- Email: [email protected]
The antibiotic polymyxin B exhibits novel antifungal activity against Fusarium species
Accepted Manuscript Title: The antibiotic polymyxin B exhibits novel antifungal activity against fusarium species Author: Li-Hang Hsu, Hsuan-Fu Wang, Pei-Lun Sun, Fung-Rong Hu, YingLien Chen PII: DOI: Reference:
S0924-8579(17)30118-8 http://dx.doi.org/doi: 10.1016/j.ijantimicag.2017.01.029 ANTAGE 5080
To appear in:
International Journal of Antimicrobial Agents
Received date: Accepted date:
28-7-2016 28-1-2017
Please cite this article as: Li-Hang Hsu, Hsuan-Fu Wang, Pei-Lun Sun, Fung-Rong Hu, YingLien Chen, The antibiotic polymyxin B exhibits novel antifungal activity against fusarium species, International Journal of Antimicrobial Agents (2017), http://dx.doi.org/doi: 10.1016/j.ijantimicag.2017.01.029. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
The antibiotic polymyxin B exhibits novel antifungal activity against Fusarium species
Li-Hang Hsu a, Hsuan-Fu Wang a, Pei-Lun Sun b, Fung-Rong Hu c, Ying-Lien Chen a,*
a
Department of Plant Pathology and Microbiology, National Taiwan University, No. 1,
Sec. 4, Roosevelt Road, Taipei 10617, Taiwan b c
Department of Dermatology, Chang Gung Memorial Hospital, Linkou, Taiwan Department of Ophthalmology, National Taiwan University Hospital, Medical College,
National Taiwan University, Taipei, Taiwan
* Corresponding author. Tel.: +886 2 3366 1763; fax: +886 2 363 6490. E-mail address: [email protected] (Y.-L. Chen).
ARTICLE INFO Article history: Received 28 July 2016 Accepted 28 January 2017
Keywords: Polymyxin B Fusarium
Page 1 of 32
Antibiotic Antifungal
Page 2 of 32
Highlights
Polymyxin B (PMB) exhibits novel antifungal activity against Fusarium spp.
PMB exhibits fungicidal activity against Fusarium spp.
Conidia, but not chlamydospore, germination of Fusarium strains is inhibited by PMB.
PMB exhibits synergistic activity with posaconazole against Fusarium spp.
PMB can potentiate the effect of fluconazole, voriconazole or amphotericin B against Fusarium spp.
ABSTRACT The genus Fusarium comprises many species, including Fusarium oxysporum, Fusarium solani, Fusarium graminearum and Fusarium verticillioides, and causes severe infections in plants and humans. In clinical settings, Fusarium is the third most frequent mould to cause invasive fungal infections after Aspergillus and the Mucorales. Fusarium solani and F. oxysporum are the most prevalent Fusarium spp. causing clinical disease. However, few effective antifungal drugs are available to treat human and plant Fusarium infections. The cationic peptide antibiotic polymyxin B (PMB) exhibits antifungal activity against the human fungal pathogens Candida albicans and Cryptococcus neoformans, but its efficacy against Fusarium spp. is unknown. In this study, the antifungal activity of PMB was tested against 12 Fusarium strains that infect humans and plants (banana, tomato, melon, pea, wheat and maize). PMB was fungicidal against all 12 Fusarium strains, with minimum fungicidal concentrations of 32 g/mL or 64 g/mL for most strains tested, as evidenced by broth dilution, methylene
Page 3 of 32
blue staining and XTT reduction assays. PMB can reduce the germination rates of conidia, but not chlamydospores, and can cause defects in cell membrane integrity in Fusarium strains. PMB exhibits synergistic activity with posaconazole and can potentiate the effect of fluconazole, voriconazole or amphotericin B against Fusarium spp. However, PMB does not show synergistic effects with fluconazole against Fusarium spp. as it does against Candida glabrata and C. neoformans, indicating evolutionary divergence of mechanisms between yeast pathogens and the filamentous fungus Fusarium.
Page 4 of 32
1. Introduction Fusarium is a large genus of filamentous fungi that is widely distributed in soil, plants and other organic substrates. Fusarium spp., most importantly Fusarium oxysporum but also Fusarium graminearum, Fusarium verticillioides and Fusarium solani, are important plant fungal pathogens that cause various diseases such as Panama disease of banana, Fusarium wilt of tomato and head blight of wheat. In humans, Fusarium can cause superficial infections such as keratitis and onychomycosis as well as disseminated infections such as fungaemia, with the latter occurring mainly in immunosuppressed patients and extremely rarely in immunocompetent individuals [1,2]. In 2006, a multistate outbreak of keratitis was associated with Fusarium-contaminated contact lens solution [3]. Fusarium spp. that produce mycotoxins (e.g. trichothecene and fumonisin) can cause mycotoxicosis and result in organ toxicity or defective reproductive function in humans and animals following ingestion of contaminated food [4]. So far, effective treatment and control strategies for Fusarium spp. that infect humans or plants are unknown.
Current methods and fungicides are insufficient to eliminate plant diseases caused by Fusarium spp. and few antifungal drugs are effective against human Fusarium infections. Amphotericin B (AmB) and voriconazole (VRC) alone or in combination have been frequently used to treat human diseases caused by Fusarium spp. [5]. Notably, although fluconazole (FLU) is a commonly used azole against fungal pathogens, it does not exhibit antifungal activity against Fusarium spp. [6]. Recently, scientific studies revealed that posaconazole (PSC) is effective against recalcitrant Fusarium keratitis or
Page 5 of 32
peritonitis [7]. Meanwhile, both itraconazole and terbinafine pulse therapy, usually used to treat Trichophyton onychomycosis, are only partially effective against Fusarium onychomycosis [8], suggesting a need to seek more efficacious drugs to combat Fusarium infections. In addition to Fusarium spp., several bacterial pathogens such as Staphylococcus aureus and Pseudomonas aeruginosa can also cause keratitis or endophthalmitis in humans [9,10]. Therefore, a drug that targets both Fusarium and bacterial pathogens will be useful.
Polymyxins comprise a class of antibiotics that were discovered from the secreted compounds of Paenibacillus polymyxa in 1947 and are further classified into chemically distinct compounds known as polymyxins A, B, C, D and E [11]. Only polymyxin B (PMB) and polymyxin E (colistin) have been used in clinical practice to treat infections caused by Gram-negative bacteria such as Acinetobacter baumannii, Klebsiella pneumoniae and P. aeruginosa, but these were abandoned in the early 1980s when more effective and less toxic drugs became available [12]. However, in recent years, PMB and colistin have been increasingly used to treat drug-resistant bacterial infections and have served as a last-line treatment choice [13]. For instance, patients infected with drug-resistant A. baumannii or K. pneumoniae can be successfully treated with intravenous PMB but not with amikacin or meropenem [14,15]. PMB has high affinity for the lipopolysaccharide constituent of the bacterial outer membrane, thus increasing the permeability of the membrane. PMB also inhibits the activity of type II NADH-quinone oxidoreductase of Gram-negative bacteria [16]. In addition to the above-described modes of action for PMB, it also has vacuole-targeting fungicidal activity against the
Page 6 of 32
baker’s yeast Saccharomyces cerevisiae, and the inhibitory activity can be enhanced with allicin, an allyl-sulfur compound in garlic [17]. In the 1970s, PMB was noted to exhibit antifungal activity against Candida tropicalis, Candida albicans and S. cerevisiae, although at relatively high concentrations, and in recent years PMB has been found to exhibit antifungal activity or synergy with existing drugs such as FLU or itraconazole against some human fungal pathogens, including Candida glabrata, Cryptococcus neoformans and Aspergillus fumigatus [18–20].
Although PMB alone does not inhibit A. fumigatus, with a minimum inhibitory concentration (MIC) of >1000 g/mL, the addition of itraconazole can exert combination effects against A. fumigatus [20]. However, it is unclear whether PMB is effective alone or can be combined with existing drugs to be effective against Fusarium spp. Notably, PMB is not the only cationic polypeptide antibiotic against fungal pathogens; colistin has also been reported to show antifungal activity against Mucorales species [21].
In this study, the potential antifungal activity of PMB was tested against six Fusarium strains infecting humans and six Fusarium strains infecting plants. The results demonstrated that PMB exhibits antifungal activity, although at relatively high concentrations with MICs between 16 g/mL and 128 g/mL for different Fusarium spp. and with minimum fungicidal concentrations (MFCs) ranging from 16 g/mL to 256 g/mL. PMB was also found to potentiate the effects of FLU, VRC and AmB against Fusarium spp. In contrast to the synergistic effects observed between PMB and FLU against C. neoformans and C. glabrata, similar synergy between PMB and FLU or VRC
Page 7 of 32
was not observed against 12 Fusarium strains, indicating divergence of synergistic functions between PMB and triazoles on yeast pathogens such as Candida or Cryptococcus and the filamentous pathogen Fusarium. Notably, Fusarium can cause keratitis and PMB can be formulated for ophthalmic use, indicating a potential use of PMB against Fusarium keratitis.
2. Materials and methods 2.1. Strains, growth media and chemicals The 12 Fusarium strains used in this study are shown in Table 1. Previously unpublished Fusarium strains include isolates MCCF1600, MCCF2106, Fungus III-6, MCCF2074 and MCCF2036, which were isolated from patients in Taiwanese hospitals. These strains were identified by internal transcribed spacer (ITS) sequencing with primers JC727 (TCCTCCGCTTATTGATATGC) and JC728 (GGAAGTAAAAGTCGTAACAAGG), elongation factor 1 sequencing with primers JC1189 [ATGGGTAAGGA(A/G)GACAAGAC] and JC1190 [GGA(G/A)GTACCAGT(G/C)ATCATGTT], and searching for all Fusarium spp. in the Fusarium multilocus sequence typing (MLST) database (http://www.cbs.knaw.nl/fusarium/defaultinfo.aspx?page=home) and Fusarium Comparative Genome Project database (http://www.broadinstitute.org/annotation/genome/fusarium_group/MultiHome.html). Strain MCCF2036 was identified as genus Fusarium, but because it shares only 87.69% similarity with Fusarium cuneirostrum and is possibly a new species, this remains to be
Page 8 of 32
confirmed. Media used in this study included potato dextrose agar (PDA) (0.4% potato from infusion, 2% dextrose, 1.5% agar) (BioShop, Burlington, ON, Canada), RPMI 1640 medium [8.4 g of RPMI 1640 (Sigma-Aldrich, St Louis, MO), 34.5 g of 3-(Nmorpholino)propanesulfonic acid (MOPS) (GeneMark, Taichung, Taiwan) and 2% glucose (BioShop) in 1 L of distilled water (pH 7.0) adjusted by NaOH pellets]. Agar plates were solidified with 2% agar (BioShop). The following antifungal agents were used: polymyxin B sulfate (PMB) (BioShop); fluconazole (FLU) (Selleckchem, Houston, TX); voriconazole (VRC) (Sigma-Aldrich); and amphotericin B (AmB) (Sigma-Aldrich).
