- Email: [email protected]
APRIL axis plays an important role in virus-induced peritoneal responses in rainbow trout
Fish & Shellfish Immunology 64 (2017) 210e217
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
The BAFF / APRIL axis plays an important role in virus-induced peritoneal responses in rainbow trout s 1, Rosario Castro, Lucia Gonza lez, Carolina Tafalla**, Irene Soleto 1, Beatriz Abo Aitor G. Granja* n en Sanidad Animal (CISA-INIA), Madrid, Spain Centro de Investigacio
a r t i c l e i n f o
a b s t r a c t
Article history: Received 23 December 2016 Received in revised form 8 March 2017 Accepted 10 March 2017 Available online 14 March 2017
IgMþ B cells have been recently demonstrated to be key regulators of peritoneal inflammation in teleost, as a large number of them occupy the peritoneal cavity after 48 h of antigenic stimulation. Despite this, the number of studies addressing the mechanism through which this cell population expands and differentiates in response to stimuli has been scarcely addressed. Because the BAFF/APRIL axis is known to play a major role in B cell survival and differentiation in mammals, we hypothesized that it could be affected in the peritoneal cavity in response to an inflammatory stimulus. To verify this hypothesis, we studied how BAFF, APRIL and the fish-specific related cytokine BALM as well as their putative receptors are regulated in rainbow trout after intraperitoneal (i.p.) injection of viral hemorrhagic septicemia virus (VHSV). When the transcriptional analysis was performed in total cells from the peritoneum, we observed that VHSV provoked an up-regulation of both BAFF and BAFF receptor (BAFF-R) mRNA levels. However, when we examined how isolated peritoneal IgMþ B cells were transcriptionally affected by VHSV i.p. injection, we found that APRIL, BALM and the transmembrane activator and calcium modulator and cyclophilin ligand interactor (TACI) were also up-regulated in response to the virus. IgM cells, on the other hand, only up-regulated BALM transcription in response to VHSV. Finally, to gain further insight on the role that these cytokines play in the peritoneum, we have studied their effect on the survival of peritoneal IgMþ B cells. This work demonstrates a key role for the BAFF/APRIL axis in the peritoneal inflammatory response and contributes to further understanding how IgMþ B cells are regulated at this specific peripheral site. © 2017 Published by Elsevier Ltd.
Keywords: Rainbow trout Peritoneum Viral hemorrhagic septicemia virus (VHSV) BAFF APRIL BALM BAFF receptors
1. Introduction So far, intraperitoneal (i.p.) injection seems as the most effective vaccination route in aquaculture, since a high number of i.p.administered fish vaccines are capable of conferring strong and long-lasting immune responses, while on the contrary, vaccination through other routes such as oral or bath confer disappointing protection levels. Despite this, how peritoneal leukocytes are regulated upon antigen encounter has only been scarcely studied in fish. Resident peritoneal leukocytes are known to include both myeloid cells (monocytes, macrophages and granulocytes) and lymphocytes, in different ratios depending on the fish species
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (C. Tafalla), [email protected] (A.G. Granja). 1 These authors have contributed equally to this work. http://dx.doi.org/10.1016/j.fsi.2017.03.023 1050-4648/© 2017 Published by Elsevier Ltd.
[1e4]. However, in the past, most studies that have addressed the recruitment and activation of cells in the peritoneal cavity upon the injection of different stimuli have exclusively focused on myeloid cells [5e11]. In 2013, Korytar et al. [12], described the nature of the cells in the peritoneal cavity of rainbow trout (Oncorhynchus mykiss) after a bacterial infection with Aeromonas salmonicida and observed that while the first hours of inflammation were dominated by myeloid cells, lymphocytes predominated at the later times, with IgMþ B cells representing almost half of all peritoneal cells after 48 h post-immunization. We have recently confirmed these results, having established that rainbow trout IgMþ B cells dominate the peritoneum upon exposure to Escherichia coli, E. coliderived lipopolysaccharide (LPS) or viral hemorrhagic septicemia virus (VHSV) [13]. Furthermore, we have also demonstrated that in response to either E. coli or VHSV some of these peritoneal IgMþ B cells differentiate towards plasmablasts/plasma cells, whereas others seem to be implicated in antigen presentation [13].
I. Soleto et al. / Fish & Shellfish Immunology 64 (2017) 210e217
BAFF (B cell activating factor) and APRIL (a proliferation inducing ligand) are two cytokines belonging to the tumor necrosis factor (TNF) superfamily which are key regulators of B cell function in mammals [14]. BAFF and APRIL are mainly produced by innate immune cells such as macrophages or dendritic cells in response to different pro-inflammatory stimuli to regulate B cell survival, maturation and differentiation [15]. Both of them are type II transmembrane proteins which become soluble ligands after cleavage at the cell surface by a furin-like protease, with both the membrane-bound and soluble forms being biologically active [16]. Concerning the receptors through which they signal, both BAFF and APRIL bind to B cell maturation antigen (BCMA, also known as TNFRSF17) and transmembrane activator and calcium modulator and cyclophilin ligand interactor (TACI, also known as TNFRSF13B), whereas BAFF also binds to BAFF receptor (BAFF-R, also known as BR3 or TNFRSF13C) [17]. All three receptors are preferentially expressed in B cells [18,19]. In rainbow trout, homologues to both BAFF and APRIL have been identified as well as a further cytokine designated as a BAFF and APRIL-like molecule (BALM) [20]. BALM has a high sequence similarity with BAFF but shares some structural characteristics of APRIL. Concerning their putative receptors, homologues to BAFF-R, BCMA and TACI have also been reported in this species [21]. Furthermore, the fact that rainbow trout BAFF promotes the survival of splenic B cells has also been recently demonstrated [22]. In this context, we thought of interest to explore the regulation of BAFF, APRIL and BALM as well as their three putative receptors in the rainbow trout peritoneal cavity upon stimulation with VHSV. These experiments would help us establish whether this cytokine family is involved in the expansion and the differentiation of IgMþ B cells observed in the peritoneum in response to the virus. For this, we first studied gene transcription in complete peritoneal cells to then focus on how isolated IgMþ B cells respond to the virus. Additionally, to establish if peritoneal B cells are directly activated by VHSV or require signals exclusively received in vivo, we have compared the transcriptional responses obtained in peritoneal IgMþ B cells after i.p. injection to the B cell responses observed when leukocyte cultures from spleen or peritoneum were exposed to the virus in vitro. Finally, to determine which of these cytokines plays a more prominent role on the expansion of IgMþ B cells, we have produced them recombinantly and studied their effects on the survival of peritoneal IgMþ B cells. Our results demonstrate that peritoneal B cells but not splenic B cells specifically regulate BAFF, APRIL, BALM, BAFF-R and TACI in response to VHSV. Because we have also demonstrated that APRIL and BALM increase peritoneal IgMþ B cell survival, it seems plausible that these two cytokines are involved in the expansion of the peritoneal IgMþ B cell subpopulation observed in response to VHSV. All these experiments contribute to a further understanding of the mechanisms through which peritoneal inflammation is organized in fish, revealing a key role for the BAFF/APRIL axis. 2. Materials and methods
of laboratory animals and were previously approved by the Ethics n y Tecnocommittee from the Instituto Nacional de Investigacio logía Agraria y Alimentaria (INIA). Anesthesia was applied following Zhal et al. recommendations for general anesthesia (narcosis) [23] prior to sacrifice, and all efforts were made to minimize suffering. 2.2. VHSV intraperitoneal injection Rainbow trout of approximately 5e10 g were i.p. injected with VHSV (100 ml of a viral solution containing 1 106 TCID50/ml) or with the same volume of PBS. At days 1, 3 or 7 post-injection, seven fish from each group were sacrificed by benzocaine overdose. Exudate cells from the peritoneal cavity were obtained by perfusion with 2 ml of Leibovitz medium (L-15) supplemented with 100 IU/ ml penicillin, 100 mg/ml streptomycin, 10 units/ml heparin and 5% fetal calf serum (FCS) (all obtained from Life Technologies). 2.3. Gene expression analysis in total peritoneal cells RNA was extracted from peritoneal cells using Trizol (Life Technologies) following the manufacturer's instructions. The RNA pellet was washed with 75% ethanol, dissolved in diethylpyrocarbonate (DEPC)-treated water and stored at 80 C until used. 1 mg of RNA from each individual was treated with DNAse I to remove any genomic DNA traces that might interfere with the PCR reactions and then used to obtain cDNA using the Superscript II reverse transcriptase (Life Technologies) following manufacturer's instructions. The cDNA was diluted in a 1:10 proportion with DEPCtreated water and stored at 20 C. To evaluate gene transcription levels, real-time PCR was performed in a LightCycler® 96 System instrument (Roche) using FastStart essential DNA green master (Roche) and specific primers (Table 1). Each sample was measured under the following conditions: 10 min at 95 C, followed by 40 amplification cycles (10 s at 95 C, 10 s at 60 C and 10 s at 72 C). The expression of individual genes was normalized to relative expression of trout EF-1a and the expression levels were calculated using the 2DCt method, where DCt is determined by subtracting the EF-1a value from Ct of the targeted gene as previously described [24]. EF1a was selected as reference gene according to the MIQE guidelines (Bustin et al., 2009. Clinical Chemistry 55:4 p611-622). A statistical analysis determined there were no differences between the means of the expression of EF1a of control and VHSV-infected groups of animals. Negative controls with no template were also included. A melting curve for each PCR was determined by reading fluorescence every Table 1 Primers used for real-time PCR analysis in this study. Gene
Primer name
Primer sequence (50 -30 )
BAFF
RT-BAFF-F RT-BAFF-R RT-APRIL-F RT-APRIL-R RT-BALM-F RT-BALM-R RT-BAFFR-F RT-BAFFR-R RT-BCMA-F RT-BCMA-R RT-TACI-F RT-TACI-F RT-VHSV-N-F RT-VHSV-N-R RT-EF1a-F RT-EF1a-R
ATGTTTGATGCTTATTCTGGCAGGT TGGGACTGTGTCTTGACTGTGTGTA CACAGACATACACAATGGAATGGAA TGTGATGACAGAGGAACAAGATGAA TGGAGGTACAGTAGTTCAGCAGTCG ACTATCCAAGGAATCACCGTCACAT TGTCTGGATATCAATGGTCGTCATA CTTTAGCTGGAGGGTTAAGTCTTGC ATGTCAGAAGGACAGTGTGGACTGG CGGCTCTGGGGCTTTGCTCT GCATCGAGTACTGTGCTTCTCTAGG AAGTCAGGCTGTTGGGTCTTACATT GAGAGAACTGGCCCTGACTG CCCGAGTTTCTTGGTGATGT GATCCAGAAGGAGGTCACCA TTACGTTCGACCTTCCATCC
APRIL
2.1. Fish Rainbow trout (Oncorhynchus mykiss) were obtained from Centro de Acuicultura El Molino (Madrid, Spain) and maintained at n en Sanidad the animal facilities of the Centro de Investigacio Animal (CISA-INIA, Spain) in a re-circulating water system at 16 C, with 12:12 h light:dark photoperiod. Fish were fed twice a day with a commercial diet (Skretting, Spain). Prior to any experimental procedure, fish were acclimatized to laboratory conditions for at least 2 weeks. The experiments described comply with the Guidelines of the European Union Council (2010/63/EU) for the use
211
BALM BAFF-R BCMA TACI VHSV-N EF-1a
212
I. Soleto et al. / Fish & Shellfish Immunology 64 (2017) 210e217
degree between 60 C and 95 C to ensure only a single product had been amplified. þ
