 in patients with different P4502E1 genotypes. Alcohol 29 (Suppl. 11), 29 –32. Uematsu, F., Ikawa, S., Kikuchi, H., Sagami, I., Kanamaru, R., Abe, T., Satoh, K., Motomiya, M., Watanabe, M., 1994. Restriction fragment length polymorphism of the human CYP2E1 (cytochrome P450IIE1)

T. Konishi et al. / Experimental and Molecular Pathology 74 (2003) 183–189 gene and susceptibility to lung cancer: possible relevance to low smoking exposure. Pharmacogenetics 4, 58 – 63. Wan, Y.J., Poland, R.E., Lin, K.M., 1998. Genetic polymorphism of CYP2E1, ADH2, and ALDH2 in Mexican-Americans. Genet. Test 2, 79 – 83. Wong, N.A.C.S., Rae, F., Simpson, K.J., Murray, G.D., Harrison, D.J., 2000. Genetic polymorphisms of cytochrome p4502E1 and susceptibility to alcoholic liver disease and hepatocellular carcinoma in a white population: a study and literature review, including meta-analysis. Mol. Pathol. 53, 88 –93. Wu, X., Amos, C.I., Kemp, B.L., Shi, H., Jiang, H., Wan, Y., Spits, M.R., 1998. Cytochrome P450 2E1 DraI polymorphism in lung

189

cancer in minority populations. Cancer Epidemiol. Biomarkers Prev. 7, 13–18. Xu, Y., Carr, L.G., Bosron, W.F., Li, T.K., Edenberg, H.J., 1988. Genotyping of human alcohol dehydrogenases at the ADH2 and ADH3 loci following DNA sequence amplification. Genomics 2, 209 –214. Yoshida, A., Impraim, C.C., Huang, I-L., 1981. Enzymatic and structural differences between usual and atypical liver alcohol dehydrogenases. J. Biol. Chem. 256, 12430 –12436. Yoshihara, E., Ameno, K., Nakamura, K., Ameno, M., Itoh, S., Ijiri, I., Iwahashi, K., 2000. The effects of the ALDH2*1/2, CYP2E1 C1/C2 and C/D genotypes on blood ethanol elimination. Drug Chem. Toxicol. 23, 371–379.