2.2. Conidia solution preparation All Fusarium strains were streaked on ½ PDA plates (0.2% potato from infusion, 1% dextrose, 1.5% agar) and were incubated at 28 C for 5–7 days. Conidia were then collected by scraping the agar surface and resuspending the conidia in sterile dH2O. The concentration of the freshly collected conidia solution was calculated with a haemocytometer and was diluted appropriately for further experiments.
2.3. Determination of conidia germination rate Each freshly collected Fusarium conidia solution was incubated in 3 mL of RPMI 1640 medium at 106 conidia/mL at 35 C for 10 h and was then treated without or with PMB at 8 g/mL. Following incubation, the supernatant was removed by centrifugation (3500 rpm for 10 min) and the pellet containing germinated conidia was resuspended in 2% Tween 20 (Polysorbate 20, Sigma-Aldrich) and was observed under a microscope.
Page 9 of 32
Germination was noted when a thin germ tube was longer than its respective conidium. The germination rate was calculated by randomly counting 50 conidia from each of three independent experiments. To compare conidia germination rates between groups, statistical analyses (Student’s unpaired t-test) were conducted using GraphPad Prism 5.01 software (GraphPad Software Inc., La Jolla, CA). Statistical significance was set at P < 0.05.
2.4. Determination of minimum inhibitory concentrations The susceptibility of 12 Fusarium strains to PMB was tested according to the protocol of the Clinical and Laboratory Standards Institute (CLSI) [28]. For filamentous fungi, twofold serial dilutions of PMB were prepared in 100 L of RPMI 1640 medium in 96-well microtitre plates (Becton Dickinson, Durham, NC). The final concentrations of PMB after addition of freshly prepared Fusarium conidia ranged from 0.5 g/mL to 256 g/mL. Conidia of Fusarium strains collected as described above and resuspended in RPMI 1640 media were adjusted to 104 conidia/mL and then 100 L (103 conidia) was added to the RPMI 1640 medium (100 L) containing serial concentrations of PMB. After addition of the Fusarium strain to the RPMI medium containing PMB at the concentrations indicated, all microtitre plates were incubated at 35 C for 48 h and the MIC was determined as the lowest drug concentration showing no visible growth. Three replicate experiments were performed.
Page 10 of 32
2.5. Determination of fractional inhibitory concentration indices (FICIs) FICIs of drug interactions were determined by chequerboard titration assays. Freshly collected conidia of 12 Fusarium strains were diluted to 104 conidia/mL with RPMI medium and then 100 L (103 conidia) was added to each well in a 96-well plate format. The drugs to be assessed were two-fold serially diluted in RPMI medium and then 50 L of each drug was added to the wells containing conidia, yielding a total volume of 200 L per well. PMB at concentrations ranging from 0.5 g/mL to 256 g/mL was added across the plate with the highest concentration in the left-most well and the lowest concentration in the right-most wells. FLU, VRC or AmB was added from top to bottom, with the highest concentration in the top row and the lowest in the bottom. FLU concentrations ranged from 1–64 g/mL, whilst both VRC and AmB concentrations ranged from 0.25–16 g/mL. This strategy allowed for 70 different drug combinations to be tested on one plate. The plates were incubated at 35 C for 48 h. The MIC of drugs, either alone or in combination, was defined as the lowest concentration of each drug that completely inhibited growth as detected by the unaided eye. The FICI was calculated by the following formula: FICI = [(MIC of drug A combined)/(MIC of drug A alone)] + [(MIC of drug B combined)/(MIC of drug B alone)] [29]. For calculation purposes, an MIC > 64 g/mL was assumed to be 128 g/mL.
Page 11 of 32
3. Results and discussion 3.1. Polymyxin B exhibits novel antifungal activity against Fusarium species Based on previous studies of PMB against human fungal pathogens such as Candida and Cryptococcus [18,20] and the findings that cell-free filtrates of P. polymyxa (from which PMB was originally isolated) can inhibit the plant pathogenic fungus F. oxysporum [30], we hypothesised that PMB has anti-Fusarium activity. Indeed, based on initial determination of MICs, PMB exhibited antifungal activity against 12 Fusarium strains that infect humans or plants (Tables 1 and 2). The MICs of PMB against 12 Fusarium strains ranged from 16 g/mL to 128 g/mL (Table 2). Among the six Fusarium spp. isolated from humans, four Fusarium isolates, including a F. solani isolate (Fungus III-6), a Fusarium falciforme isolate (MCCF2106), a F. oxysporum isolate (MCCF2074) and a Fusarium sp. isolate (MCCF2036), demonstrated the greatest susceptibility with MICs of 32 g/mL, whilst F. oxysporum FOSC 3-a exhibited the lowest susceptibility to PMB with an MIC of 128 g/mL (Table 2). There was a fourfold difference in MICs between F. oxysporum FOSC 3-a and F. oxysporum MCCF2074, whilst MICs were within a two-fold difference between two F. solani isolates (MCCF1600 and Fungus III-6) (Table 2). Among six plant-infecting Fusarium spp., peainfecting F. solani (MPVI 77-13-4) and wheat-infecting F. graminearum (PH-1) were the most susceptible to PMB with MICs of 16 g/mL, whilst maize-infecting F. verticillioides (7600) was the least susceptible to PMB with an MIC of 128 g/mL, showing an eightfold difference between these Fusarium spp. and indicating that the susceptibility of Fusarium to PMB depends on the species. Within the same F. oxysporum species but
Page 12 of 32
different formae speciales (f. sp.) that infect plants (Foc-T14, 4287 and NRRL26406), the MICs were all 32 g/mL (Table 2).
The susceptibility of the Fusarium genus to PMB varies approximately eight-fold (i.e. 16 g/mL vs. 128 g/mL) based on the limited number of strains tested. Even within the same F. oxysporum or F. solani species, the MIC can differ approximately four-fold (i.e. F. oxysporum MCCF2074 versus FOSC 3-a; F. solani MPVI 77-13-4 versus MCCF1600), indicating that evolutionary adaption to drug tolerance has diverged among Fusarium strains. Further investigation on more Fusarium strains in a species will provide more extensive findings, and studying the mechanisms of the susceptibility difference among Fusarium strains may identify genes or gene clusters involved in drug tolerance to PMB.
In addition to bacterial pathogens, Fusarium isolates (such as Fungus III-6 and MCCF2106) can also cause keratitis, and mixed infections may result in therapeutic challenges. Currently, PMB can be used for the topical treatment of keratitis caused by bacterial pathogens [31,32]. In the future, patients with keratitis caused both by bacterial pathogens and Fusarium might be treated with PMB or its less toxic but more potent derivatives after acquiring detailed data of the pharmacokinetics and pharmacodynamics of PMB. However, the MIC for Fusarium spp. (16 g/mL or 32 g/mL for most strains) and P. aeruginosa (ca. 1 g/mL) [33] are ca. 16- to 32-fold different, which may pose a challenge in determining the best dose of PMB against bacterial and Fusarium co-infections.
Page 13 of 32
3.2. Polymyxin B exhibits fungicidal activity against Fusarium species It is unclear whether PMB exhibits fungistatic or fungicidal activity against Fusarium spp. based on MIC determination. Therefore, we first used a CLSI broth dilution and spotting assay to determine the MFC. PMB exhibited fungicidal activity against 12 Fusarium strains with MFCs ranging from 16 g/mL to 256 g/mL (Table 2). These MFCs were less than or equal to four-fold their respective MICs (Table 2) and thus were considered to be the lowest drug concentrations to kill Fusarium strains [34]. Then, 0.01% methylene blue was used to stain 12 Fusarium strains after exposure to PMB at their respective MICs (Fig. 1). Fusarium strains treated with PMB were readily stained with methylene blue in contrast to the unstained PMB-untreated controls, suggesting that PMB is fungicidal (Fig. 1). In addition to using CLSI broth dilution and methylene blue staining to test the fungicidal activity of PMB, an XTT-based method was adapted to confirm the MFC. MFCs determined by the XTT-based method were consistent with broth dilution and methylene blue stain assays (Table 2).
Based on the above data, PMB demonstrated novel antifungal activity against Fusarium strains (Table 2; Fig. 1); however, it carries relatively high toxicity in mammals [35]. One can synthesise non-toxic or less toxic derivatives in order to reduce the toxicity of PMB. Several PMB derivatives with broad-spectrum antimicrobial activity against Gramnegative bacteria and Gram-positive S. aureus isolates have been synthesised recently [36,37] and these novel derivatives exhibit low toxicity in mammalian cell cultures
Page 14 of 32
compared with PMB. In the future, it will be intriguing to test whether these derivatives maintain anti-Fusarium activity and exhibit potential therapeutic function in animal models.
3.3. Conidia, but not chlamydospore, germination of Fusarium strains is inhibited by polymyxin B Identification of compounds that block the formation of the conidia germ tube will aid in further antifungal drug development. Here we demonstrated that PMB at 8 g/mL can inhibit conidia germ tube formation of most Fusarium strains (Fig. 2A,B). However, we did not observe obvious inhibition of conidia germination in F. verticillioides owing to its relatively lower susceptibility to PMB (MIC = 128 g/mL) (Table 2; Fig. 2). Through inhibition of Fusarium conidia germination with PMB, the potential for infection progression can be reduced. We further demonstrated that PMB can damage the cell membrane integrity of Fusarium strains owing to the finding that propidium iodide, a membrane-impermeable DNA stain, can penetrate Fusarium cells after treatment with PMB (Fig. 3; see Materials and methods in Supplementary information). The results indicate that PMB may target the cell membrane or cell wall. Meanwhile, the expression of four chitin synthesis genes (CHS1, CHS2, CHSV and CHS7) and a glucan synthase gene (FKS1) were determined in the presence or absence of PMB for two Fusarium strains with whole-genome sequences available (F. oxysporum f. sp. lycopersici 4287 and F. oxysporum FOSC 3-a). Only expression of the CHS1 gene was slightly increased ca. 1.5 fold (P < 0.001) upon PMB treatment in both F. oxysporum strains
Page 15 of 32
compared with the PMB-untreated F. oxysporum (Fig. 4; see Materials and methods in Supplementary information).
Formation of chlamydospores is a survival strategy for Fusarium in nature and these chlamydospores can germinate to infect plant hosts once the environment becomes appropriate. Nevertheless, whether PMB affects chlamydospore germination of various Fusarium spp. is unknown. Recently, Schäfer et al. demonstrated that F. oxysporum can form chlamydospore-like survival structures in mouse organs [38], and Schroers et al. isolated purple clustered chlamydospores of Fusarium lunatum from a human sinus cavity [39], indicating that Fusarium chlamydospores can form in mammalian hosts. Characterisation of the effects of PMB on chlamydospore germination might provide solutions to combat Fusarium infections in human or plant hosts. We tried to induce the formation of chlamydospores for 12 Fusarium strains with soil medium and found that only 2 plant pathogenic strains (F. oxysporum f. sp. lycopersici 4287 and F. oxysporum f. sp. cubense Foc-T14) formed chlamydospores. However, PMB did not affect the chlamydospore germination rate (Fig. 5; see Materials and methods in Supplementary information), indicating that the use of PMB against these two Fusarium strains infecting plants might be limited.