2.4. Isolation of IgM B cells from the peritoneal cavity Peritoneal cells from VHSV-injected and PBS-injected fish were obtained from the peritoneal cavity by perfusion with 2 ml of L-15 media supplemented with antibiotics, heparin and 5%FCS at different times post-injection, as described above. Cell suspensions were then placed onto 30/51% discontinuous Percoll (GE Healthcare) density gradients and centrifuged at 500g for 30 min at 4 C. The interface cells were collected and washed twice in L-15 containing 5% FCS. Purified leukocytes were incubated for 30 min on ice with a specific anti-trout IgM antibody (1.14) coupled to R-PE [25]. Following two washing steps, cells were resuspended in PBS and IgMþ cells were sorted using a BD FACSAria III (BD Biosciences), using first their FSC/SSC profiles (to exclude the granulocyte gate) and then on the basis of the fluorescence emitted by the sample. IgMþ and IgM cells were then collected separately for RNA isolation. 2.5. Gene expression analysis in FACS isolated peritoneal IgMþ B cells Total cellular RNA was isolated from IgMþ and IgM sorted populations from the peritoneal cavity using the Power Sybr Green Cells-to-Ct Kit (Invitrogen) following manufacturer's instructions. RNAs were treated with DNAse during the process to remove genomic DNA that might interfere with the PCR reactions. Reverse transcription was also performed using the Power Sybr Green Cellsto-Ct Kit (Invitrogen) following manufacturer's instructions. To evaluate the levels of transcription of the different genes, real-time PCR was performed using SYBR Green PCR core Reagents (Applied Biosystems). Each sample was measured in duplicate under the following conditions: 10 min at 95 C, followed by 45 amplification cycles (15 s at 95 C and 1 min at 60 C). A melting curve for each PCR was also included to ensure only a single product had been amplified. The expression of individual genes was normalized to the relative expression of trout housekeeping gene EF-1a elongation factor as described above. 2.6. In vitro stimulation of peritoneal and splenic leukocytes with VHSV Rainbow trout of approximately 10e15 cm were killed by benzocaine overdose and peritoneal leukocytes isolated as described above. Spleen was also collected and placed in L-15 medium supplemented with P/S, heparin and 5%FCS. Single cell suspensions from spleen were obtained using 100 mm nylon cell strainers (BD Biosciences). Both peritoneal and splenic cell suspensions were placed onto 30/51% discontinuous Percoll density gradients and centrifuged at 500g for 30 min at 4 C. The interface cells were collected and washed twice in L-15 containing 5% FCS. Peritoneal or splenic leukocytes adjusted to 2 106 cells/ml in L-15 with 5% FCS were disposed in 24-well plates and exposed to VHSV at a final concentration of 2 106 TCID50/ml. After 48 h of incubation at 14 C, the samples were labeled with an anti-IgM mAb and IgMþ cells were FACS isolated as described above. Total cellular RNA was isolated from IgMþ B cell populations from the different tissues using the Power Sybr Green Cells-to-Ct Kit following manufacturer's instructions. Reverse transcription to cDNA and realtime PCR reactions were performed and analyzed as described above.
2.7. Production of recombinant BAFF, APRIL and BALM Although mammalian BAFF and APRIL have several N-glycosylation sites, no N-glycosylation sites were found in the rainbow trout BAFF sequence, one in APRIL and one in BALM. In any case, the absence of N-glycosylation does not seem to alter functionality of these cytokines in mammals, given the fact that recombinant BAFF and APRIL produced in Escherichia coli are active. Thus, to study the effects of rainbow trout BAFF, APRIL and BALM on IgMþ B cell survival, we produced them in E. coli. To carry this out, the nucleotide sequence corresponding to the extracellular domain of the rainbow trout BAFF sequence (GenBank Accession number DQ218467.1), APRIL (GenBank Accession number EF451543.1) or BALM (GenBank Accession number DQ218469.1) sequences together with an N-terminal 6 x histidine tag were synthetized and subcloned into the E3 expression vector (Abyntek). The recombinant plasmids were transformed into BL21 cells and kanamycinresistant single positive colonies for each clone were then incubated at 37 C in Luria-Bertani (LB) media. When the OD600 reached 0.6, 0.1 mM of isopropyl b-D-thiogalactoside (IPTG, Sigma Aldrich) was added to induce protein production. After 16 h, cells were harvested, lysed by sonication and dissolved using urea. Thereafter, BAFF, APRIL or BALM were obtained through the use of Nickel columns (Sigma Aldrich). The protein-containing fractions were pooled, refolded, filtered through 0.22 mm and resuspended in storage buffer (50 mM Tris-HCl, 150 mM NaCl, 10% glycerol, 0.5 M Larginine and 2 mM DTT, pH 8.5). Protein concentrations were determined in a BCA protein assay (Thermo Fisher Scientific) and the recombinant rainbow trout cytokines (0.3 mg/ml) aliquoted and stored at 80 C until used. An irrelevant protein with a similar molecular weight to that of these recombinant proteins, also bearing an N-terminal His tag was produced in the same conditions (C-His) and was used as a functional control. 2.8. Effect of BAFF, APRIL and BALM on the survival of peritoneal IgMþ B cells Peritoneal leukocytes were incubated in the presence of recombinant rainbow trout BAFF, APRIL or BALM, or the C-His control protein, at a final concentration of 3 mg/ml. A wide range of doses of these stimuli were tested and the optimal doses were selected based on their effect on B cell survival (data not shown). After 72 h of incubation, cells were labeled with PE-labeled anti-IgM (1.14) antibody and live IgMþ B cells were quantified by flow cytometry on a FACSCalibur flow cytometer (BD Biosciences) equipped with CellQuest Pro software. Analysis was performed with FlowJo 10 (TreeStar). 2.9. Statistics Data handling, analyses and graphic representation was performed using Microsoft Office Excel 2010. Statistical analyses were performed using a two-tailed Student's t-test with Welch's correction when the F test indicated that the variances of both groups differed significantly. The differences between the mean values were considered significant on different degrees, where * means P 0.05, ** means P 0.01 and *** means P 0.005 (GraphPad Prism 4 software). 3. Results 3.1. Effect of VHSV on BAFF, APRIL and BALM transcription in the peritoneum Given the fact that previous experiments have demonstrated
I. Soleto et al. / Fish & Shellfish Immunology 64 (2017) 210e217
that the i.p. injection of VHSV to rainbow trout provokes a significant increase in the number of IgMþ B cells within the peritoneal cavity as well as a local B differentiation [13], we thought relevant to study the levels of transcription of cytokines of the TNF subfamily known to regulate B cell responses in mammals. Thus, we analyzed whether BAFF, APRIL and BALM expression was affected by VHSV. After i.p. administration of the virus, we observed a significant up-regulation of BAFF transcriptional levels in peritoneal leukocytes at days 1, 3 and 7 after injection (Fig. 1A). The upregulation on BAFF transcription reached a 10-times increase on day 1 and remained at a 3-times increase on days 3 and 7. On the contrary, no up-regulation was observed for either APRIL or BALM after the viral challenge (Fig. 1B and C). 3.2. Effect of VHSV on the transcription of BAFF receptors in the peritoneum In mammals, both BAFF and APRIL bind to and signal through BCMA and TACI receptors, with BAFF also binding to BAFF-R with very high affinity (reviewed in Ref. [26]). Since homologue sequences to BAFF-R, BCMA and TACI have been very recently reported in teleost [21], we thought of importance to analyze whether VHSV challenge could also modulate the expression of these BAFF-APRIL subfamily receptors. After i.p. administration of the virus, we observed a significant up-regulation of around 4times increase of the transcriptional levels of BAFF-R in peritoneal leukocytes at days 1, 3 and 7 after injection (Fig. 2A). On the contrary, no up-regulation was observed for either BCMA or TACI after the viral challenge (Fig. 2B and C). 3.3. Effect of VHSV on BAFF, APRIL and BALM transcription in the IgMþ and IgM cells in the peritoneum In order to establish which cell types were responding to the virus in more detail, a further experiment was conducted to analyze the transcriptional responses to VHSV on IgMþ B cells and IgM cells. This analysis was performed at day 3 post-infection, since we observed the highest expression of the gene encoding for the protein N of VHSV at that time (Supplementary Fig. 1). Surprisingly, when we studied the response of peritoneal IgMþ B cells alone after VHSV i.p. injection, we found that in this case APRIL (Fig. 3B) and BALM (Fig. 3C) were also up-regulated in addition to BAFF (Fig. 3A). Within the IgM cell compartment, BAFF was expressed at high levels in control animals but no up-regulation was observed after
213
VHSV i.p. injection (Fig. 3A). In the case of APRIL, only IgMþ B cells from VHSV-injected fish showed detectable mRNA levels for this cytokine (Fig. 3B). BALM, on the other hand, was not transcribed by IgM B cells in control fish, and was induced after VHSV infection (Fig. 3C). On the IgMþ cell compartment, BALM was expressed by control animals and was up-regulated (3-times increase) upon VHSV injection (Fig. 3C). These data suggest that peritoneal IgMþ B cells actively participate in the production of B cell stimulating cytokines during the immune response against VHSV. 3.4. Effect of VHSV on the transcription of BAFF receptors in the IgMþ and IgM cells in the peritoneum Because BAFF-R, BCMA and TACI receptors are preferentially expressed on B cells [17], we further analyzed the impact of VHSV on the expression of such receptors within the peritoneal cavity IgM and IgMþ cell compartments. BAFF-R expression was higher on IgMþ B cells compared to IgM cells and, interestingly, its expression was significantly increased after exposure to VHSV in both compartments, preferentially on IgMþ B cells (4.5-times increase) compared with IgM cells (2.5-times increase) (Fig. 4A). On the contrary, BCMA transcription was not affected by VHSV either in IgM or in IgMþ cells from the peritoneal cavity (Fig. 4B). Regarding TACI, its expression levels were undetectable on IgM cells in both control and infected animals or IgMþ B cells from control fish, but were significantly induced in peritoneal IgMþ B cells after exposure to VHSV (Fig. 4C). 3.5. Comparative effect of VHSV on peritoneal and splenic leukocytes after in vitro viral exposure To establish if the transcriptional effects on the BAFF/APRIL axis provoked by VHSV in peritoneal IgMþ B cells require external signals only received in vivo or are a consequence of the direct effect of VHSV on B cells, we isolated peritoneal leukocytes, incubated them with VHSV in vitro and analyzed the transcriptional response of sorted IgMþ B cell populations. This experiment was also carried out with splenic IgMþ B cells to also establish if the response to VHSV observed was exclusive of peritoneal IgMþ B cells. When peritoneal IgMþ B cells were incubated with VHSV, the transcriptional responses observed were identical to those observed in IgMþ B cell populations from VHSV-infected fish. The virus up-regulated the transcription of BAFF, APRIL and BALM (3-times increase) as well as that of BAFF-R and TACI in IgMþ B cells (4-times increase)
Fig. 1. Regulation of BAFF, APRIL and BALM transcription in peritoneal cavity leukocytes in response to VHSV. Rainbow trout were i.p. injected with 100 ml of saline containing 1 105 TCID50 of VHSV or the same volume of saline as control. Fish were kept at 16 C, peritoneal leukocytes obtained at days 1, 3 and 7 post-infection and RNA extracted from total cells as described in Materials and Methods. The transcription levels of BAFF, APRIL and BALM genes relative to the endogenous control gene EF-1a were calculated for each sample and are shown as mean þ SD (n ¼ 6). Statistical differences were evaluated by an unpaired two-tailed Student's t-test, where * means p 0.05 and ** means p 0.01.