Page 16 of 32
3.4. Polymyxin B exhibits synergistic activity with posaconazole and potentiates the effect with fluconazole, voriconazole or amphotericin B against Fusarium strains Antifungal drug combination therapy is a promising strategy to thwart drug-resistant isolates and to reduce the required drug doses [40]. Previous studies demonstrated that PMB exerts synergistic antifungal activity with FLU against C. neoformans and C. glabrata, but only slight combination effects against A. fumigatus [18,20]. Based on Etest and time–kill assays, PMB and FLU exhibited synergistic activity against 54–60% of 35 C. glabrata isolates [18], suggesting that this combination is not effective in all C. glabrata isolates. We therefore tested for combination effects of PMB and existing drugs in the filamentous fungus Fusarium. Interestingly, PMB exhibited synergistic activity with PSC against two Fusarium isolates [F. oxysporum FOSC 3-a (FICI = 0.313) and F. verticillioides 7600 (FICI = 0.375)]. Furthermore, we found that the MIC of FLU is decreased from >64 g/mL to 1 g/mL (for 10/12 strains), of VRC from 16 g/mL to 0.25 g/mL (for 6/12 strains) and of AmB from 8 g/mL to 0.25 g/mL (for 1 strain, MCCF1600) when combined with PMB (Table 3), indicating that PMB can potentiate the effects of antifungal drugs. Nevertheless, PMB in combination with FLU or VRC had MICs similar to PMB alone (Table 3); thus, no synergistic activity was detected using chequerboard titration assays. We further found that the MICs of PMB can be lowered to 0.5 g/mL from 32 g/mL or higher when combined with AmB (Table 3). However, we did not observe synergistic activity between PMB and FLU, VRC or AmB against 12 Fusarium isolates (Table 3). Drug combinations (i.e. PMB vs. FLU, VRC or AmB) demonstrated FICIs >0.5 but 4 (Table 3), indicating no drug interactions between these
Page 17 of 32
combinations. The finding that no synergistic activity was observed between PMB and FLU may be partly attributed to the intrinsic tolerance of Fusarium spp. to FLU (MIC > 64 g/mL) (Table 3).
The current data suggest that drug–drug interactions between PMB and FLU might differ between yeasts (C. neoformans and C. glabrata) and filamentous fungi (Fusarium spp.). Further characterisation of drug–drug interaction differences in yeasts and filamentous fungi may provide intriguing insights into the mechanisms. Currently, most tests to evaluate combination effects between two drugs are conducted in vitro and in animal models, and more rigorous clinical trials should be done in order to confirm the experimental data and to provide potential treatment options.
4. Conclusions With limited options for antifungal treatments, it is challenging to combat infections caused by Fusarium spp. Currently, VRC and liposomal AmB remain the therapeutic options for clinical Fusarium infections. The current studies demonstrate that the antibiotic PMB exhibits fungicidal activity against 12 Fusarium strains infecting humans or plants. PMB is commercially available as an eye drop for the topical treatment of keratitis caused by bacterial pathogens [31,32]. Based on the findings in this report, we suggest that PMB potentially can be used in combination with PSC, with which it exhibits synergistic activity, or to increase the susceptibility of Fusarium spp. in response to FLU, VRC or AmB, although it does not show synergistic activity with these
Page 18 of 32
antifungal drugs. The mode of action of PMB against Fusarium strains is at least in part through inhibition of conidia germination. Future studies should focus on identifying the drug target(s) of PMB in Fusarium strains and synthesising more potent but less toxic PMB analogues for in vitro and animal therapeutic experiments.
Acknowledgments: The authors thank Drs James Swezey (United States Department of Agriculture), Hans VanEtten (University of Arizona, Tucson, AZ), Corby Kistler (University of Minnesota, Minneapolis–Saint Paul, MN), Pi-Fang Linda Chang (National Chung Hsing University, Taichung, Taiwan) and Tsai-Ling Yang Lauderdale (National Health Research Institutes, Zhunan, Taiwan) for providing strains. The authors also thank Ms Cecelia Wall for language editing.
Funding: This work was financially supported by the Ministry of Science & Technology [grants MOST 102-2320-B-002-041-MY2 and 104-2320-B-002-063-MY3] and the Bureau of Animal and Plant Health Inspection and Quarantine in Taiwan [104AS-10.7.3BQ-B1(5)].
Competing interests: None declared.
Ethical approval: Not required.
Page 19 of 32
References [1] Dananche C, Cassier P, Sautour M, Gautheron N, Wegrzyn J, Perraud M, et al. Fungaemia caused by Fusarium proliferatum in a patient without definite immunodeficiency. Mycopathologia 2015;179:135–40. [2] Nucci M, Anaissie E. Fusarium infections in immunocompromised patients. Clin Microbiol Rev 2007;20:695–704. [3] Chang DC, Grant GB, O'Donnell K, Wannemuehler KA, Noble-Wang J, Rao CY, et al. Multistate outbreak of Fusarium keratitis associated with use of a contact lens solution. JAMA 2006;296:953–63. [4] Broekaert N, Devreese M, De Baere S, De Backer P, Croubels S. Modified Fusarium mycotoxins unmasked: from occurrence in cereals to animal and human excretion. Food Chem Toxicol 2015;80:17–31. [5] Guzman-Cottrill JA, Zheng X, Chadwick EG. Fusarium solani endocarditis successfully treated with liposomal amphotericin B and voriconazole. Pediatr Infect Dis J 2004;23:1059–61. [6] Speeleveld E, Gordts B, Van Landuyt HW, De Vroey C, Raes-Wuytack C. Susceptibility of clinical isolates of Fusarium to antifungal drugs. Mycoses 1996;39:37–40. [7] Altun A, Kurna SA, Sengor T, Altun G, Olcaysu OO, Aki SF, et al. Effectiveness of posaconazole in recalcitrant fungal keratitis resistant to conventional antifungal drugs. Case Rep Ophthalmol Med 2014;2014:701653.
Page 20 of 32
[8] Ranawaka RR, Nagahawatte A, Gunasekara TA. Fusarium onychomycosis: prevalence, clinical presentations, response to itraconazole and terbinafine pulse therapy, and 1-year follow-up in nine cases. Int J Dermatol 2015;54:1275–82. [9] Chen KJ, Sun MH, Lai CC, Wu WC, Chen TL, Kuo YH, et al. Endophthalmitis caused by Pseudomonas aeruginosa in Taiwan. Retina 2011;31:1193–8. [10]
Chuang CC, Hsiao CH, Tan HY, Ma DH, Lin KK, Chang CJ, et al.
Staphylococcus aureus ocular infection: methicillin-resistance, clinical features, and antibiotic susceptibilities. PLoS One 2012;8:e42437. [11]
Stansly PG, Schlosser ME. Studies on polymyxin: isolation and
identification of Bacillus polymyxa and differentiation of polymyxin from certain known antibiotics. J Bacteriol 1947;54:549–56. [12]
Hancock RE. Peptide antibiotics. Lancet 1997;349:418–22.
[13]
Nation RL, Li J, Cars O, Couet W, Dudley MN, Kaye KS, et al. Framework
for optimisation of the clinical use of colistin and polymyxin B: the Prato polymyxin consensus. Lancet Infect Dis 2014:15:225–34. [14]
Parchuri S, Mohan S, Cunha BA. Extended spectrum -lactamase-
producing Klebsiella pneumoniae chronic ambulatory peritoneal dialysis peritonitis treated successfully with polymyxin B. Heart Lung 2005;34:360–3. [15]
Sarria JC, Angulo-Pernett F, Kimbrough RC, McVay CS, Vidal AM. Use of
intravenous polymyxin B during continuous venovenous hemodialysis. Eur J Clin Microbiol Infect Dis 2004;23:340–1. [16]
Deris ZZ, Akter J, Sivanesan S, Roberts KD, Thompson PE, Nation RL, et
al. A secondary mode of action of polymyxins against Gram-negative bacteria
Page 21 of 32
involves the inhibition of NADH-quinone oxidoreductase activity. J Antibiot (Tokyo) 2014;67:147–51. [17]
Ogita A, Nagao Y, Fujita K, Tanaka T. Amplification of vacuole-targeting
fungicidal activity of antibacterial antibiotic polymyxin B by allicin, an allyl sulfur compound from garlic. J Antibiot (Tokyo) 2007;60:511–8. [18]
Pankey G, Ashcraft D, Kahn H, Ismail A. Time–kill assay and Etest
evaluation for synergy with polymyxin B and fluconazole against Candida glabrata. Antimicrob Agents Chemother 2014;58:5795–800. [19]
Zhai B, Lin X. Evaluation of the anticryptococcal activity of the antibiotic
polymyxin B in vitro and in vivo. Int J Antimicrob Agents 2013;41:250–4. [20]
Zhai B, Zhou H, Yang L, Zhang J, Jung K, Giam CZ, et al. Polymyxin B, in
combination with fluconazole, exerts a potent fungicidal effect. J Antimicrob Chemother 2010;65:931–8. [21]
Ben-Ami R, Lewis RE, Tarrand J, Leventakos K, Kontoyiannis DP.
Antifungal activity of colistin against Mucorales species in vitro and in a murine model of Rhizopus oryzae pulmonary infection. Antimicrob Agents Chemother 2010;54:484–90. [22]
O'Donnell K, Sutton DA, Rinaldi MG, Magnon KC, Cox PA, Revankar SG,
et al. Genetic diversity of human pathogenic members of the Fusarium oxysporum complex inferred from multilocus DNA sequence data and amplified fragment length polymorphism analyses: evidence for the recent dispersion of a geographically widespread clonal lineage and nosocomial origin. J Clin Microbiol 2004;42:5109–20.
Page 22 of 32
[23]
Lin Y-H, Chang J-Y, Liu E-T, Chao C-P, Huang J-W, Chang P-FL.
Development of a molecular marker for specific detection of Fusarium oxysporum f. sp. cubense race 4. Eur J Plant Pathol 2009;123:353–65. [24]
Ma LJ, van der Does HC, Borkovich KA, Coleman JJ, Daboussi MJ, Di
Pietro A, et al. Comparative genomics reveals mobile pathogenicity chromosomes in Fusarium. Nature 2010;464:367–73. [25]
Ma LJ, Shea T, Young S, Zeng Q, Kistler HC. Genome sequence of
Fusarium oxysporum f. sp. melonis strain NRRL 26406, a fungus causing wilt disease on melon. Genome Announc 2014;2:pii: e00730-14. [26]
Coleman JJ, Rounsley SD, Rodriguez-Carres M, Kuo A, Wasmann CC,
Grimwood J, et al. The genome of Nectria haematococca: contribution of supernumerary chromosomes to gene expansion. PLoS Genet 2009;5:e1000618. [27]
Cuomo CA, Guldener U, Xu JR, Trail F, Turgeon BG, Di Pietro A, et al.
The Fusarium graminearum genome reveals a link between localized polymorphism and pathogen specialization. Science 2007;317:1400–2. [28]
Clinical and Laboratory Standards Institute. Reference method for broth
dilution antifungal susceptibility testing of filamentous fungi; approved standard— second edition. Document M38-A2. Wayne, PA: CLSI; 2008. [29]
Odds FC. Synergy, antagonism, and what the chequerboard puts between
them. J Antimicrob Chemother 2003;52:1.
Page 23 of 32
[30]
Dijksterhuis J, Sanders M, Gorris LG, Smid EJ. Antibiosis plays a role in
the context of direct interaction during antagonism of Paenibacillus polymyxa towards Fusarium oxysporum. J Appl Microbiol 1999;86:13–21. [31]
Bosscha MI, van Dissel JT, Kuijper EJ, Swart W, Jager MJ. The efficacy
and safety of topical polymyxin B, neomycin and gramicidin for treatment of presumed bacterial corneal ulceration. Br J Ophthalmol 2004;88:25–8. [32]
Tajima K, Miyake T, Koike N, Hattori T, Kumakura S, Yamaguchi T, et al.
In vivo challenging of polymyxins and levofloxacin eye drop against multidrugresistant Pseudomonas aeruginosa keratitis. J Infect Chemother 2014;20:343–9. [33]
Ly NS, Bulman ZP, Bulitta JB, Baron C, Rao GG, Holden PN, et al.
Optimization of polymyxin B in combination with doripenem to combat mutator Pseudomonas aeruginosa. Antimicrob Agents Chemother 2016;60:2870–80. [34]
Pfaller MA, Sheehan DJ, Rex JH. Determination of fungicidal activities
against yeasts and molds: lessons learned from bactericidal testing and the need for standardization. Clin Microbiol Rev 2004;17:268–80. [35]
Justo JA, Bosso JA. Adverse reactions associated with systemic
polymyxin therapy. Pharmacotherapy 2015;35:28–33. [36]
Grau-Campistany A, Manresa Á, Pujol M, Rabanal F, Cajal Y. Tryptophan-
containing lipopeptide antibiotics derived from polymyxin B with activity against Gram positive and Gram negative bacteria. Biochim Biophys Acta 2016;1858:333–43.
Page 24 of 32
[37]
Rabanal F, Grau-Campistany A, Vila-Farres X, Gonzalez-Linares J,
Borras M, Vila J, et al. A bioinspired peptide scaffold with high antibiotic activity and low in vivo toxicity. Sci Rep 2015;5:10558. [38]
Schäfer K, Di Pietro A, Gow NA, MacCallum D. Murine model for
Fusarium oxysporum invasive fusariosis reveals organ-specific structures for dissemination and long-term persistence. PLoS One 2014;9:e89920. [39]
Schroers HJ, O'Donnell K, Lamprecht SC, Kammeyer PL, Johnson S,
Sutton DA, et al. Taxonomy and phylogeny of the Fusarium dimerum species group. Mycologia 2009;101:44–70. [40]
Chang YL, Yu SJ, Heitman J, Wellington M, Chen YL. New facets of
antifungal therapy. Virulence 2017;8:222–36.
Page 25 of 32
Fig. 1. Polymyxin B (PMB) exhibits fungicidal activity against Fusarium strains infecting humans and plants. A total of 104 conidia/mL without or with PMB treatment at the concentration indicated was incubated in 5 mL of RPMI 1640 liquid medium for 72 h at 35 C. Mycelia were collected and were smeared on a slide after treatment with 0.01% methylene blue solution for 5 min at room temperature. Samples were washed twice with dH2O and were observed at a magnification of 400. Numbers in white rectangles indicate the minimum inhibitory concentration (MIC) in g/mL of the respective strain. Scale bar = 25 m.
Fig. 2. Polymyxin B (PMB) inhibits conidia germination of Fusarium strains. (A) Fusarium strains were grown in liquid medium without or with 8 g/mL PMB and were incubated at 35 C for 10 h before microscopic observation at a magnification of 400. (B) Conidia germination rates from (A) were plotted using GraphPad Prism 5.01 (GraphPad Software Inc., La Jolla, CA). Germination was defined as the presence of a thin germ tube longer than its respective conidium. The germination rate was calculated by randomly counting 50 conidia from each of three independent experiments. * P < 0.05; ** P < 0.01 based on Student’s t-test analysis. Scale bar = 50 m.
Fig. 3. Polymyxin B (PMB) damages Fusarium strains. Conidia of Fusarium strains were incubated in RPMI 1640 medium in the absence or presence of PMB at their respective minimum inhibitory concentrations (MICs) at 35 C for 10 h. Following harvest, germlings were stained with propidium iodide and were observed under
Page 26 of 32
fluorescence at a magnification of 400 or 1000. Numbers in white rectangles indicate the minimum inhibitory concentration (MIC) in g/mL of the respective strain. Scale bar = 10 m.
Fig, 4. Expression of the Fusarium CHS1 gene is slightly affected by polymyxin B (PMB). Conidia of Fusarium oxysporum f. sp. lycopersici 4287 and F. oxysporum FOSC 3-a were incubated in RPMI 1640 medium in the absence or presence of 8 g/mL PMB at 35 C for 10 h and were harvested for RNA extraction. RNA was reverse transcribed to cDNA. Quantitative PCR (qPCR) was performed as described in the Materials and methods in the Supplementary information. * Significant difference at P < 0.001 based on two-way analysis of variance (ANOVA) and Bonferroni's multiple comparison test.
Fig. 5. The germination rate of chlamydospores produced by Fusarium oxysporum f. sp. cubense (Foc-T14) or lycopersici (4287) was not inhibited by polymyxin B (PMB). (A) Chlamydospores of Fusarium strains Foc-T14 and 4287 were collected from soil medium and were transferred to RPMI medium with 0, 8 or 16 g/mL PMB. Chlamydospores were incubated at 35 C for 10 h before microscopic observation at a magnification of 400. Red arrows indicate germinated chlamydospores. Scale bar = 50 m. (B) Chlamydospore germination rates from (A) were plotted using GraphPad Prism 5.01 (GraphPad Software Inc., La Jolla, CA). The germination rate was calculated by randomly counting 50 chlamydospores from each of three independent experiments. There was no significant difference between the germination rate among all
Page 27 of 32
concentrations of PMB based on one-way analysis of variance (ANOVA) and Bonferroni's multiple comparison test.
Page 28 of 32
Table 1. Fusarium strains used in this study Strain
Isolate
Host
Reference
Fusarium solani
MCCF1600
Human (skin)
This study
F. solani
Fungus III-6
Human (eye)
This study
Fusarium falciforme
MCCF2106
Human (eye)
This study
Fusarium oxysporum
FOSC 3-a
Human (blood) [22]
F. oxysporum
MCCF2074
Human (blood) This study
Fusarium sp.
MCCF2036
Human (hand)
This study
F. oxysporum f. sp. cubense
Foc-T14
Banana
[23]
F. oxysporum f. sp. lycopersici 4287
Tomato
[24]
F. oxysporum f. sp. melonis
NRRL26406
Melon
[25]
F. solani
MPVI 77-13-4 Pea
[26]
Fusarium graminearum
PH-1
Wheat
[27]
Fusarium verticillioides
7600
Maize
[24]
Page 29 of 32
Table 2. Minimum inhibitory concentrations (MICs) and minimum fungicidal concentrations (MFCs) of polymyxin B for 12 Fusarium strains Strain
MIC (g/mL) MFC (g/mL)
Fusarium solani (MCCF1600)
64
128
F. solani (Fungus III-6)
32
32
Fusarium falciforme (MCCF2106)
32
32
Fusarium oxysporum (FOSC 3-a)
128
256
F. oxysporum (MCCF2074)
32
128
Fusarium sp. (MCCF2036)
32
64
F. oxysporum f. sp. cubense (Foc-T14)
32
64
F. oxysporum f. sp. lycopersici (4287)
32
64
F. oxysporum f. sp. melonis (NRRL26406) 32
64
F. solani (MPVI 77-13-4)
16
16
Fusarium graminearum (PH-1)
16
32
Fusarium verticillioides (7600)
128
256
Page 30 of 32
Table 3. Synergistic antifungal activity between polymyxin B (PMB) and fluconazole (FLU), voriconazole (VRC), posaconazole (PSC) and amphotericin B (AmB) against 12 Fusarium strains Strain
MIC alone (g/mL) PMB FLU VRC PSC
MCCF1600
64
>64
16
>16
AmB PMB, 8
PMB,
PMB,
PMB,
PMB +
PMB +
PMB +
PMB +
FLU
VRC
PSC
AmB
FLU
VRC
PSC
AmB
32, 64
32,
32,
32,
1
0.516
0.508
0.531
0.5, 2
0.508
0.516
1.008
0.516
0.5, 2
0.508
0.516
1.008
0.516
32, 2
0.5, 8
0.508
0.531
0.313
1.004
0.25 MCCF2106
32
>64
16
>16
4
16, 1
16, 0.25
Fungus III-6
32
>64
16
>16
4
16, 1
16, 0.25
FOSC 3-a
128
>64
8
FICI a
MIC combined (g/mL)
>16
8
64, 1
64,
0.25 32,
0.25
0.25 32, 0.25
0.25 MCCF2074
32
>64
4
>16
8
32, 1
0.5, 4
16, 2
0.5, 8
1.016
1.016
0.563
1.016
MCCF2036
32
>64
8
>16
2
16, 64
16,
16,
0.5, 1
1
0.531
0.516
0.516
32,
1.008
1.063
1.008
1.063
1.008
1.016
1.008
1.016
0.25 Foc-T-14
32
>64
4
>16
4
32, 1
32, 0.25
4287
32
>64
16
>16
8
32, 1
32, 0.25
0.25 32, 0.25 32,
0.25 0.5, 8
0.25
Page 31 of 32
NRRL26406
32
>64
8
>16
8
32, 1
16, 0.25
MPVI 77-13- 16
>64
16
>16
2
16, 1
4 PH-1
16, 0.25
16
>64
16
>16
1
16, 1
16,
32,
128
>64
1
1
16
64, 1
64, 0.25
1.008
0.531
1.008
1.016
8, 0.5
1.016
1.016
1.008
0.75
0.508
1.016
0.508
0.531
0.75
0.375
1.004
0.25 16, 0.25 8, 0.25 0.5,
0.25 7600
0.5, 8
0.5 16,
0.5, 16 0.508
0.25
MIC, minimum inhibitory concentration; FICI, fractional inhibitory concentration index. a
FICI ≤ 0.5, synergy; FICI >0.5 but ≤4, no interaction; FICI > 4, antagonism.