214
I. Soleto et al. / Fish & Shellfish Immunology 64 (2017) 210e217
Fig. 2. Regulation of BAFF-R, BCMA and TACI transcription in peritoneal cavity leukocytes in response to VHSV. Rainbow trout were i.p. injected with 100 ml of saline containing 1 105 TCID50 of VHSV or the same volume of saline as control. Fish were kept at 16 C, peritoneal leukocytes obtained at days 1, 3 and 7 post-infection and RNA extracted from total cells as described in Materials and Methods. The transcription levels of BAFF-R, BCMA and TACI genes relative to the endogenous control gene EF-1a were calculated for each sample, and are shown as mean þ SD (n ¼ 6). Statistical differences were evaluated by an unpaired two-tailed Student's t-test, where * means p 0.05, ** means p 0.01 and *** means p 0.005.
Fig. 3. Regulation of BAFF, APRIL and BALM transcription in peritoneal cavity IgMþ B cells in response to VHSV. Rainbow trout were i.p. injected with 100 ml of saline containing 1 105 TCID50 of VHSV or the same volume of saline as control. Fish were kept at 16 C and peritoneal leukocytes obtained at day 3 post-infection. Peritoneal leukocytes were then stained with an anti-IgM mAb and IgMþ and IgM subpopulations were FACS isolated. RNA was then extracted from all collected samples and the transcription levels of BAFF, APRIL and BALM genes relative to the endogenous control gene EF-1a calculated for each fraction. Results are shown as mean þ SD (n ¼ 6). Statistical differences were evaluated by an unpaired two-tailed Student's t-test, where * means p 0.05 and *** means p 0.005.
Fig. 4. Regulation of BAFF-R, BCMA and APRIL transcription in peritoneal cavity IgMþ B cells in response to VHSV. Rainbow trout were i.p. injected with 100 ml of saline containing 1 105 TCID50 of VHSV or the same volume of saline as control. Fish were kept at 16 C and peritoneal leukocytes obtained at day 3 post-infection. Peritoneal leukocytes were then stained with an anti-IgM mAb and IgMþ and IgM subpopulations were FACS isolated. RNA was then extracted from all collected samples and the transcription levels of BAFF-R, BCMA and APRIL genes relative to the endogenous control gene EF-1a calculated for each fraction. Results are shown as mean þ SD (n ¼ 6). Statistical differences were evaluated by an unpaired two-tailed Student's t-test, where * means p 0.05 and *** means p 0.005.
I. Soleto et al. / Fish & Shellfish Immunology 64 (2017) 210e217
(Fig. 5A and B). When the experiment was performed using splenic IgMþ B cells, none of these genes were transcriptionally modulated by VHSV (Fig. 5A and B) suggesting that peritoneal IgMþ B cells respond to VHSV differently than splenic B cells. 3.6. Effect of BAFF, APRIL and BALM on the survival of peritoneal IgMþ B cells Given that cytokines and receptors of the BAFF/APRIL axis seem to be highly regulated in response to VHSV i.p. injection and knowing that this stimulation provokes an expansion of the IgMþ B cell compartment in the peritoneal cavity, we decided to test the effect that recombinant BAFF, APRIL and BALM proteins had on the survival of peritoneal IgMþ B cells. A wide range of doses of these cytokines were tested and the optimal dose (3 mg/ml) selected based on the effect on B cell survival (data not shown). The incubation of peritoneal leukocytes with either APRIL or BALM provoked a significant increase in IgMþ B cell survival after 72 h, representing an increase of 16% for APRIL and 8% for BALM (Fig. 6). This increase on B cell survival was not observed in response to BAFF (Fig. 6). 4. Discussion Although resident peritoneal leukocytes are known to include both lymphocytes and myeloid cells (monocytes, macrophages and granulocytes) [1,3,4], most studies that have addressed the recruitment and activation of cells in the peritoneal cavity upon the
215
injection of different stimuli have mainly focused on the behavior of myeloid cells in inflammation and the role of B cells in peritoneal inflammation has been neglected [5e11]. Nevertheless, recent studies have demonstrated that while the first hours of peritoneal inflammation are dominated by myeloid cells, lymphocytes predominate at the later times, with IgMþ B cells representing almost half of all peritoneal cells after 48 h post-immunization [12,13]. Furthermore, IgMþ B cells not only dominate the peritoneum upon antigenic exposure, but they also differentiate towards IgMsecreting cells or plasmablasts in response to stimuli such as VHSV or E. coli [13]. This behavior of peritoneal IgMþ B cells seems as a fish-specific response, as i.p. stimulation in mammals provokes a depletion of resident B cells which migrate to the spleen where they differentiate to plasma cells, accompanied with a great influx of monocytes, macrophages or granulocytes from blood to the peritoneal cavity [27,28]. In this context, to gain insight on the cytokines that could be regulating this expansion and differentiation of IgMþ B cells in the peritoneal cavity of rainbow trout injected with VHSV, we analyzed how the BAFF and APRIL subfamily of cytokines and receptors, which are responsible for the survival, proliferation and differentiation of B cells in mammals [17], were regulated during the course of the infection. First, we studied the transcriptional levels of cytokines and receptors of the BAFF/APRIL axis in complete leukocyte populations. In these experiments, we observed that both BAFF and BAFF-R mRNA levels were significantly up-regulated in VHSV-injected fish when compared to controls, whereas the other cytokines and cytokine receptors seemed unaltered by the infection. In mammals,
Fig. 5. Peritoneal cavity B cells but not splenic B cells up-regulate BAFF, APRIL, BALM, BAFF-R and TACI expression in response to VHSV in vitro. Peritoneal and splenic leukocytes adjusted to 2 106 cells/ml were exposed to VHSV (2 106 TCID50/ml). After 48 h of incubation at 14 C, the samples were labeled with an anti-IgM mAb and IgMþ cells were FACS isolated. Total RNA was isolated from IgMþ B cells to determine the levels of transcription of BAFF, APRIL and BALM (A) as well those of BAFF-R, BCMA and TACI (B) genes relative to the endogenous control gene EF-1a. Results are shown as mean þ SD (n ¼ 6). Statistical differences were evaluated by an unpaired two-tailed Student's t-test, where * means p 0.05.
216
I. Soleto et al. / Fish & Shellfish Immunology 64 (2017) 210e217
Fig. 6. BAFF, APRIL and BALM promote the survival of peritoneal cavity B cells. Peritoneal cavity leukocytes were incubated with recombinant BAFF (3 mg/ml), APRIL (3 mg/ml), BALM (3 mg/ml), or with a histidine-tagged irrelevant protein (c-His, 3 mg/ml) for 3 days at 20 C. After this time, cells were labeled with an anti-IgM mAb and analyzed by flow cytometry. The percentage of live IgMþ B cells among the lymphocyte gate was then determined. Quantification of average B cell survival is shown as mean þ SD (n ¼ 9). A representative dot plot for each experimental condition is also included. Statistical differences were evaluated by a two-tailed Student's t-test, where * means p 0.05 and *** means p 0.005.
BAFF and APRIL cytokines are mainly produced by myeloid cells and their expression is tightly regulated (summarized in Ref. [29]). Nevertheless, it has been recently shown that a subpopulation of fish splenic B cells produce BAFF in physiological conditions, promoting the survival of such splenic B cells [22]. Furthermore, certain subsets of stimulated B cells in mice are known to express both BAFF and APRIL [30]. In this context, we decided to study the transcriptional levels of these cytokines and receptors in response to VHSV in vivo stimulation in FACS isolated peritoneal IgM cells and IgMþ B cells. BAFF, APRIL, BALM, BAFF-R and TACI were all modulated in response to VHSV in IgMþ B cells, whereas only BALM was up-regulated in IgM cells in response to VHSV. In the case of BAFF, transcriptional levels in control fish were similar between IgMþ and IgM cells, suggesting that in homeostasis BAFF can be produced by B cells and other cell types, probably myeloid cells. Despite this, only IgMþ B cells significantly up-regulated BAFF transcription in response to the virus. On the other hand, only IgMþ B cells from VHSV-injected fish transcribed APRIL, pointing to IgMþ B cells as the main source of APRIL in the peritoneum. Interestingly, in mammals, APRIL is constitutively produced by peritoneal B1 cells but not by other B cell subsets [30]. In the case of BALM, although IgMþ B cells seemed as the main cells responsible for its secretion in homeostasis, both IgMþ and IgM appear to contribute to BALM production in response to VHSV. Given the absence of BALM sequences in tetrapods and its recent discovery in lampreys, BALM is considered to be an ancestral member of this subfamily of cytokines [31]. Consequently, its biological function or regulation cannot be inferred from mammalian studies. In this sense, the current study constitutes the first to describe aspects of the regulation and biological function of this fish-specific cytokine. Having established that peritoneal IgMþ B cells up-regulate the transcription of BAFF and BALM and induce the transcription of APRIL in response to VHSV, we also studied how their putative receptors were regulated. BAFF-R and BCMA were constitutively transcribed in peritoneal IgMþ B cells suggesting these two receptors play an important role in peritoneal B cell homeostasis, however, only BAFF-R was up-regulated in response to VHSV. In mammals, BCMA expression is mostly restricted to antibodyproducing cells as signaling through BCMA is an essential step for plasma cell survival [32,33], whereas BAFF-R is mainly responsible for increasing B cell survival of resting or transitional B cells [34]. On the other hand, TACI was not constitutively expressed by either peritoneal or splenic IgMþ B cells suggesting that this receptor is not involved in B cell homeostasis, but was induced by VHSV exposure in peritoneal B cells exclusively. Similarly, in mammals,
TACI is highly inducible [35] and is mostly expressed by peritoneal B1 cells [36], thus playing a key role in the orchestration of T-independent B cell responses [34]. Taking into account that peritoneal IgMþ B cells up-regulated BAFF, APRIL and BALM transcription in response to VHSV, and knowing that they transcribed the required receptors for these cytokines to signal, it seems logical to think that these cytokines are induced in response to the virus to regulate IgMþ B cell function in an autocrine way. To further support this hypothesis, we produced the three recombinant cytokines and tested their effects on the survival of peritoneal IgMþ B cells. Although BAFF has been reported to increase the survival of splenic B cells [22], no significant effect on peritoneal IgMþ B cells was observed. On the contrary, BALM and APRIL significantly increased IgMþ B cell survival, especially the latter, suggesting that these two cytokines are contributing to the expansion of the IgMþ B cell compartment that is observed in response to the virus [13]. It could be possible that the induction of BAFF is regulating in an autocrine loop different aspects of B cell differentiation also affected by VHSV, but this is something that should be further studied. In summary, we have demonstrated that the i.p. injection of VHSV provokes that peritoneal IgMþ B cells up-regulate the transcription of BAFF, BALM and BAFF-R and induce the transcription of APRIL and TACI not transcribed by B cells in homeostasis. This transcriptional response could be reproduced incubating peritoneal IgMþ B cells with VHSV in vitro, but was not observed in splenic IgMþ B cells, thus demonstrating a specific capacity of peritoneal B cells to directly respond to the virus. Finally, having established that recombinant APRIL and BALM increase the survival of peritoneal IgMþ B cells, it seems plausible to suggest that the autocrine production and subsequent up-regulation of these two cytokines contributes to the expansion of IgMþ B cells that takes place in the peritoneum in response to VHSV.