Page 32 of 32
S0924-8579(17)30118-8 http://dx.doi.org/doi: 10.1016/j.ijantimicag.2017.01.029 ANTAGE 5080
To appear in:
International Journal of Antimicrobial Agents
Received date: Accepted date:
28-7-2016 28-1-2017
Please cite this article as: Li-Hang Hsu, Hsuan-Fu Wang, Pei-Lun Sun, Fung-Rong Hu, YingLien Chen, The antibiotic polymyxin B exhibits novel antifungal activity against fusarium species, International Journal of Antimicrobial Agents (2017), http://dx.doi.org/doi: 10.1016/j.ijantimicag.2017.01.029. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
The antibiotic polymyxin B exhibits novel antifungal activity against Fusarium species
Li-Hang Hsu a, Hsuan-Fu Wang a, Pei-Lun Sun b, Fung-Rong Hu c, Ying-Lien Chen a,*
a
Department of Plant Pathology and Microbiology, National Taiwan University, No. 1,
Sec. 4, Roosevelt Road, Taipei 10617, Taiwan b c
Department of Dermatology, Chang Gung Memorial Hospital, Linkou, Taiwan Department of Ophthalmology, National Taiwan University Hospital, Medical College,
National Taiwan University, Taipei, Taiwan
* Corresponding author. Tel.: +886 2 3366 1763; fax: +886 2 363 6490. E-mail address: [email protected] (Y.-L. Chen).
ARTICLE INFO Article history: Received 28 July 2016 Accepted 28 January 2017
Keywords: Polymyxin B Fusarium
Page 1 of 32
Antibiotic Antifungal
Page 2 of 32
Highlights
Polymyxin B (PMB) exhibits novel antifungal activity against Fusarium spp.
PMB exhibits fungicidal activity against Fusarium spp.
Conidia, but not chlamydospore, germination of Fusarium strains is inhibited by PMB.
PMB exhibits synergistic activity with posaconazole against Fusarium spp.
PMB can potentiate the effect of fluconazole, voriconazole or amphotericin B against Fusarium spp.
ABSTRACT The genus Fusarium comprises many species, including Fusarium oxysporum, Fusarium solani, Fusarium graminearum and Fusarium verticillioides, and causes severe infections in plants and humans. In clinical settings, Fusarium is the third most frequent mould to cause invasive fungal infections after Aspergillus and the Mucorales. Fusarium solani and F. oxysporum are the most prevalent Fusarium spp. causing clinical disease. However, few effective antifungal drugs are available to treat human and plant Fusarium infections. The cationic peptide antibiotic polymyxin B (PMB) exhibits antifungal activity against the human fungal pathogens Candida albicans and Cryptococcus neoformans, but its efficacy against Fusarium spp. is unknown. In this study, the antifungal activity of PMB was tested against 12 Fusarium strains that infect humans and plants (banana, tomato, melon, pea, wheat and maize). PMB was fungicidal against all 12 Fusarium strains, with minimum fungicidal concentrations of 32 g/mL or 64 g/mL for most strains tested, as evidenced by broth dilution, methylene
Page 3 of 32
blue staining and XTT reduction assays. PMB can reduce the germination rates of conidia, but not chlamydospores, and can cause defects in cell membrane integrity in Fusarium strains. PMB exhibits synergistic activity with posaconazole and can potentiate the effect of fluconazole, voriconazole or amphotericin B against Fusarium spp. However, PMB does not show synergistic effects with fluconazole against Fusarium spp. as it does against Candida glabrata and C. neoformans, indicating evolutionary divergence of mechanisms between yeast pathogens and the filamentous fungus Fusarium.
Page 4 of 32
1. Introduction Fusarium is a large genus of filamentous fungi that is widely distributed in soil, plants and other organic substrates. Fusarium spp., most importantly Fusarium oxysporum but also Fusarium graminearum, Fusarium verticillioides and Fusarium solani, are important plant fungal pathogens that cause various diseases such as Panama disease of banana, Fusarium wilt of tomato and head blight of wheat. In humans, Fusarium can cause superficial infections such as keratitis and onychomycosis as well as disseminated infections such as fungaemia, with the latter occurring mainly in immunosuppressed patients and extremely rarely in immunocompetent individuals [1,2]. In 2006, a multistate outbreak of keratitis was associated with Fusarium-contaminated contact lens solution [3]. Fusarium spp. that produce mycotoxins (e.g. trichothecene and fumonisin) can cause mycotoxicosis and result in organ toxicity or defective reproductive function in humans and animals following ingestion of contaminated food [4]. So far, effective treatment and control strategies for Fusarium spp. that infect humans or plants are unknown.
Current methods and fungicides are insufficient to eliminate plant diseases caused by Fusarium spp. and few antifungal drugs are effective against human Fusarium infections. Amphotericin B (AmB) and voriconazole (VRC) alone or in combination have been frequently used to treat human diseases caused by Fusarium spp. [5]. Notably, although fluconazole (FLU) is a commonly used azole against fungal pathogens, it does not exhibit antifungal activity against Fusarium spp. [6]. Recently, scientific studies revealed that posaconazole (PSC) is effective against recalcitrant Fusarium keratitis or
Page 5 of 32
peritonitis [7]. Meanwhile, both itraconazole and terbinafine pulse therapy, usually used to treat Trichophyton onychomycosis, are only partially effective against Fusarium onychomycosis [8], suggesting a need to seek more efficacious drugs to combat Fusarium infections. In addition to Fusarium spp., several bacterial pathogens such as Staphylococcus aureus and Pseudomonas aeruginosa can also cause keratitis or endophthalmitis in humans [9,10]. Therefore, a drug that targets both Fusarium and bacterial pathogens will be useful.
Polymyxins comprise a class of antibiotics that were discovered from the secreted compounds of Paenibacillus polymyxa in 1947 and are further classified into chemically distinct compounds known as polymyxins A, B, C, D and E [11]. Only polymyxin B (PMB) and polymyxin E (colistin) have been used in clinical practice to treat infections caused by Gram-negative bacteria such as Acinetobacter baumannii, Klebsiella pneumoniae and P. aeruginosa, but these were abandoned in the early 1980s when more effective and less toxic drugs became available [12]. However, in recent years, PMB and colistin have been increasingly used to treat drug-resistant bacterial infections and have served as a last-line treatment choice [13]. For instance, patients infected with drug-resistant A. baumannii or K. pneumoniae can be successfully treated with intravenous PMB but not with amikacin or meropenem [14,15]. PMB has high affinity for the lipopolysaccharide constituent of the bacterial outer membrane, thus increasing the permeability of the membrane. PMB also inhibits the activity of type II NADH-quinone oxidoreductase of Gram-negative bacteria [16]. In addition to the above-described modes of action for PMB, it also has vacuole-targeting fungicidal activity against the
Page 6 of 32
baker’s yeast Saccharomyces cerevisiae, and the inhibitory activity can be enhanced with allicin, an allyl-sulfur compound in garlic [17]. In the 1970s, PMB was noted to exhibit antifungal activity against Candida tropicalis, Candida albicans and S. cerevisiae, although at relatively high concentrations, and in recent years PMB has been found to exhibit antifungal activity or synergy with existing drugs such as FLU or itraconazole against some human fungal pathogens, including Candida glabrata, Cryptococcus neoformans and Aspergillus fumigatus [18–20].
Although PMB alone does not inhibit A. fumigatus, with a minimum inhibitory concentration (MIC) of >1000 g/mL, the addition of itraconazole can exert combination effects against A. fumigatus [20]. However, it is unclear whether PMB is effective alone or can be combined with existing drugs to be effective against Fusarium spp. Notably, PMB is not the only cationic polypeptide antibiotic against fungal pathogens; colistin has also been reported to show antifungal activity against Mucorales species [21].
In this study, the potential antifungal activity of PMB was tested against six Fusarium strains infecting humans and six Fusarium strains infecting plants. The results demonstrated that PMB exhibits antifungal activity, although at relatively high concentrations with MICs between 16 g/mL and 128 g/mL for different Fusarium spp. and with minimum fungicidal concentrations (MFCs) ranging from 16 g/mL to 256 g/mL. PMB was also found to potentiate the effects of FLU, VRC and AmB against Fusarium spp. In contrast to the synergistic effects observed between PMB and FLU against C. neoformans and C. glabrata, similar synergy between PMB and FLU or VRC
Page 7 of 32
was not observed against 12 Fusarium strains, indicating divergence of synergistic functions between PMB and triazoles on yeast pathogens such as Candida or Cryptococcus and the filamentous pathogen Fusarium. Notably, Fusarium can cause keratitis and PMB can be formulated for ophthalmic use, indicating a potential use of PMB against Fusarium keratitis.
2. Materials and methods 2.1. Strains, growth media and chemicals The 12 Fusarium strains used in this study are shown in Table 1. Previously unpublished Fusarium strains include isolates MCCF1600, MCCF2106, Fungus III-6, MCCF2074 and MCCF2036, which were isolated from patients in Taiwanese hospitals. These strains were identified by internal transcribed spacer (ITS) sequencing with primers JC727 (TCCTCCGCTTATTGATATGC) and JC728 (GGAAGTAAAAGTCGTAACAAGG), elongation factor 1 sequencing with primers JC1189 [ATGGGTAAGGA(A/G)GACAAGAC] and JC1190 [GGA(G/A)GTACCAGT(G/C)ATCATGTT], and searching for all Fusarium spp. in the Fusarium multilocus sequence typing (MLST) database (http://www.cbs.knaw.nl/fusarium/defaultinfo.aspx?page=home) and Fusarium Comparative Genome Project database (http://www.broadinstitute.org/annotation/genome/fusarium_group/MultiHome.html). Strain MCCF2036 was identified as genus Fusarium, but because it shares only 87.69% similarity with Fusarium cuneirostrum and is possibly a new species, this remains to be
Page 8 of 32
confirmed. Media used in this study included potato dextrose agar (PDA) (0.4% potato from infusion, 2% dextrose, 1.5% agar) (BioShop, Burlington, ON, Canada), RPMI 1640 medium [8.4 g of RPMI 1640 (Sigma-Aldrich, St Louis, MO), 34.5 g of 3-(Nmorpholino)propanesulfonic acid (MOPS) (GeneMark, Taichung, Taiwan) and 2% glucose (BioShop) in 1 L of distilled water (pH 7.0) adjusted by NaOH pellets]. Agar plates were solidified with 2% agar (BioShop). The following antifungal agents were used: polymyxin B sulfate (PMB) (BioShop); fluconazole (FLU) (Selleckchem, Houston, TX); voriconazole (VRC) (Sigma-Aldrich); and amphotericin B (AmB) (Sigma-Aldrich).