Acknowledgements This work was supported by the European Research Council (ERC Starting Grant 2011 280469), the European Commission under the 7th Framework Programme for Research and Technological Development (FP7) of the European Union (Grant Agreement 311993 TARGETFISH) and by the Spanish Ministry of Economy and Competitiveness (MINECO) (grant AGL-2014-54456-JIN).
I. Soleto et al. / Fish & Shellfish Immunology 64 (2017) 210e217
Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2017.03.023. References [1] L.O. Afonso, P.M. Campbell, G.K. Iwama, R.H. Devlin, E.M. Donaldson, The effect of the aromatase inhibitor fadrozole and two polynuclear aromatic hydrocarbons on sex steroid secretion by ovarian follicles of coho salmon, Gen. Comp. Endocrinol. 106 (1997) 169e174. [2] J.C. Baiano, R.A. Tumbol, A. Umapathy, A.C. Barnes, Identification and molecular characterisation of a fibrinogen binding protein from Streptococcus iniae, BMC Microbiol. 8 (2008) 67. [3] J. Meseguer, A. Lopez-Ruiz, M. Angeles Esteban, Cytochemical characterization of leucocytes from the seawater teleost, gilthead seabream (Sparus aurata L.), Histochemistry 102 (1994) 37e44. [4] L.D. Moss, M.M. Monette, L. Jaso-Friedmann, J.H. Leary 3rd, S.T. Dougan, T. Krunkosky, et al., Identification of phagocytic cells, NK-like cytotoxic cell activity and the production of cellular exudates in the coelomic cavity of adult zebrafish, Dev. Comp. Immunol. 33 (2009) 1077e1087. [5] A. Afonso, S. Lousada, J. Silva, A.E. Ellis, M.T. Silva, Neutrophil and macrophage responses to inflammation in the peritoneal cavity of rainbow trout Oncorhynchus mykiss. A light and electron microscopic cytochemical study, Dis. Aquat. Organ 34 (1998) 27e37. [6] E. Chaves-Pozo, P. Munoz, A. Lopez-Munoz, P. Pelegrin, A. Garcia Ayala, V. Mulero, et al., Early innate immune response and redistribution of inflammatory cells in the bony fish gilthead seabream experimentally infected with Vibrio anguillarum, Cell Tissue Res. 320 (2005) 61e68. [7] A. do Vale, A. Afonso, M.T. Silva, The professional phagocytes of sea bass (Dicentrarchus labrax L.): cytochemical characterisation of neutrophils and macrophages in the normal and inflamed peritoneal cavity, Fish. Shellfish Immunol. 13 (2002) 183e198. [8] D.T. Gauthier, M.W. Rhodes, W.K. Vogelbein, H. Kator, C.A. Ottinger, Experimental mycobacteriosis in striped bass Morone saxatilis, Dis. Aquat. Organ 54 (2003) 105e117. [9] O.B. Reite, The rodlet cells of teleostean fish: their potential role in host defence in relation to the role of mast cells/eosinophilic granule cells, Fish. Shellfish Immunol. 19 (2005) 253e267. [10] A. White, T.C. Fletcher, M.B. Pepys, B.A. Baldo, The effect of inflammatory agents on C-reactive protein and serum amyloid P-component levels in plaice (Pleuronectes platessa L.) serum, Comp. Biochem. Physiol. C 69 (1981) 325e329. [11] A. White, J.I. MacArthur, T.C. Fletcher, Distribution of endotoxin and its effect on serum concentrations of C-reactive protein and cortisol in the plaice (Pleuronectes Platessa L.), Comp. Biochem. Physiol. C 79 (1984) 97e101. [12] T. Korytar, J. Jaros, M. Verleih, A. Rebl, G. Kotterba, C. Kuhn, et al., Novel insights into the peritoneal inflammation of rainbow trout (Oncorhynchus mykiss), Fish. Shellfish Immunol. 35 (2013) 1192e1199. [13] R. Castro, B. Abos, L. Gonzalez, A.G. Granja, C. Tafalla, Expansion and differentiation of IgMþ B cells in the rainbow trout peritoneal cavity in response to different antigens, Dev. Comp. Immunol. 70 (2017) 119e127. [14] C. Bossen, P.B.A.F.F. Schneider, APRIL and their receptors: structure, function and signaling, Semin. Immunol. 18 (2006) 263e275. [15] H.A. Kim, S.H. Jeon, G.Y. Seo, J.B. Park, P.H. Kim, TGF-beta1 and IFN-gamma stimulate mouse macrophages to express BAFF via different signaling pathways, J. Leukoc. Biol. 83 (2008) 1431e1439. [16] B. Nardelli, O. Belvedere, V. Roschke, P.A. Moore, H.S. Olsen, T.S. Migone, et al., Synthesis and release of B-lymphocyte stimulator from myeloid cells, Blood
217
97 (2001) 198e204. [17] P. Schneider, The role of APRIL and BAFF in lymphocyte activation, Curr. Opin. Immunol. 17 (2005) 282e289. [18] J.A. Gross, J. Johnston, S. Mudri, R. Enselman, S.R. Dillon, K. Madden, et al., TACI and BCMA are receptors for a TNF homologue implicated in B-cell autoimmune disease, Nature 404 (2000) 995e999. [19] J.S. Thompson, S.A. Bixler, F. Qian, K. Vora, M.L. Scott, T.G. Cachero, et al., BAFFR, a newly identified TNF receptor that specifically interacts with BAFF, Science 293 (2001) 2108e2111. [20] G.W. Glenney, G.D. Wiens, Early diversification of the TNF superfamily in teleosts: genomic characterization and expression analysis, J. Immunol. 178 (2007) 7955e7973. [21] A.G. Granja, J.W. Holland, J. Pignatelli, C.J. Secombes, C. Tafalla, Characterization of BAFF and APRIL subfamily receptors in rainbow trout (Oncorhynchus mykiss). Potential role of the BAFF/APRIL axis in the pathogenesis of proliferative kidney disease, PLoS One (2017), http://dx.doi.org/10.1371/ journal.pone.0174249. [22] C. Tafalla, L. Gonzalez, R. Castro, A.G. Granja, BAFF regulates different aspescts of B cell functionality and is produced by a subset of splenic B cells in teleost fish, Front. Immunol. (2017), http://dx.doi.org/10.3389/fimmu.2017.00295. [23] I.H. Zahl, O. Samuelsen, A. Kiessling, Anaesthesia of farmed fish: implications for welfare, Fish. Physiol. Biochem. 38 (2012) 201e218. [24] R. Castro, E. Bromage, B. Abos, J. Pignatelli, A. Gonzalez Granja, A. Luque, et al., CCR7 is mainly expressed in teleost gills, where it defines an IgDþIgM- B lymphocyte subset, J. Immunol. 192 (2014) 1257e1266. [25] D. DeLuca, M. Wilson, G.W. Warr, Lymphocyte heterogeneity in the trout, Salmo gairdneri, defined with monoclonal antibodies to IgM, Eur. J. Immunol. 13 (1983) 546e551. [26] F. Mackay, P.A. Silveira, R. Brink, B cells and the BAFF/APRIL axis: fast-forward on autoimmunity and signaling, Curr. Opin. Immunol. 19 (2007) 327e336. [27] S.A. Ha, M. Tsuji, K. Suzuki, B. Meek, N. Yasuda, T. Kaisho, et al., Regulation of B1 cell migration by signals through Toll-like receptors, J. Exp. Med. 203 (2006) 2541e2550. [28] H. Moon, J.G. Lee, S.H. Shin, T.J. Kim, LPS-induced migration of peritoneal B-1 cells is associated with upregulation of CXCR4 and increased migratory sensitivity to CXCL12, J. Korean Med. Sci. 27 (2012) 27e35. [29] F.B. Vincent, D. Saulep-Easton, W.A. Figgett, K.A. Fairfax, F. Mackay, The BAFF/ APRIL system: emerging functions beyond B cell biology and autoimmunity, Cytokine Growth Factor Rev. 24 (2013) 203e215. [30] V.T. Chu, P. Enghard, G. Riemekasten, C. Berek, In vitro and in vivo activation induces BAFF and APRIL expression in B cells, J. Immunol. 179 (2007) 5947e5957. [31] S. Das, Y. Sutoh, M. Hirano, Q. Han, J. Li, M.D. Cooper, et al., Characterization of lamprey BAFF-like gene: evolutionary implications, J. Immunol. 197 (2016) 2695e2703. [32] J.R. Darce, B.K. Arendt, X. Wu, D.F. Jelinek, Regulated expression of BAFFbinding receptors during human B cell differentiation, J. Immunol. 179 (2007) 7276e7286. [33] B.P. O'Connor, V.S. Raman, L.D. Erickson, W.J. Cook, L.K. Weaver, C. Ahonen, et al., BCMA is essential for the survival of long-lived bone marrow plasma cells, J. Exp. Med. 199 (2004) 91e98. [34] G.U. von Bulow, J.M. van Deursen, R.J. Bram, Regulation of the T-independent humoral response by TACI, Immunity 14 (2001) 573e582. [35] L.S. Treml, G. Carlesso, K.L. Hoek, J.E. Stadanlick, T. Kambayashi, R.J. Bram, et al., TLR stimulation modifies BLyS receptor expression in follicular and marginal zone B cells, J. Immunol. 178 (2007) 7531e7539. [36] S. Shulga-Morskaya, M. Dobles, M.E. Walsh, L.G. Ng, F. MacKay, S.P. Rao, et al., B cell-activating factor belonging to the TNF family acts through separate receptors to support B cell survival and T cell-independent antibody formation, J. Immunol. 173 (2004) 2331e2341.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
The BAFF / APRIL axis plays an important role in virus-induced peritoneal responses in rainbow trout s 1, Rosario Castro, Lucia Gonza lez, Carolina Tafalla**, Irene Soleto 1, Beatriz Abo Aitor G. Granja* n en Sanidad Animal (CISA-INIA), Madrid, Spain Centro de Investigacio
a r t i c l e i n f o
a b s t r a c t
Article history: Received 23 December 2016 Received in revised form 8 March 2017 Accepted 10 March 2017 Available online 14 March 2017
IgMþ B cells have been recently demonstrated to be key regulators of peritoneal inflammation in teleost, as a large number of them occupy the peritoneal cavity after 48 h of antigenic stimulation. Despite this, the number of studies addressing the mechanism through which this cell population expands and differentiates in response to stimuli has been scarcely addressed. Because the BAFF/APRIL axis is known to play a major role in B cell survival and differentiation in mammals, we hypothesized that it could be affected in the peritoneal cavity in response to an inflammatory stimulus. To verify this hypothesis, we studied how BAFF, APRIL and the fish-specific related cytokine BALM as well as their putative receptors are regulated in rainbow trout after intraperitoneal (i.p.) injection of viral hemorrhagic septicemia virus (VHSV). When the transcriptional analysis was performed in total cells from the peritoneum, we observed that VHSV provoked an up-regulation of both BAFF and BAFF receptor (BAFF-R) mRNA levels. However, when we examined how isolated peritoneal IgMþ B cells were transcriptionally affected by VHSV i.p. injection, we found that APRIL, BALM and the transmembrane activator and calcium modulator and cyclophilin ligand interactor (TACI) were also up-regulated in response to the virus. IgM cells, on the other hand, only up-regulated BALM transcription in response to VHSV. Finally, to gain further insight on the role that these cytokines play in the peritoneum, we have studied their effect on the survival of peritoneal IgMþ B cells. This work demonstrates a key role for the BAFF/APRIL axis in the peritoneal inflammatory response and contributes to further understanding how IgMþ B cells are regulated at this specific peripheral site. © 2017 Published by Elsevier Ltd.
Keywords: Rainbow trout Peritoneum Viral hemorrhagic septicemia virus (VHSV) BAFF APRIL BALM BAFF receptors
1. Introduction So far, intraperitoneal (i.p.) injection seems as the most effective vaccination route in aquaculture, since a high number of i.p.administered fish vaccines are capable of conferring strong and long-lasting immune responses, while on the contrary, vaccination through other routes such as oral or bath confer disappointing protection levels. Despite this, how peritoneal leukocytes are regulated upon antigen encounter has only been scarcely studied in fish. Resident peritoneal leukocytes are known to include both myeloid cells (monocytes, macrophages and granulocytes) and lymphocytes, in different ratios depending on the fish species
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (C. Tafalla), [email protected] (A.G. Granja). 1 These authors have contributed equally to this work. http://dx.doi.org/10.1016/j.fsi.2017.03.023 1050-4648/© 2017 Published by Elsevier Ltd.
[1e4]. However, in the past, most studies that have addressed the recruitment and activation of cells in the peritoneal cavity upon the injection of different stimuli have exclusively focused on myeloid cells [5e11]. In 2013, Korytar et al. [12], described the nature of the cells in the peritoneal cavity of rainbow trout (Oncorhynchus mykiss) after a bacterial infection with Aeromonas salmonicida and observed that while the first hours of inflammation were dominated by myeloid cells, lymphocytes predominated at the later times, with IgMþ B cells representing almost half of all peritoneal cells after 48 h post-immunization. We have recently confirmed these results, having established that rainbow trout IgMþ B cells dominate the peritoneum upon exposure to Escherichia coli, E. coliderived lipopolysaccharide (LPS) or viral hemorrhagic septicemia virus (VHSV) [13]. Furthermore, we have also demonstrated that in response to either E. coli or VHSV some of these peritoneal IgMþ B cells differentiate towards plasmablasts/plasma cells, whereas others seem to be implicated in antigen presentation [13].
I. Soleto et al. / Fish & Shellfish Immunology 64 (2017) 210e217
BAFF (B cell activating factor) and APRIL (a proliferation inducing ligand) are two cytokines belonging to the tumor necrosis factor (TNF) superfamily which are key regulators of B cell function in mammals [14]. BAFF and APRIL are mainly produced by innate immune cells such as macrophages or dendritic cells in response to different pro-inflammatory stimuli to regulate B cell survival, maturation and differentiation [15]. Both of them are type II transmembrane proteins which become soluble ligands after cleavage at the cell surface by a furin-like protease, with both the membrane-bound and soluble forms being biologically active [16]. Concerning the receptors through which they signal, both BAFF and APRIL bind to B cell maturation antigen (BCMA, also known as TNFRSF17) and transmembrane activator and calcium modulator and cyclophilin ligand interactor (TACI, also known as TNFRSF13B), whereas BAFF also binds to BAFF receptor (BAFF-R, also known as BR3 or TNFRSF13C) [17]. All three receptors are preferentially expressed in B cells [18,19]. In rainbow trout, homologues to both BAFF and APRIL have been identified as well as a further cytokine designated as a BAFF and APRIL-like molecule (BALM) [20]. BALM has a high sequence similarity with BAFF but shares some structural characteristics of APRIL. Concerning their putative receptors, homologues to BAFF-R, BCMA and TACI have also been reported in this species [21]. Furthermore, the fact that rainbow trout BAFF promotes the survival of splenic B cells has also been recently demonstrated [22]. In this context, we thought of interest to explore the regulation of BAFF, APRIL and BALM as well as their three putative receptors in the rainbow trout peritoneal cavity upon stimulation with VHSV. These experiments would help us establish whether this cytokine family is involved in the expansion and the differentiation of IgMþ B cells observed in the peritoneum in response to the virus. For this, we first studied gene transcription in complete peritoneal cells to then focus on how isolated IgMþ B cells respond to the virus. Additionally, to establish if peritoneal B cells are directly activated by VHSV or require signals exclusively received in vivo, we have compared the transcriptional responses obtained in peritoneal IgMþ B cells after i.p. injection to the B cell responses observed when leukocyte cultures from spleen or peritoneum were exposed to the virus in vitro. Finally, to determine which of these cytokines plays a more prominent role on the expansion of IgMþ B cells, we have produced them recombinantly and studied their effects on the survival of peritoneal IgMþ B cells. Our results demonstrate that peritoneal B cells but not splenic B cells specifically regulate BAFF, APRIL, BALM, BAFF-R and TACI in response to VHSV. Because we have also demonstrated that APRIL and BALM increase peritoneal IgMþ B cell survival, it seems plausible that these two cytokines are involved in the expansion of the peritoneal IgMþ B cell subpopulation observed in response to VHSV. All these experiments contribute to a further understanding of the mechanisms through which peritoneal inflammation is organized in fish, revealing a key role for the BAFF/APRIL axis. 2. Materials and methods
of laboratory animals and were previously approved by the Ethics n y Tecnocommittee from the Instituto Nacional de Investigacio logía Agraria y Alimentaria (INIA). Anesthesia was applied following Zhal et al. recommendations for general anesthesia (narcosis) [23] prior to sacrifice, and all efforts were made to minimize suffering. 2.2. VHSV intraperitoneal injection Rainbow trout of approximately 5e10 g were i.p. injected with VHSV (100 ml of a viral solution containing 1 106 TCID50/ml) or with the same volume of PBS. At days 1, 3 or 7 post-injection, seven fish from each group were sacrificed by benzocaine overdose. Exudate cells from the peritoneal cavity were obtained by perfusion with 2 ml of Leibovitz medium (L-15) supplemented with 100 IU/ ml penicillin, 100 mg/ml streptomycin, 10 units/ml heparin and 5% fetal calf serum (FCS) (all obtained from Life Technologies). 2.3. Gene expression analysis in total peritoneal cells RNA was extracted from peritoneal cells using Trizol (Life Technologies) following the manufacturer's instructions. The RNA pellet was washed with 75% ethanol, dissolved in diethylpyrocarbonate (DEPC)-treated water and stored at 80 C until used. 1 mg of RNA from each individual was treated with DNAse I to remove any genomic DNA traces that might interfere with the PCR reactions and then used to obtain cDNA using the Superscript II reverse transcriptase (Life Technologies) following manufacturer's instructions. The cDNA was diluted in a 1:10 proportion with DEPCtreated water and stored at 20 C. To evaluate gene transcription levels, real-time PCR was performed in a LightCycler® 96 System instrument (Roche) using FastStart essential DNA green master (Roche) and specific primers (Table 1). Each sample was measured under the following conditions: 10 min at 95 C, followed by 40 amplification cycles (10 s at 95 C, 10 s at 60 C and 10 s at 72 C). The expression of individual genes was normalized to relative expression of trout EF-1a and the expression levels were calculated using the 2DCt method, where DCt is determined by subtracting the EF-1a value from Ct of the targeted gene as previously described [24]. EF1a was selected as reference gene according to the MIQE guidelines (Bustin et al., 2009. Clinical Chemistry 55:4 p611-622). A statistical analysis determined there were no differences between the means of the expression of EF1a of control and VHSV-infected groups of animals. Negative controls with no template were also included. A melting curve for each PCR was determined by reading fluorescence every Table 1 Primers used for real-time PCR analysis in this study. Gene
Primer name
Primer sequence (50 -30 )
BAFF
RT-BAFF-F RT-BAFF-R RT-APRIL-F RT-APRIL-R RT-BALM-F RT-BALM-R RT-BAFFR-F RT-BAFFR-R RT-BCMA-F RT-BCMA-R RT-TACI-F RT-TACI-F RT-VHSV-N-F RT-VHSV-N-R RT-EF1a-F RT-EF1a-R
ATGTTTGATGCTTATTCTGGCAGGT TGGGACTGTGTCTTGACTGTGTGTA CACAGACATACACAATGGAATGGAA TGTGATGACAGAGGAACAAGATGAA TGGAGGTACAGTAGTTCAGCAGTCG ACTATCCAAGGAATCACCGTCACAT TGTCTGGATATCAATGGTCGTCATA CTTTAGCTGGAGGGTTAAGTCTTGC ATGTCAGAAGGACAGTGTGGACTGG CGGCTCTGGGGCTTTGCTCT GCATCGAGTACTGTGCTTCTCTAGG AAGTCAGGCTGTTGGGTCTTACATT GAGAGAACTGGCCCTGACTG CCCGAGTTTCTTGGTGATGT GATCCAGAAGGAGGTCACCA TTACGTTCGACCTTCCATCC
APRIL
2.1. Fish Rainbow trout (Oncorhynchus mykiss) were obtained from Centro de Acuicultura El Molino (Madrid, Spain) and maintained at n en Sanidad the animal facilities of the Centro de Investigacio Animal (CISA-INIA, Spain) in a re-circulating water system at 16 C, with 12:12 h light:dark photoperiod. Fish were fed twice a day with a commercial diet (Skretting, Spain). Prior to any experimental procedure, fish were acclimatized to laboratory conditions for at least 2 weeks. The experiments described comply with the Guidelines of the European Union Council (2010/63/EU) for the use
211
BALM BAFF-R BCMA TACI VHSV-N EF-1a
212
I. Soleto et al. / Fish & Shellfish Immunology 64 (2017) 210e217
degree between 60 C and 95 C to ensure only a single product had been amplified. þ