2.2. Conidia solution preparation All Fusarium strains were streaked on ½ PDA plates (0.2% potato from infusion, 1% dextrose, 1.5% agar) and were incubated at 28 C for 5–7 days. Conidia were then collected by scraping the agar surface and resuspending the conidia in sterile dH2O. The concentration of the freshly collected conidia solution was calculated with a haemocytometer and was diluted appropriately for further experiments.
2.3. Determination of conidia germination rate Each freshly collected Fusarium conidia solution was incubated in 3 mL of RPMI 1640 medium at 106 conidia/mL at 35 C for 10 h and was then treated without or with PMB at 8 g/mL. Following incubation, the supernatant was removed by centrifugation (3500 rpm for 10 min) and the pellet containing germinated conidia was resuspended in 2% Tween 20 (Polysorbate 20, Sigma-Aldrich) and was observed under a microscope.
Page 9 of 32
Germination was noted when a thin germ tube was longer than its respective conidium. The germination rate was calculated by randomly counting 50 conidia from each of three independent experiments. To compare conidia germination rates between groups, statistical analyses (Student’s unpaired t-test) were conducted using GraphPad Prism 5.01 software (GraphPad Software Inc., La Jolla, CA). Statistical significance was set at P < 0.05.
2.4. Determination of minimum inhibitory concentrations The susceptibility of 12 Fusarium strains to PMB was tested according to the protocol of the Clinical and Laboratory Standards Institute (CLSI) [28]. For filamentous fungi, twofold serial dilutions of PMB were prepared in 100 L of RPMI 1640 medium in 96-well microtitre plates (Becton Dickinson, Durham, NC). The final concentrations of PMB after addition of freshly prepared Fusarium conidia ranged from 0.5 g/mL to 256 g/mL. Conidia of Fusarium strains collected as described above and resuspended in RPMI 1640 media were adjusted to 104 conidia/mL and then 100 L (103 conidia) was added to the RPMI 1640 medium (100 L) containing serial concentrations of PMB. After addition of the Fusarium strain to the RPMI medium containing PMB at the concentrations indicated, all microtitre plates were incubated at 35 C for 48 h and the MIC was determined as the lowest drug concentration showing no visible growth. Three replicate experiments were performed.
Page 10 of 32
2.5. Determination of fractional inhibitory concentration indices (FICIs) FICIs of drug interactions were determined by chequerboard titration assays. Freshly collected conidia of 12 Fusarium strains were diluted to 104 conidia/mL with RPMI medium and then 100 L (103 conidia) was added to each well in a 96-well plate format. The drugs to be assessed were two-fold serially diluted in RPMI medium and then 50 L of each drug was added to the wells containing conidia, yielding a total volume of 200 L per well. PMB at concentrations ranging from 0.5 g/mL to 256 g/mL was added across the plate with the highest concentration in the left-most well and the lowest concentration in the right-most wells. FLU, VRC or AmB was added from top to bottom, with the highest concentration in the top row and the lowest in the bottom. FLU concentrations ranged from 1–64 g/mL, whilst both VRC and AmB concentrations ranged from 0.25–16 g/mL. This strategy allowed for 70 different drug combinations to be tested on one plate. The plates were incubated at 35 C for 48 h. The MIC of drugs, either alone or in combination, was defined as the lowest concentration of each drug that completely inhibited growth as detected by the unaided eye. The FICI was calculated by the following formula: FICI = [(MIC of drug A combined)/(MIC of drug A alone)] + [(MIC of drug B combined)/(MIC of drug B alone)] [29]. For calculation purposes, an MIC > 64 g/mL was assumed to be 128 g/mL.
Page 11 of 32
3. Results and discussion 3.1. Polymyxin B exhibits novel antifungal activity against Fusarium species Based on previous studies of PMB against human fungal pathogens such as Candida and Cryptococcus [18,20] and the findings that cell-free filtrates of P. polymyxa (from which PMB was originally isolated) can inhibit the plant pathogenic fungus F. oxysporum [30], we hypothesised that PMB has anti-Fusarium activity. Indeed, based on initial determination of MICs, PMB exhibited antifungal activity against 12 Fusarium strains that infect humans or plants (Tables 1 and 2). The MICs of PMB against 12 Fusarium strains ranged from 16 g/mL to 128 g/mL (Table 2). Among the six Fusarium spp. isolated from humans, four Fusarium isolates, including a F. solani isolate (Fungus III-6), a Fusarium falciforme isolate (MCCF2106), a F. oxysporum isolate (MCCF2074) and a Fusarium sp. isolate (MCCF2036), demonstrated the greatest susceptibility with MICs of 32 g/mL, whilst F. oxysporum FOSC 3-a exhibited the lowest susceptibility to PMB with an MIC of 128 g/mL (Table 2). There was a fourfold difference in MICs between F. oxysporum FOSC 3-a and F. oxysporum MCCF2074, whilst MICs were within a two-fold difference between two F. solani isolates (MCCF1600 and Fungus III-6) (Table 2). Among six plant-infecting Fusarium spp., peainfecting F. solani (MPVI 77-13-4) and wheat-infecting F. graminearum (PH-1) were the most susceptible to PMB with MICs of 16 g/mL, whilst maize-infecting F. verticillioides (7600) was the least susceptible to PMB with an MIC of 128 g/mL, showing an eightfold difference between these Fusarium spp. and indicating that the susceptibility of Fusarium to PMB depends on the species. Within the same F. oxysporum species but
Page 12 of 32
different formae speciales (f. sp.) that infect plants (Foc-T14, 4287 and NRRL26406), the MICs were all 32 g/mL (Table 2).
The susceptibility of the Fusarium genus to PMB varies approximately eight-fold (i.e. 16 g/mL vs. 128 g/mL) based on the limited number of strains tested. Even within the same F. oxysporum or F. solani species, the MIC can differ approximately four-fold (i.e. F. oxysporum MCCF2074 versus FOSC 3-a; F. solani MPVI 77-13-4 versus MCCF1600), indicating that evolutionary adaption to drug tolerance has diverged among Fusarium strains. Further investigation on more Fusarium strains in a species will provide more extensive findings, and studying the mechanisms of the susceptibility difference among Fusarium strains may identify genes or gene clusters involved in drug tolerance to PMB.
In addition to bacterial pathogens, Fusarium isolates (such as Fungus III-6 and MCCF2106) can also cause keratitis, and mixed infections may result in therapeutic challenges. Currently, PMB can be used for the topical treatment of keratitis caused by bacterial pathogens [31,32]. In the future, patients with keratitis caused both by bacterial pathogens and Fusarium might be treated with PMB or its less toxic but more potent derivatives after acquiring detailed data of the pharmacokinetics and pharmacodynamics of PMB. However, the MIC for Fusarium spp. (16 g/mL or 32 g/mL for most strains) and P. aeruginosa (ca. 1 g/mL) [33] are ca. 16- to 32-fold different, which may pose a challenge in determining the best dose of PMB against bacterial and Fusarium co-infections.
Page 13 of 32
3.2. Polymyxin B exhibits fungicidal activity against Fusarium species It is unclear whether PMB exhibits fungistatic or fungicidal activity against Fusarium spp. based on MIC determination. Therefore, we first used a CLSI broth dilution and spotting assay to determine the MFC. PMB exhibited fungicidal activity against 12 Fusarium strains with MFCs ranging from 16 g/mL to 256 g/mL (Table 2). These MFCs were less than or equal to four-fold their respective MICs (Table 2) and thus were considered to be the lowest drug concentrations to kill Fusarium strains [34]. Then, 0.01% methylene blue was used to stain 12 Fusarium strains after exposure to PMB at their respective MICs (Fig. 1). Fusarium strains treated with PMB were readily stained with methylene blue in contrast to the unstained PMB-untreated controls, suggesting that PMB is fungicidal (Fig. 1). In addition to using CLSI broth dilution and methylene blue staining to test the fungicidal activity of PMB, an XTT-based method was adapted to confirm the MFC. MFCs determined by the XTT-based method were consistent with broth dilution and methylene blue stain assays (Table 2).
Based on the above data, PMB demonstrated novel antifungal activity against Fusarium strains (Table 2; Fig. 1); however, it carries relatively high toxicity in mammals [35]. One can synthesise non-toxic or less toxic derivatives in order to reduce the toxicity of PMB. Several PMB derivatives with broad-spectrum antimicrobial activity against Gramnegative bacteria and Gram-positive S. aureus isolates have been synthesised recently [36,37] and these novel derivatives exhibit low toxicity in mammalian cell cultures
Page 14 of 32
compared with PMB. In the future, it will be intriguing to test whether these derivatives maintain anti-Fusarium activity and exhibit potential therapeutic function in animal models.
3.3. Conidia, but not chlamydospore, germination of Fusarium strains is inhibited by polymyxin B Identification of compounds that block the formation of the conidia germ tube will aid in further antifungal drug development. Here we demonstrated that PMB at 8 g/mL can inhibit conidia germ tube formation of most Fusarium strains (Fig. 2A,B). However, we did not observe obvious inhibition of conidia germination in F. verticillioides owing to its relatively lower susceptibility to PMB (MIC = 128 g/mL) (Table 2; Fig. 2). Through inhibition of Fusarium conidia germination with PMB, the potential for infection progression can be reduced. We further demonstrated that PMB can damage the cell membrane integrity of Fusarium strains owing to the finding that propidium iodide, a membrane-impermeable DNA stain, can penetrate Fusarium cells after treatment with PMB (Fig. 3; see Materials and methods in Supplementary information). The results indicate that PMB may target the cell membrane or cell wall. Meanwhile, the expression of four chitin synthesis genes (CHS1, CHS2, CHSV and CHS7) and a glucan synthase gene (FKS1) were determined in the presence or absence of PMB for two Fusarium strains with whole-genome sequences available (F. oxysporum f. sp. lycopersici 4287 and F. oxysporum FOSC 3-a). Only expression of the CHS1 gene was slightly increased ca. 1.5 fold (P < 0.001) upon PMB treatment in both F. oxysporum strains
Page 15 of 32
compared with the PMB-untreated F. oxysporum (Fig. 4; see Materials and methods in Supplementary information).
Formation of chlamydospores is a survival strategy for Fusarium in nature and these chlamydospores can germinate to infect plant hosts once the environment becomes appropriate. Nevertheless, whether PMB affects chlamydospore germination of various Fusarium spp. is unknown. Recently, Schäfer et al. demonstrated that F. oxysporum can form chlamydospore-like survival structures in mouse organs [38], and Schroers et al. isolated purple clustered chlamydospores of Fusarium lunatum from a human sinus cavity [39], indicating that Fusarium chlamydospores can form in mammalian hosts. Characterisation of the effects of PMB on chlamydospore germination might provide solutions to combat Fusarium infections in human or plant hosts. We tried to induce the formation of chlamydospores for 12 Fusarium strains with soil medium and found that only 2 plant pathogenic strains (F. oxysporum f. sp. lycopersici 4287 and F. oxysporum f. sp. cubense Foc-T14) formed chlamydospores. However, PMB did not affect the chlamydospore germination rate (Fig. 5; see Materials and methods in Supplementary information), indicating that the use of PMB against these two Fusarium strains infecting plants might be limited.