2.4. Isolation of IgM B cells from the peritoneal cavity Peritoneal cells from VHSV-injected and PBS-injected fish were obtained from the peritoneal cavity by perfusion with 2 ml of L-15 media supplemented with antibiotics, heparin and 5%FCS at different times post-injection, as described above. Cell suspensions were then placed onto 30/51% discontinuous Percoll (GE Healthcare) density gradients and centrifuged at 500g for 30 min at 4 C. The interface cells were collected and washed twice in L-15 containing 5% FCS. Purified leukocytes were incubated for 30 min on ice with a specific anti-trout IgM antibody (1.14) coupled to R-PE [25]. Following two washing steps, cells were resuspended in PBS and IgMþ cells were sorted using a BD FACSAria III (BD Biosciences), using first their FSC/SSC profiles (to exclude the granulocyte gate) and then on the basis of the fluorescence emitted by the sample. IgMþ and IgM cells were then collected separately for RNA isolation. 2.5. Gene expression analysis in FACS isolated peritoneal IgMþ B cells Total cellular RNA was isolated from IgMþ and IgM sorted populations from the peritoneal cavity using the Power Sybr Green Cells-to-Ct Kit (Invitrogen) following manufacturer's instructions. RNAs were treated with DNAse during the process to remove genomic DNA that might interfere with the PCR reactions. Reverse transcription was also performed using the Power Sybr Green Cellsto-Ct Kit (Invitrogen) following manufacturer's instructions. To evaluate the levels of transcription of the different genes, real-time PCR was performed using SYBR Green PCR core Reagents (Applied Biosystems). Each sample was measured in duplicate under the following conditions: 10 min at 95 C, followed by 45 amplification cycles (15 s at 95 C and 1 min at 60 C). A melting curve for each PCR was also included to ensure only a single product had been amplified. The expression of individual genes was normalized to the relative expression of trout housekeeping gene EF-1a elongation factor as described above. 2.6. In vitro stimulation of peritoneal and splenic leukocytes with VHSV Rainbow trout of approximately 10e15 cm were killed by benzocaine overdose and peritoneal leukocytes isolated as described above. Spleen was also collected and placed in L-15 medium supplemented with P/S, heparin and 5%FCS. Single cell suspensions from spleen were obtained using 100 mm nylon cell strainers (BD Biosciences). Both peritoneal and splenic cell suspensions were placed onto 30/51% discontinuous Percoll density gradients and centrifuged at 500g for 30 min at 4 C. The interface cells were collected and washed twice in L-15 containing 5% FCS. Peritoneal or splenic leukocytes adjusted to 2 106 cells/ml in L-15 with 5% FCS were disposed in 24-well plates and exposed to VHSV at a final concentration of 2 106 TCID50/ml. After 48 h of incubation at 14 C, the samples were labeled with an anti-IgM mAb and IgMþ cells were FACS isolated as described above. Total cellular RNA was isolated from IgMþ B cell populations from the different tissues using the Power Sybr Green Cells-to-Ct Kit following manufacturer's instructions. Reverse transcription to cDNA and realtime PCR reactions were performed and analyzed as described above.
2.7. Production of recombinant BAFF, APRIL and BALM Although mammalian BAFF and APRIL have several N-glycosylation sites, no N-glycosylation sites were found in the rainbow trout BAFF sequence, one in APRIL and one in BALM. In any case, the absence of N-glycosylation does not seem to alter functionality of these cytokines in mammals, given the fact that recombinant BAFF and APRIL produced in Escherichia coli are active. Thus, to study the effects of rainbow trout BAFF, APRIL and BALM on IgMþ B cell survival, we produced them in E. coli. To carry this out, the nucleotide sequence corresponding to the extracellular domain of the rainbow trout BAFF sequence (GenBank Accession number DQ218467.1), APRIL (GenBank Accession number EF451543.1) or BALM (GenBank Accession number DQ218469.1) sequences together with an N-terminal 6 x histidine tag were synthetized and subcloned into the E3 expression vector (Abyntek). The recombinant plasmids were transformed into BL21 cells and kanamycinresistant single positive colonies for each clone were then incubated at 37 C in Luria-Bertani (LB) media. When the OD600 reached 0.6, 0.1 mM of isopropyl b-D-thiogalactoside (IPTG, Sigma Aldrich) was added to induce protein production. After 16 h, cells were harvested, lysed by sonication and dissolved using urea. Thereafter, BAFF, APRIL or BALM were obtained through the use of Nickel columns (Sigma Aldrich). The protein-containing fractions were pooled, refolded, filtered through 0.22 mm and resuspended in storage buffer (50 mM Tris-HCl, 150 mM NaCl, 10% glycerol, 0.5 M Larginine and 2 mM DTT, pH 8.5). Protein concentrations were determined in a BCA protein assay (Thermo Fisher Scientific) and the recombinant rainbow trout cytokines (0.3 mg/ml) aliquoted and stored at 80 C until used. An irrelevant protein with a similar molecular weight to that of these recombinant proteins, also bearing an N-terminal His tag was produced in the same conditions (C-His) and was used as a functional control. 2.8. Effect of BAFF, APRIL and BALM on the survival of peritoneal IgMþ B cells Peritoneal leukocytes were incubated in the presence of recombinant rainbow trout BAFF, APRIL or BALM, or the C-His control protein, at a final concentration of 3 mg/ml. A wide range of doses of these stimuli were tested and the optimal doses were selected based on their effect on B cell survival (data not shown). After 72 h of incubation, cells were labeled with PE-labeled anti-IgM (1.14) antibody and live IgMþ B cells were quantified by flow cytometry on a FACSCalibur flow cytometer (BD Biosciences) equipped with CellQuest Pro software. Analysis was performed with FlowJo 10 (TreeStar). 2.9. Statistics Data handling, analyses and graphic representation was performed using Microsoft Office Excel 2010. Statistical analyses were performed using a two-tailed Student's t-test with Welch's correction when the F test indicated that the variances of both groups differed significantly. The differences between the mean values were considered significant on different degrees, where * means P 0.05, ** means P 0.01 and *** means P 0.005 (GraphPad Prism 4 software). 3. Results 3.1. Effect of VHSV on BAFF, APRIL and BALM transcription in the peritoneum Given the fact that previous experiments have demonstrated
I. Soleto et al. / Fish & Shellfish Immunology 64 (2017) 210e217
that the i.p. injection of VHSV to rainbow trout provokes a significant increase in the number of IgMþ B cells within the peritoneal cavity as well as a local B differentiation [13], we thought relevant to study the levels of transcription of cytokines of the TNF subfamily known to regulate B cell responses in mammals. Thus, we analyzed whether BAFF, APRIL and BALM expression was affected by VHSV. After i.p. administration of the virus, we observed a significant up-regulation of BAFF transcriptional levels in peritoneal leukocytes at days 1, 3 and 7 after injection (Fig. 1A). The upregulation on BAFF transcription reached a 10-times increase on day 1 and remained at a 3-times increase on days 3 and 7. On the contrary, no up-regulation was observed for either APRIL or BALM after the viral challenge (Fig. 1B and C). 3.2. Effect of VHSV on the transcription of BAFF receptors in the peritoneum In mammals, both BAFF and APRIL bind to and signal through BCMA and TACI receptors, with BAFF also binding to BAFF-R with very high affinity (reviewed in Ref. [26]). Since homologue sequences to BAFF-R, BCMA and TACI have been very recently reported in teleost [21], we thought of importance to analyze whether VHSV challenge could also modulate the expression of these BAFF-APRIL subfamily receptors. After i.p. administration of the virus, we observed a significant up-regulation of around 4times increase of the transcriptional levels of BAFF-R in peritoneal leukocytes at days 1, 3 and 7 after injection (Fig. 2A). On the contrary, no up-regulation was observed for either BCMA or TACI after the viral challenge (Fig. 2B and C). 3.3. Effect of VHSV on BAFF, APRIL and BALM transcription in the IgMþ and IgM cells in the peritoneum In order to establish which cell types were responding to the virus in more detail, a further experiment was conducted to analyze the transcriptional responses to VHSV on IgMþ B cells and IgM cells. This analysis was performed at day 3 post-infection, since we observed the highest expression of the gene encoding for the protein N of VHSV at that time (Supplementary Fig. 1). Surprisingly, when we studied the response of peritoneal IgMþ B cells alone after VHSV i.p. injection, we found that in this case APRIL (Fig. 3B) and BALM (Fig. 3C) were also up-regulated in addition to BAFF (Fig. 3A). Within the IgM cell compartment, BAFF was expressed at high levels in control animals but no up-regulation was observed after
213
VHSV i.p. injection (Fig. 3A). In the case of APRIL, only IgMþ B cells from VHSV-injected fish showed detectable mRNA levels for this cytokine (Fig. 3B). BALM, on the other hand, was not transcribed by IgM B cells in control fish, and was induced after VHSV infection (Fig. 3C). On the IgMþ cell compartment, BALM was expressed by control animals and was up-regulated (3-times increase) upon VHSV injection (Fig. 3C). These data suggest that peritoneal IgMþ B cells actively participate in the production of B cell stimulating cytokines during the immune response against VHSV. 3.4. Effect of VHSV on the transcription of BAFF receptors in the IgMþ and IgM cells in the peritoneum Because BAFF-R, BCMA and TACI receptors are preferentially expressed on B cells [17], we further analyzed the impact of VHSV on the expression of such receptors within the peritoneal cavity IgM and IgMþ cell compartments. BAFF-R expression was higher on IgMþ B cells compared to IgM cells and, interestingly, its expression was significantly increased after exposure to VHSV in both compartments, preferentially on IgMþ B cells (4.5-times increase) compared with IgM cells (2.5-times increase) (Fig. 4A). On the contrary, BCMA transcription was not affected by VHSV either in IgM or in IgMþ cells from the peritoneal cavity (Fig. 4B). Regarding TACI, its expression levels were undetectable on IgM cells in both control and infected animals or IgMþ B cells from control fish, but were significantly induced in peritoneal IgMþ B cells after exposure to VHSV (Fig. 4C). 3.5. Comparative effect of VHSV on peritoneal and splenic leukocytes after in vitro viral exposure To establish if the transcriptional effects on the BAFF/APRIL axis provoked by VHSV in peritoneal IgMþ B cells require external signals only received in vivo or are a consequence of the direct effect of VHSV on B cells, we isolated peritoneal leukocytes, incubated them with VHSV in vitro and analyzed the transcriptional response of sorted IgMþ B cell populations. This experiment was also carried out with splenic IgMþ B cells to also establish if the response to VHSV observed was exclusive of peritoneal IgMþ B cells. When peritoneal IgMþ B cells were incubated with VHSV, the transcriptional responses observed were identical to those observed in IgMþ B cell populations from VHSV-infected fish. The virus up-regulated the transcription of BAFF, APRIL and BALM (3-times increase) as well as that of BAFF-R and TACI in IgMþ B cells (4-times increase)
Fig. 1. Regulation of BAFF, APRIL and BALM transcription in peritoneal cavity leukocytes in response to VHSV. Rainbow trout were i.p. injected with 100 ml of saline containing 1 105 TCID50 of VHSV or the same volume of saline as control. Fish were kept at 16 C, peritoneal leukocytes obtained at days 1, 3 and 7 post-infection and RNA extracted from total cells as described in Materials and Methods. The transcription levels of BAFF, APRIL and BALM genes relative to the endogenous control gene EF-1a were calculated for each sample and are shown as mean þ SD (n ¼ 6). Statistical differences were evaluated by an unpaired two-tailed Student's t-test, where * means p 0.05 and ** means p 0.01.
214
I. Soleto et al. / Fish & Shellfish Immunology 64 (2017) 210e217
Fig. 2. Regulation of BAFF-R, BCMA and TACI transcription in peritoneal cavity leukocytes in response to VHSV. Rainbow trout were i.p. injected with 100 ml of saline containing 1 105 TCID50 of VHSV or the same volume of saline as control. Fish were kept at 16 C, peritoneal leukocytes obtained at days 1, 3 and 7 post-infection and RNA extracted from total cells as described in Materials and Methods. The transcription levels of BAFF-R, BCMA and TACI genes relative to the endogenous control gene EF-1a were calculated for each sample, and are shown as mean þ SD (n ¼ 6). Statistical differences were evaluated by an unpaired two-tailed Student's t-test, where * means p 0.05, ** means p 0.01 and *** means p 0.005.
Fig. 3. Regulation of BAFF, APRIL and BALM transcription in peritoneal cavity IgMþ B cells in response to VHSV. Rainbow trout were i.p. injected with 100 ml of saline containing 1 105 TCID50 of VHSV or the same volume of saline as control. Fish were kept at 16 C and peritoneal leukocytes obtained at day 3 post-infection. Peritoneal leukocytes were then stained with an anti-IgM mAb and IgMþ and IgM subpopulations were FACS isolated. RNA was then extracted from all collected samples and the transcription levels of BAFF, APRIL and BALM genes relative to the endogenous control gene EF-1a calculated for each fraction. Results are shown as mean þ SD (n ¼ 6). Statistical differences were evaluated by an unpaired two-tailed Student's t-test, where * means p 0.05 and *** means p 0.005.
Fig. 4. Regulation of BAFF-R, BCMA and APRIL transcription in peritoneal cavity IgMþ B cells in response to VHSV. Rainbow trout were i.p. injected with 100 ml of saline containing 1 105 TCID50 of VHSV or the same volume of saline as control. Fish were kept at 16 C and peritoneal leukocytes obtained at day 3 post-infection. Peritoneal leukocytes were then stained with an anti-IgM mAb and IgMþ and IgM subpopulations were FACS isolated. RNA was then extracted from all collected samples and the transcription levels of BAFF-R, BCMA and APRIL genes relative to the endogenous control gene EF-1a calculated for each fraction. Results are shown as mean þ SD (n ¼ 6). Statistical differences were evaluated by an unpaired two-tailed Student's t-test, where * means p 0.05 and *** means p 0.005.
I. Soleto et al. / Fish & Shellfish Immunology 64 (2017) 210e217
(Fig. 5A and B). When the experiment was performed using splenic IgMþ B cells, none of these genes were transcriptionally modulated by VHSV (Fig. 5A and B) suggesting that peritoneal IgMþ B cells respond to VHSV differently than splenic B cells. 3.6. Effect of BAFF, APRIL and BALM on the survival of peritoneal IgMþ B cells Given that cytokines and receptors of the BAFF/APRIL axis seem to be highly regulated in response to VHSV i.p. injection and knowing that this stimulation provokes an expansion of the IgMþ B cell compartment in the peritoneal cavity, we decided to test the effect that recombinant BAFF, APRIL and BALM proteins had on the survival of peritoneal IgMþ B cells. A wide range of doses of these cytokines were tested and the optimal dose (3 mg/ml) selected based on the effect on B cell survival (data not shown). The incubation of peritoneal leukocytes with either APRIL or BALM provoked a significant increase in IgMþ B cell survival after 72 h, representing an increase of 16% for APRIL and 8% for BALM (Fig. 6). This increase on B cell survival was not observed in response to BAFF (Fig. 6). 4. Discussion Although resident peritoneal leukocytes are known to include both lymphocytes and myeloid cells (monocytes, macrophages and granulocytes) [1,3,4], most studies that have addressed the recruitment and activation of cells in the peritoneal cavity upon the
215
injection of different stimuli have mainly focused on the behavior of myeloid cells in inflammation and the role of B cells in peritoneal inflammation has been neglected [5e11]. Nevertheless, recent studies have demonstrated that while the first hours of peritoneal inflammation are dominated by myeloid cells, lymphocytes predominate at the later times, with IgMþ B cells representing almost half of all peritoneal cells after 48 h post-immunization [12,13]. Furthermore, IgMþ B cells not only dominate the peritoneum upon antigenic exposure, but they also differentiate towards IgMsecreting cells or plasmablasts in response to stimuli such as VHSV or E. coli [13]. This behavior of peritoneal IgMþ B cells seems as a fish-specific response, as i.p. stimulation in mammals provokes a depletion of resident B cells which migrate to the spleen where they differentiate to plasma cells, accompanied with a great influx of monocytes, macrophages or granulocytes from blood to the peritoneal cavity [27,28]. In this context, to gain insight on the cytokines that could be regulating this expansion and differentiation of IgMþ B cells in the peritoneal cavity of rainbow trout injected with VHSV, we analyzed how the BAFF and APRIL subfamily of cytokines and receptors, which are responsible for the survival, proliferation and differentiation of B cells in mammals [17], were regulated during the course of the infection. First, we studied the transcriptional levels of cytokines and receptors of the BAFF/APRIL axis in complete leukocyte populations. In these experiments, we observed that both BAFF and BAFF-R mRNA levels were significantly up-regulated in VHSV-injected fish when compared to controls, whereas the other cytokines and cytokine receptors seemed unaltered by the infection. In mammals,
Fig. 5. Peritoneal cavity B cells but not splenic B cells up-regulate BAFF, APRIL, BALM, BAFF-R and TACI expression in response to VHSV in vitro. Peritoneal and splenic leukocytes adjusted to 2 106 cells/ml were exposed to VHSV (2 106 TCID50/ml). After 48 h of incubation at 14 C, the samples were labeled with an anti-IgM mAb and IgMþ cells were FACS isolated. Total RNA was isolated from IgMþ B cells to determine the levels of transcription of BAFF, APRIL and BALM (A) as well those of BAFF-R, BCMA and TACI (B) genes relative to the endogenous control gene EF-1a. Results are shown as mean þ SD (n ¼ 6). Statistical differences were evaluated by an unpaired two-tailed Student's t-test, where * means p 0.05.
216
I. Soleto et al. / Fish & Shellfish Immunology 64 (2017) 210e217
Fig. 6. BAFF, APRIL and BALM promote the survival of peritoneal cavity B cells. Peritoneal cavity leukocytes were incubated with recombinant BAFF (3 mg/ml), APRIL (3 mg/ml), BALM (3 mg/ml), or with a histidine-tagged irrelevant protein (c-His, 3 mg/ml) for 3 days at 20 C. After this time, cells were labeled with an anti-IgM mAb and analyzed by flow cytometry. The percentage of live IgMþ B cells among the lymphocyte gate was then determined. Quantification of average B cell survival is shown as mean þ SD (n ¼ 9). A representative dot plot for each experimental condition is also included. Statistical differences were evaluated by a two-tailed Student's t-test, where * means p 0.05 and *** means p 0.005.
BAFF and APRIL cytokines are mainly produced by myeloid cells and their expression is tightly regulated (summarized in Ref. [29]). Nevertheless, it has been recently shown that a subpopulation of fish splenic B cells produce BAFF in physiological conditions, promoting the survival of such splenic B cells [22]. Furthermore, certain subsets of stimulated B cells in mice are known to express both BAFF and APRIL [30]. In this context, we decided to study the transcriptional levels of these cytokines and receptors in response to VHSV in vivo stimulation in FACS isolated peritoneal IgM cells and IgMþ B cells. BAFF, APRIL, BALM, BAFF-R and TACI were all modulated in response to VHSV in IgMþ B cells, whereas only BALM was up-regulated in IgM cells in response to VHSV. In the case of BAFF, transcriptional levels in control fish were similar between IgMþ and IgM cells, suggesting that in homeostasis BAFF can be produced by B cells and other cell types, probably myeloid cells. Despite this, only IgMþ B cells significantly up-regulated BAFF transcription in response to the virus. On the other hand, only IgMþ B cells from VHSV-injected fish transcribed APRIL, pointing to IgMþ B cells as the main source of APRIL in the peritoneum. Interestingly, in mammals, APRIL is constitutively produced by peritoneal B1 cells but not by other B cell subsets [30]. In the case of BALM, although IgMþ B cells seemed as the main cells responsible for its secretion in homeostasis, both IgMþ and IgM appear to contribute to BALM production in response to VHSV. Given the absence of BALM sequences in tetrapods and its recent discovery in lampreys, BALM is considered to be an ancestral member of this subfamily of cytokines [31]. Consequently, its biological function or regulation cannot be inferred from mammalian studies. In this sense, the current study constitutes the first to describe aspects of the regulation and biological function of this fish-specific cytokine. Having established that peritoneal IgMþ B cells up-regulate the transcription of BAFF and BALM and induce the transcription of APRIL in response to VHSV, we also studied how their putative receptors were regulated. BAFF-R and BCMA were constitutively transcribed in peritoneal IgMþ B cells suggesting these two receptors play an important role in peritoneal B cell homeostasis, however, only BAFF-R was up-regulated in response to VHSV. In mammals, BCMA expression is mostly restricted to antibodyproducing cells as signaling through BCMA is an essential step for plasma cell survival [32,33], whereas BAFF-R is mainly responsible for increasing B cell survival of resting or transitional B cells [34]. On the other hand, TACI was not constitutively expressed by either peritoneal or splenic IgMþ B cells suggesting that this receptor is not involved in B cell homeostasis, but was induced by VHSV exposure in peritoneal B cells exclusively. Similarly, in mammals,
TACI is highly inducible [35] and is mostly expressed by peritoneal B1 cells [36], thus playing a key role in the orchestration of T-independent B cell responses [34]. Taking into account that peritoneal IgMþ B cells up-regulated BAFF, APRIL and BALM transcription in response to VHSV, and knowing that they transcribed the required receptors for these cytokines to signal, it seems logical to think that these cytokines are induced in response to the virus to regulate IgMþ B cell function in an autocrine way. To further support this hypothesis, we produced the three recombinant cytokines and tested their effects on the survival of peritoneal IgMþ B cells. Although BAFF has been reported to increase the survival of splenic B cells [22], no significant effect on peritoneal IgMþ B cells was observed. On the contrary, BALM and APRIL significantly increased IgMþ B cell survival, especially the latter, suggesting that these two cytokines are contributing to the expansion of the IgMþ B cell compartment that is observed in response to the virus [13]. It could be possible that the induction of BAFF is regulating in an autocrine loop different aspects of B cell differentiation also affected by VHSV, but this is something that should be further studied. In summary, we have demonstrated that the i.p. injection of VHSV provokes that peritoneal IgMþ B cells up-regulate the transcription of BAFF, BALM and BAFF-R and induce the transcription of APRIL and TACI not transcribed by B cells in homeostasis. This transcriptional response could be reproduced incubating peritoneal IgMþ B cells with VHSV in vitro, but was not observed in splenic IgMþ B cells, thus demonstrating a specific capacity of peritoneal B cells to directly respond to the virus. Finally, having established that recombinant APRIL and BALM increase the survival of peritoneal IgMþ B cells, it seems plausible to suggest that the autocrine production and subsequent up-regulation of these two cytokines contributes to the expansion of IgMþ B cells that takes place in the peritoneum in response to VHSV.