Page 16 of 32
3.4. Polymyxin B exhibits synergistic activity with posaconazole and potentiates the effect with fluconazole, voriconazole or amphotericin B against Fusarium strains Antifungal drug combination therapy is a promising strategy to thwart drug-resistant isolates and to reduce the required drug doses [40]. Previous studies demonstrated that PMB exerts synergistic antifungal activity with FLU against C. neoformans and C. glabrata, but only slight combination effects against A. fumigatus [18,20]. Based on Etest and time–kill assays, PMB and FLU exhibited synergistic activity against 54–60% of 35 C. glabrata isolates [18], suggesting that this combination is not effective in all C. glabrata isolates. We therefore tested for combination effects of PMB and existing drugs in the filamentous fungus Fusarium. Interestingly, PMB exhibited synergistic activity with PSC against two Fusarium isolates [F. oxysporum FOSC 3-a (FICI = 0.313) and F. verticillioides 7600 (FICI = 0.375)]. Furthermore, we found that the MIC of FLU is decreased from >64 g/mL to 1 g/mL (for 10/12 strains), of VRC from 16 g/mL to 0.25 g/mL (for 6/12 strains) and of AmB from 8 g/mL to 0.25 g/mL (for 1 strain, MCCF1600) when combined with PMB (Table 3), indicating that PMB can potentiate the effects of antifungal drugs. Nevertheless, PMB in combination with FLU or VRC had MICs similar to PMB alone (Table 3); thus, no synergistic activity was detected using chequerboard titration assays. We further found that the MICs of PMB can be lowered to 0.5 g/mL from 32 g/mL or higher when combined with AmB (Table 3). However, we did not observe synergistic activity between PMB and FLU, VRC or AmB against 12 Fusarium isolates (Table 3). Drug combinations (i.e. PMB vs. FLU, VRC or AmB) demonstrated FICIs >0.5 but 4 (Table 3), indicating no drug interactions between these
Page 17 of 32
combinations. The finding that no synergistic activity was observed between PMB and FLU may be partly attributed to the intrinsic tolerance of Fusarium spp. to FLU (MIC > 64 g/mL) (Table 3).
The current data suggest that drug–drug interactions between PMB and FLU might differ between yeasts (C. neoformans and C. glabrata) and filamentous fungi (Fusarium spp.). Further characterisation of drug–drug interaction differences in yeasts and filamentous fungi may provide intriguing insights into the mechanisms. Currently, most tests to evaluate combination effects between two drugs are conducted in vitro and in animal models, and more rigorous clinical trials should be done in order to confirm the experimental data and to provide potential treatment options.
4. Conclusions With limited options for antifungal treatments, it is challenging to combat infections caused by Fusarium spp. Currently, VRC and liposomal AmB remain the therapeutic options for clinical Fusarium infections. The current studies demonstrate that the antibiotic PMB exhibits fungicidal activity against 12 Fusarium strains infecting humans or plants. PMB is commercially available as an eye drop for the topical treatment of keratitis caused by bacterial pathogens [31,32]. Based on the findings in this report, we suggest that PMB potentially can be used in combination with PSC, with which it exhibits synergistic activity, or to increase the susceptibility of Fusarium spp. in response to FLU, VRC or AmB, although it does not show synergistic activity with these
Page 18 of 32
antifungal drugs. The mode of action of PMB against Fusarium strains is at least in part through inhibition of conidia germination. Future studies should focus on identifying the drug target(s) of PMB in Fusarium strains and synthesising more potent but less toxic PMB analogues for in vitro and animal therapeutic experiments.
Acknowledgments: The authors thank Drs James Swezey (United States Department of Agriculture), Hans VanEtten (University of Arizona, Tucson, AZ), Corby Kistler (University of Minnesota, Minneapolis–Saint Paul, MN), Pi-Fang Linda Chang (National Chung Hsing University, Taichung, Taiwan) and Tsai-Ling Yang Lauderdale (National Health Research Institutes, Zhunan, Taiwan) for providing strains. The authors also thank Ms Cecelia Wall for language editing.
Funding: This work was financially supported by the Ministry of Science & Technology [grants MOST 102-2320-B-002-041-MY2 and 104-2320-B-002-063-MY3] and the Bureau of Animal and Plant Health Inspection and Quarantine in Taiwan [104AS-10.7.3BQ-B1(5)].
Competing interests: None declared.
Ethical approval: Not required.
Page 19 of 32
References [1] Dananche C, Cassier P, Sautour M, Gautheron N, Wegrzyn J, Perraud M, et al. Fungaemia caused by Fusarium proliferatum in a patient without definite immunodeficiency. Mycopathologia 2015;179:135–40. [2] Nucci M, Anaissie E. Fusarium infections in immunocompromised patients. Clin Microbiol Rev 2007;20:695–704. [3] Chang DC, Grant GB, O'Donnell K, Wannemuehler KA, Noble-Wang J, Rao CY, et al. Multistate outbreak of Fusarium keratitis associated with use of a contact lens solution. JAMA 2006;296:953–63. [4] Broekaert N, Devreese M, De Baere S, De Backer P, Croubels S. Modified Fusarium mycotoxins unmasked: from occurrence in cereals to animal and human excretion. Food Chem Toxicol 2015;80:17–31. [5] Guzman-Cottrill JA, Zheng X, Chadwick EG. Fusarium solani endocarditis successfully treated with liposomal amphotericin B and voriconazole. Pediatr Infect Dis J 2004;23:1059–61. [6] Speeleveld E, Gordts B, Van Landuyt HW, De Vroey C, Raes-Wuytack C. Susceptibility of clinical isolates of Fusarium to antifungal drugs. Mycoses 1996;39:37–40. [7] Altun A, Kurna SA, Sengor T, Altun G, Olcaysu OO, Aki SF, et al. Effectiveness of posaconazole in recalcitrant fungal keratitis resistant to conventional antifungal drugs. Case Rep Ophthalmol Med 2014;2014:701653.
Page 20 of 32
[8] Ranawaka RR, Nagahawatte A, Gunasekara TA. Fusarium onychomycosis: prevalence, clinical presentations, response to itraconazole and terbinafine pulse therapy, and 1-year follow-up in nine cases. Int J Dermatol 2015;54:1275–82. [9] Chen KJ, Sun MH, Lai CC, Wu WC, Chen TL, Kuo YH, et al. Endophthalmitis caused by Pseudomonas aeruginosa in Taiwan. Retina 2011;31:1193–8. [10]
Chuang CC, Hsiao CH, Tan HY, Ma DH, Lin KK, Chang CJ, et al.
Staphylococcus aureus ocular infection: methicillin-resistance, clinical features, and antibiotic susceptibilities. PLoS One 2012;8:e42437. [11]
Stansly PG, Schlosser ME. Studies on polymyxin: isolation and
identification of Bacillus polymyxa and differentiation of polymyxin from certain known antibiotics. J Bacteriol 1947;54:549–56. [12]
Hancock RE. Peptide antibiotics. Lancet 1997;349:418–22.
[13]
Nation RL, Li J, Cars O, Couet W, Dudley MN, Kaye KS, et al. Framework
for optimisation of the clinical use of colistin and polymyxin B: the Prato polymyxin consensus. Lancet Infect Dis 2014:15:225–34. [14]
Parchuri S, Mohan S, Cunha BA. Extended spectrum -lactamase-
producing Klebsiella pneumoniae chronic ambulatory peritoneal dialysis peritonitis treated successfully with polymyxin B. Heart Lung 2005;34:360–3. [15]
Sarria JC, Angulo-Pernett F, Kimbrough RC, McVay CS, Vidal AM. Use of
intravenous polymyxin B during continuous venovenous hemodialysis. Eur J Clin Microbiol Infect Dis 2004;23:340–1. [16]
Deris ZZ, Akter J, Sivanesan S, Roberts KD, Thompson PE, Nation RL, et
al. A secondary mode of action of polymyxins against Gram-negative bacteria
Page 21 of 32
involves the inhibition of NADH-quinone oxidoreductase activity. J Antibiot (Tokyo) 2014;67:147–51. [17]
Ogita A, Nagao Y, Fujita K, Tanaka T. Amplification of vacuole-targeting
fungicidal activity of antibacterial antibiotic polymyxin B by allicin, an allyl sulfur compound from garlic. J Antibiot (Tokyo) 2007;60:511–8. [18]
Pankey G, Ashcraft D, Kahn H, Ismail A. Time–kill assay and Etest
evaluation for synergy with polymyxin B and fluconazole against Candida glabrata. Antimicrob Agents Chemother 2014;58:5795–800. [19]
Zhai B, Lin X. Evaluation of the anticryptococcal activity of the antibiotic
polymyxin B in vitro and in vivo. Int J Antimicrob Agents 2013;41:250–4. [20]
Zhai B, Zhou H, Yang L, Zhang J, Jung K, Giam CZ, et al. Polymyxin B, in
combination with fluconazole, exerts a potent fungicidal effect. J Antimicrob Chemother 2010;65:931–8. [21]
Ben-Ami R, Lewis RE, Tarrand J, Leventakos K, Kontoyiannis DP.
Antifungal activity of colistin against Mucorales species in vitro and in a murine model of Rhizopus oryzae pulmonary infection. Antimicrob Agents Chemother 2010;54:484–90. [22]
O'Donnell K, Sutton DA, Rinaldi MG, Magnon KC, Cox PA, Revankar SG,
et al. Genetic diversity of human pathogenic members of the Fusarium oxysporum complex inferred from multilocus DNA sequence data and amplified fragment length polymorphism analyses: evidence for the recent dispersion of a geographically widespread clonal lineage and nosocomial origin. J Clin Microbiol 2004;42:5109–20.
Page 22 of 32
[23]
Lin Y-H, Chang J-Y, Liu E-T, Chao C-P, Huang J-W, Chang P-FL.
Development of a molecular marker for specific detection of Fusarium oxysporum f. sp. cubense race 4. Eur J Plant Pathol 2009;123:353–65. [24]
Ma LJ, van der Does HC, Borkovich KA, Coleman JJ, Daboussi MJ, Di
Pietro A, et al. Comparative genomics reveals mobile pathogenicity chromosomes in Fusarium. Nature 2010;464:367–73. [25]
Ma LJ, Shea T, Young S, Zeng Q, Kistler HC. Genome sequence of
Fusarium oxysporum f. sp. melonis strain NRRL 26406, a fungus causing wilt disease on melon. Genome Announc 2014;2:pii: e00730-14. [26]
Coleman JJ, Rounsley SD, Rodriguez-Carres M, Kuo A, Wasmann CC,
Grimwood J, et al. The genome of Nectria haematococca: contribution of supernumerary chromosomes to gene expansion. PLoS Genet 2009;5:e1000618. [27]
Cuomo CA, Guldener U, Xu JR, Trail F, Turgeon BG, Di Pietro A, et al.