Acknowledgements This work was supported by the European Research Council (ERC Starting Grant 2011 280469), the European Commission under the 7th Framework Programme for Research and Technological Development (FP7) of the European Union (Grant Agreement 311993 TARGETFISH) and by the Spanish Ministry of Economy and Competitiveness (MINECO) (grant AGL-2014-54456-JIN).
I. Soleto et al. / Fish & Shellfish Immunology 64 (2017) 210e217
Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2017.03.023. References [1] L.O. Afonso, P.M. Campbell, G.K. Iwama, R.H. Devlin, E.M. Donaldson, The effect of the aromatase inhibitor fadrozole and two polynuclear aromatic hydrocarbons on sex steroid secretion by ovarian follicles of coho salmon, Gen. Comp. Endocrinol. 106 (1997) 169e174. [2] J.C. Baiano, R.A. Tumbol, A. Umapathy, A.C. Barnes, Identification and molecular characterisation of a fibrinogen binding protein from Streptococcus iniae, BMC Microbiol. 8 (2008) 67. [3] J. Meseguer, A. Lopez-Ruiz, M. Angeles Esteban, Cytochemical characterization of leucocytes from the seawater teleost, gilthead seabream (Sparus aurata L.), Histochemistry 102 (1994) 37e44. [4] L.D. Moss, M.M. Monette, L. Jaso-Friedmann, J.H. Leary 3rd, S.T. Dougan, T. Krunkosky, et al., Identification of phagocytic cells, NK-like cytotoxic cell activity and the production of cellular exudates in the coelomic cavity of adult zebrafish, Dev. Comp. Immunol. 33 (2009) 1077e1087. [5] A. Afonso, S. Lousada, J. Silva, A.E. Ellis, M.T. Silva, Neutrophil and macrophage responses to inflammation in the peritoneal cavity of rainbow trout Oncorhynchus mykiss. A light and electron microscopic cytochemical study, Dis. Aquat. Organ 34 (1998) 27e37. [6] E. Chaves-Pozo, P. Munoz, A. Lopez-Munoz, P. Pelegrin, A. Garcia Ayala, V. Mulero, et al., Early innate immune response and redistribution of inflammatory cells in the bony fish gilthead seabream experimentally infected with Vibrio anguillarum, Cell Tissue Res. 320 (2005) 61e68. [7] A. do Vale, A. Afonso, M.T. Silva, The professional phagocytes of sea bass (Dicentrarchus labrax L.): cytochemical characterisation of neutrophils and macrophages in the normal and inflamed peritoneal cavity, Fish. Shellfish Immunol. 13 (2002) 183e198. [8] D.T. Gauthier, M.W. Rhodes, W.K. Vogelbein, H. Kator, C.A. Ottinger, Experimental mycobacteriosis in striped bass Morone saxatilis, Dis. Aquat. Organ 54 (2003) 105e117. [9] O.B. Reite, The rodlet cells of teleostean fish: their potential role in host defence in relation to the role of mast cells/eosinophilic granule cells, Fish. Shellfish Immunol. 19 (2005) 253e267. [10] A. White, T.C. Fletcher, M.B. Pepys, B.A. Baldo, The effect of inflammatory agents on C-reactive protein and serum amyloid P-component levels in plaice (Pleuronectes platessa L.) serum, Comp. Biochem. Physiol. C 69 (1981) 325e329. [11] A. White, J.I. MacArthur, T.C. Fletcher, Distribution of endotoxin and its effect on serum concentrations of C-reactive protein and cortisol in the plaice (Pleuronectes Platessa L.), Comp. Biochem. Physiol. C 79 (1984) 97e101. [12] T. Korytar, J. Jaros, M. Verleih, A. Rebl, G. Kotterba, C. Kuhn, et al., Novel insights into the peritoneal inflammation of rainbow trout (Oncorhynchus mykiss), Fish. Shellfish Immunol. 35 (2013) 1192e1199. [13] R. Castro, B. Abos, L. Gonzalez, A.G. Granja, C. Tafalla, Expansion and differentiation of IgMþ B cells in the rainbow trout peritoneal cavity in response to different antigens, Dev. Comp. Immunol. 70 (2017) 119e127. [14] C. Bossen, P.B.A.F.F. Schneider, APRIL and their receptors: structure, function and signaling, Semin. Immunol. 18 (2006) 263e275. [15] H.A. Kim, S.H. Jeon, G.Y. Seo, J.B. Park, P.H. Kim, TGF-beta1 and IFN-gamma stimulate mouse macrophages to express BAFF via different signaling pathways, J. Leukoc. Biol. 83 (2008) 1431e1439. [16] B. Nardelli, O. Belvedere, V. Roschke, P.A. Moore, H.S. Olsen, T.S. Migone, et al., Synthesis and release of B-lymphocyte stimulator from myeloid cells, Blood
217
97 (2001) 198e204. [17] P. Schneider, The role of APRIL and BAFF in lymphocyte activation, Curr. Opin. Immunol. 17 (2005) 282e289. [18] J.A. Gross, J. Johnston, S. Mudri, R. Enselman, S.R. Dillon, K. Madden, et al., TACI and BCMA are receptors for a TNF homologue implicated in B-cell autoimmune disease, Nature 404 (2000) 995e999. [19] J.S. Thompson, S.A. Bixler, F. Qian, K. Vora, M.L. Scott, T.G. Cachero, et al., BAFFR, a newly identified TNF receptor that specifically interacts with BAFF, Science 293 (2001) 2108e2111. [20] G.W. Glenney, G.D. Wiens, Early diversification of the TNF superfamily in teleosts: genomic characterization and expression analysis, J. Immunol. 178 (2007) 7955e7973. [21] A.G. Granja, J.W. Holland, J. Pignatelli, C.J. Secombes, C. Tafalla, Characterization of BAFF and APRIL subfamily receptors in rainbow trout (Oncorhynchus mykiss). Potential role of the BAFF/APRIL axis in the pathogenesis of proliferative kidney disease, PLoS One (2017), http://dx.doi.org/10.1371/ journal.pone.0174249. [22] C. Tafalla, L. Gonzalez, R. Castro, A.G. Granja, BAFF regulates different aspescts of B cell functionality and is produced by a subset of splenic B cells in teleost fish, Front. Immunol. (2017), http://dx.doi.org/10.3389/fimmu.2017.00295. [23] I.H. Zahl, O. Samuelsen, A. Kiessling, Anaesthesia of farmed fish: implications for welfare, Fish. Physiol. Biochem. 38 (2012) 201e218. [24] R. Castro, E. Bromage, B. Abos, J. Pignatelli, A. Gonzalez Granja, A. Luque, et al., CCR7 is mainly expressed in teleost gills, where it defines an IgDþIgM- B lymphocyte subset, J. Immunol. 192 (2014) 1257e1266. [25] D. DeLuca, M. Wilson, G.W. Warr, Lymphocyte heterogeneity in the trout, Salmo gairdneri, defined with monoclonal antibodies to IgM, Eur. J. Immunol. 13 (1983) 546e551. [26] F. Mackay, P.A. Silveira, R. Brink, B cells and the BAFF/APRIL axis: fast-forward on autoimmunity and signaling, Curr. Opin. Immunol. 19 (2007) 327e336. [27] S.A. Ha, M. Tsuji, K. Suzuki, B. Meek, N. Yasuda, T. Kaisho, et al., Regulation of B1 cell migration by signals through Toll-like receptors, J. Exp. Med. 203 (2006) 2541e2550. [28] H. Moon, J.G. Lee, S.H. Shin, T.J. Kim, LPS-induced migration of peritoneal B-1 cells is associated with upregulation of CXCR4 and increased migratory sensitivity to CXCL12, J. Korean Med. Sci. 27 (2012) 27e35. [29] F.B. Vincent, D. Saulep-Easton, W.A. Figgett, K.A. Fairfax, F. Mackay, The BAFF/ APRIL system: emerging functions beyond B cell biology and autoimmunity, Cytokine Growth Factor Rev. 24 (2013) 203e215. [30] V.T. Chu, P. Enghard, G. Riemekasten, C. Berek, In vitro and in vivo activation induces BAFF and APRIL expression in B cells, J. Immunol. 179 (2007) 5947e5957. [31] S. Das, Y. Sutoh, M. Hirano, Q. Han, J. Li, M.D. Cooper, et al., Characterization of lamprey BAFF-like gene: evolutionary implications, J. Immunol. 197 (2016) 2695e2703. [32] J.R. Darce, B.K. Arendt, X. Wu, D.F. Jelinek, Regulated expression of BAFFbinding receptors during human B cell differentiation, J. Immunol. 179 (2007) 7276e7286. [33] B.P. O'Connor, V.S. Raman, L.D. Erickson, W.J. Cook, L.K. Weaver, C. Ahonen, et al., BCMA is essential for the survival of long-lived bone marrow plasma cells, J. Exp. Med. 199 (2004) 91e98. [34] G.U. von Bulow, J.M. van Deursen, R.J. Bram, Regulation of the T-independent humoral response by TACI, Immunity 14 (2001) 573e582. [35] L.S. Treml, G. Carlesso, K.L. Hoek, J.E. Stadanlick, T. Kambayashi, R.J. Bram, et al., TLR stimulation modifies BLyS receptor expression in follicular and marginal zone B cells, J. Immunol. 178 (2007) 7531e7539. [36] S. Shulga-Morskaya, M. Dobles, M.E. Walsh, L.G. Ng, F. MacKay, S.P. Rao, et al., B cell-activating factor belonging to the TNF family acts through separate receptors to support B cell survival and T cell-independent antibody formation, J. Immunol. 173 (2004) 2331e2341.