The Fusarium graminearum genome reveals a link between localized polymorphism and pathogen specialization. Science 2007;317:1400–2. [28]
Clinical and Laboratory Standards Institute. Reference method for broth
dilution antifungal susceptibility testing of filamentous fungi; approved standard— second edition. Document M38-A2. Wayne, PA: CLSI; 2008. [29]
Odds FC. Synergy, antagonism, and what the chequerboard puts between
them. J Antimicrob Chemother 2003;52:1.
Page 23 of 32
[30]
Dijksterhuis J, Sanders M, Gorris LG, Smid EJ. Antibiosis plays a role in
the context of direct interaction during antagonism of Paenibacillus polymyxa towards Fusarium oxysporum. J Appl Microbiol 1999;86:13–21. [31]
Bosscha MI, van Dissel JT, Kuijper EJ, Swart W, Jager MJ. The efficacy
and safety of topical polymyxin B, neomycin and gramicidin for treatment of presumed bacterial corneal ulceration. Br J Ophthalmol 2004;88:25–8. [32]
Tajima K, Miyake T, Koike N, Hattori T, Kumakura S, Yamaguchi T, et al.
In vivo challenging of polymyxins and levofloxacin eye drop against multidrugresistant Pseudomonas aeruginosa keratitis. J Infect Chemother 2014;20:343–9. [33]
Ly NS, Bulman ZP, Bulitta JB, Baron C, Rao GG, Holden PN, et al.
Optimization of polymyxin B in combination with doripenem to combat mutator Pseudomonas aeruginosa. Antimicrob Agents Chemother 2016;60:2870–80. [34]
Pfaller MA, Sheehan DJ, Rex JH. Determination of fungicidal activities
against yeasts and molds: lessons learned from bactericidal testing and the need for standardization. Clin Microbiol Rev 2004;17:268–80. [35]
Justo JA, Bosso JA. Adverse reactions associated with systemic
polymyxin therapy. Pharmacotherapy 2015;35:28–33. [36]
Grau-Campistany A, Manresa Á, Pujol M, Rabanal F, Cajal Y. Tryptophan-
containing lipopeptide antibiotics derived from polymyxin B with activity against Gram positive and Gram negative bacteria. Biochim Biophys Acta 2016;1858:333–43.
Page 24 of 32
[37]
Rabanal F, Grau-Campistany A, Vila-Farres X, Gonzalez-Linares J,
Borras M, Vila J, et al. A bioinspired peptide scaffold with high antibiotic activity and low in vivo toxicity. Sci Rep 2015;5:10558. [38]
Schäfer K, Di Pietro A, Gow NA, MacCallum D. Murine model for
Fusarium oxysporum invasive fusariosis reveals organ-specific structures for dissemination and long-term persistence. PLoS One 2014;9:e89920. [39]
Schroers HJ, O'Donnell K, Lamprecht SC, Kammeyer PL, Johnson S,
Sutton DA, et al. Taxonomy and phylogeny of the Fusarium dimerum species group. Mycologia 2009;101:44–70. [40]
Chang YL, Yu SJ, Heitman J, Wellington M, Chen YL. New facets of
antifungal therapy. Virulence 2017;8:222–36.
Page 25 of 32
Fig. 1. Polymyxin B (PMB) exhibits fungicidal activity against Fusarium strains infecting humans and plants. A total of 104 conidia/mL without or with PMB treatment at the concentration indicated was incubated in 5 mL of RPMI 1640 liquid medium for 72 h at 35 C. Mycelia were collected and were smeared on a slide after treatment with 0.01% methylene blue solution for 5 min at room temperature. Samples were washed twice with dH2O and were observed at a magnification of 400. Numbers in white rectangles indicate the minimum inhibitory concentration (MIC) in g/mL of the respective strain. Scale bar = 25 m.
Fig. 2. Polymyxin B (PMB) inhibits conidia germination of Fusarium strains. (A) Fusarium strains were grown in liquid medium without or with 8 g/mL PMB and were incubated at 35 C for 10 h before microscopic observation at a magnification of 400. (B) Conidia germination rates from (A) were plotted using GraphPad Prism 5.01 (GraphPad Software Inc., La Jolla, CA). Germination was defined as the presence of a thin germ tube longer than its respective conidium. The germination rate was calculated by randomly counting 50 conidia from each of three independent experiments. * P < 0.05; ** P < 0.01 based on Student’s t-test analysis. Scale bar = 50 m.
Fig. 3. Polymyxin B (PMB) damages Fusarium strains. Conidia of Fusarium strains were incubated in RPMI 1640 medium in the absence or presence of PMB at their respective minimum inhibitory concentrations (MICs) at 35 C for 10 h. Following harvest, germlings were stained with propidium iodide and were observed under
Page 26 of 32
fluorescence at a magnification of 400 or 1000. Numbers in white rectangles indicate the minimum inhibitory concentration (MIC) in g/mL of the respective strain. Scale bar = 10 m.
Fig, 4. Expression of the Fusarium CHS1 gene is slightly affected by polymyxin B (PMB). Conidia of Fusarium oxysporum f. sp. lycopersici 4287 and F. oxysporum FOSC 3-a were incubated in RPMI 1640 medium in the absence or presence of 8 g/mL PMB at 35 C for 10 h and were harvested for RNA extraction. RNA was reverse transcribed to cDNA. Quantitative PCR (qPCR) was performed as described in the Materials and methods in the Supplementary information. * Significant difference at P < 0.001 based on two-way analysis of variance (ANOVA) and Bonferroni's multiple comparison test.
Fig. 5. The germination rate of chlamydospores produced by Fusarium oxysporum f. sp. cubense (Foc-T14) or lycopersici (4287) was not inhibited by polymyxin B (PMB). (A) Chlamydospores of Fusarium strains Foc-T14 and 4287 were collected from soil medium and were transferred to RPMI medium with 0, 8 or 16 g/mL PMB. Chlamydospores were incubated at 35 C for 10 h before microscopic observation at a magnification of 400. Red arrows indicate germinated chlamydospores. Scale bar = 50 m. (B) Chlamydospore germination rates from (A) were plotted using GraphPad Prism 5.01 (GraphPad Software Inc., La Jolla, CA). The germination rate was calculated by randomly counting 50 chlamydospores from each of three independent experiments. There was no significant difference between the germination rate among all
Page 27 of 32
concentrations of PMB based on one-way analysis of variance (ANOVA) and Bonferroni's multiple comparison test.
Page 28 of 32
Table 1. Fusarium strains used in this study Strain
Isolate
Host
Reference
Fusarium solani
MCCF1600
Human (skin)
This study
F. solani
Fungus III-6
Human (eye)
This study
Fusarium falciforme
MCCF2106
Human (eye)
This study
Fusarium oxysporum
FOSC 3-a
Human (blood) [22]
F. oxysporum
MCCF2074
Human (blood) This study
Fusarium sp.
MCCF2036
Human (hand)
This study
F. oxysporum f. sp. cubense
Foc-T14
Banana
[23]
F. oxysporum f. sp. lycopersici 4287
Tomato
[24]
F. oxysporum f. sp. melonis
NRRL26406
Melon
[25]
F. solani
MPVI 77-13-4 Pea
[26]
Fusarium graminearum
PH-1
Wheat
[27]
Fusarium verticillioides
7600
Maize
[24]
Page 29 of 32
Table 2. Minimum inhibitory concentrations (MICs) and minimum fungicidal concentrations (MFCs) of polymyxin B for 12 Fusarium strains Strain
MIC (g/mL) MFC (g/mL)
Fusarium solani (MCCF1600)
64
128
F. solani (Fungus III-6)
32
32
Fusarium falciforme (MCCF2106)
32
32
Fusarium oxysporum (FOSC 3-a)
128
256
F. oxysporum (MCCF2074)
32
128
Fusarium sp. (MCCF2036)
32
64
F. oxysporum f. sp. cubense (Foc-T14)
32
64
F. oxysporum f. sp. lycopersici (4287)
32
64
F. oxysporum f. sp. melonis (NRRL26406) 32
64
F. solani (MPVI 77-13-4)
16
16
Fusarium graminearum (PH-1)
16
32
Fusarium verticillioides (7600)
128
256
Page 30 of 32
Table 3. Synergistic antifungal activity between polymyxin B (PMB) and fluconazole (FLU), voriconazole (VRC), posaconazole (PSC) and amphotericin B (AmB) against 12 Fusarium strains Strain
MIC alone (g/mL) PMB FLU VRC PSC
MCCF1600
64
>64
16
>16
AmB PMB, 8
PMB,
PMB,
PMB,
PMB +
PMB +
PMB +
PMB +
FLU
VRC
PSC
AmB
FLU
VRC
PSC
AmB
32, 64
32,
32,
32,
1
0.516
0.508
0.531
0.5, 2
0.508
0.516
1.008
0.516
0.5, 2
0.508
0.516
1.008
0.516
32, 2
0.5, 8
0.508
0.531
0.313
1.004
0.25 MCCF2106
32
>64
16
>16
4
16, 1
16, 0.25
Fungus III-6
32
>64
16
>16
4
16, 1
16, 0.25
FOSC 3-a
128
>64
8
FICI a
MIC combined (g/mL)
>16
8
64, 1
64,
0.25 32,
0.25
0.25 32, 0.25
0.25 MCCF2074
32
>64
4
>16
8
32, 1
0.5, 4
16, 2
0.5, 8
1.016
1.016
0.563
1.016
MCCF2036
32
>64
8
>16
2
16, 64
16,
16,
0.5, 1
1
0.531
0.516
0.516
32,
1.008
1.063
1.008
1.063
1.008
1.016
1.008
1.016
0.25 Foc-T-14
32
>64
4
>16
4
32, 1
32, 0.25
4287
32
>64
16
>16
8
32, 1
32, 0.25
0.25 32, 0.25 32,
0.25 0.5, 8
0.25
Page 31 of 32
NRRL26406
32
>64
8
>16
8
32, 1
16, 0.25
MPVI 77-13- 16
>64
16
>16
2
16, 1
4 PH-1
16, 0.25
16
>64
16
>16
1
16, 1
16,
32,
128
>64
1
1
16
64, 1
64, 0.25
1.008
0.531
1.008
1.016
8, 0.5
1.016
1.016
1.008
0.75
0.508
1.016
0.508
0.531
0.75
0.375
1.004
0.25 16, 0.25 8, 0.25 0.5,
0.25 7600
0.5, 8
0.5 16,
0.5, 16 0.508
0.25
MIC, minimum inhibitory concentration; FICI, fractional inhibitory concentration index. a
FICI ≤ 0.5, synergy; FICI >0.5 but ≤4, no interaction; FICI > 4, antagonism.
Page 32 of 32