- Email: [email protected]
The BcSDR1 gene is required for growth, development, and pathogenicity of Botrytis cinerea
Physiological and Molecular Plant Pathology 103 (2018) 122–129
Contents lists available at ScienceDirect
Physiological and Molecular Plant Pathology journal homepage: www.elsevier.com/locate/pmpp
The BcSDR1 gene is required for growth, development, and pathogenicity of Botrytis cinerea
T
Jinping Zanga,b,1, Xuemei Yuana,1, Fuxin Zhaoa,1, Kang Zhanga,b, Hongzhe Caoa, Jing Zhanga, Helong Sia,b, Jihong Xinga,b,∗, Jingao Donga,b,∗∗ a b
College of Life Sciences, Hebei Agricultural University, Baoding, 071001, China Key Laboratory of Hebei Province for Plant Physiology and Molecular Pathology, Baoding, 071001, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Botrytis cinerea BcSDR1 Growth Development Pathogenicity
The sclerotia-deficiency mutant BCt41 was found in the Agrobacterium tumefaciens-mediated transformation mutant library of Botrytis cinerea. The mutant gene of BCt41 was isolated and identified as BcSDR1, encoding a B. cinerea protein with unknown function. The BCt41 mutant had a significantly weakened pathogenicity compared to wild-type (WT) and BcSDR1-complementing mutant (BCt41/BcSDR1). Both phenotype and pathogenicity of BcSDR1-complementing mutant were similar to those of WT. The activity of cell wall degrading enzymes (CWDE) was significantly lower in the BCt41 mutant than in both WT and BCt41/BcSDR1. The toxin activity and acid production of the BCt41 mutant were also significantly reduced. However, appressoria of the BCt41 mutant appeared significantly different to that of WT and BCt41/BcSDR1. The BCt41 mutant sensitivity to NaCl, KCl, and Fluconazole were remarkably increased compared to WT and BCt41/BcSDR1. The expression levels of the key genes of the cAMP and MAPK signaling pathways were noticeably up-regulated in the BCt41 mutant. These results indicated that the BcSDR1 gene positively influences mycelia growth, sclerotia development, and pathogenicity, while it negatively regulates conidia formation of B. cinerea. The BcSDR1 gene is involved in the regulation of CWDEs, toxin, acid production, and the cAMP and MAPK signaling pathways.
1. Introduction Botrytis cinerea is a necrotrophic plant pathogen with the ability to infect more than 200 plants worldwide. Infection causes the gray mould disease, which results in the loss of important vegetables, ornamentals, and fruit crops such as tomatoes, beans, grape vines, or strawberries [1]. Mycelia of B. cinerea have a septum, the color of the sclerotia ranges from black to gray, the shape is irregular and hard, and the conidia is unicellular, colorless, spherical to oval, and these can be separate or branched [2,3]. Infection happens via attachment of conidia on the host surface and then, the conidia germinated and produced the germ tube, before penetration of the host plant. Once the conidia or sclerotia of B. cinerea have attached to the host surface, they can germinate and form both the germination tube and appressoria to penetrate the surface of host tissues under appropriate conditions. The first genomic sequencing of strains B05.10 and T4 were performed using Sanger technology. 10,427 protein-coding genes were found in strain B05.10, and 10,467 protein-coding genes were predicted in strain T4. It
∗
was found that 96.5% of the T4 genome and 97.3% of the B05.10 genome could be aligned and 88.6% of the predicted genes in strain T4 had a complete match in strain B05.10. The completion of B. cinerea genome sequences is helpful for us to understand the molecular and cellular pathogenesis of B. cinerea. B. cinerea produces a variety of pathogenic factors, i.e., cell wall degrading enzymes (CWDEs), toxins, and other low-molecular-weight compounds such as oxalic acid [4,5]. CWDEs (such as hemicelluloses, cutinase, pectin methylesterase, and endopolygalacturonase) have been reported to degrade plant cuticle and cell wall components. Mutation of the superoxide dismutase gene BcSOD1 as well as the endopolygalacturonase genes BcPG1 and BcPG2 resulted in severely reduced pathogenicity on several different hosts [6,7]. Nonspecific phytotoxins secreted by B. cinerea (including the sesquiterpene botrydial and the polyketide botcinic acid) have been reported to be involved in colonization, growth, and development inside plant tissues [8,9]. Oxalic acid may stimulate the production of various secreted enzymes, and may be a cofactor in pathogenesis [3].
Corresponding author. College of Life Sciences, Hebei Agricultural University, Baoding, 071001, China. Corresponding author. Key Laboratory of Hebei Province for Plant Physiology and Molecular Pathology, Baoding, 071001, China. E-mail addresses: [email protected] (J. Zang), [email protected] (J. Xing), [email protected] (J. Dong). 1 Equal contribution. ∗∗
https://doi.org/10.1016/j.pmpp.2018.05.009 Received 14 February 2018; Received in revised form 18 May 2018; Accepted 28 May 2018 Available online 01 June 2018 0885-5765/ © 2018 Published by Elsevier Ltd.
Physiological and Molecular Plant Pathology 103 (2018) 122–129
J. Zang et al.
Table 1 Primers used in this study. Gene name
Gene ID
Function
Primer name
Sequence (5′ - 3′)
Tubulin
5441652
Tubulin
bcg2
5433321
Ga subunit of G-proteins
bcg3
543895
Ga subunit of G-proteins
bac
5438818
Adenylate cyclase
Pka1
5431658
PKA catalytic subunit
Pka2
5427084
PKA catalytic subunit
PkaR
5431368
PKA regulatory subunit
RAS2
5437772
Small GTP-binding protein
bmp1
5428095
MAP kinase
Bcreg1
36394051
Transcriptional regulator
Tubulin-F Tubulin-R bcg2-F bcg2-R bcg3-F bcg3-R bac-F bac-R pka1-F pka1-R pka2-F pka2-R PkaR-F PkaR-R RAS2-F RAS2-R bmp1-F bmp1-R Bcreg1-F Bcreg1-R
ACATGCTCTGCCATTTTCCG TTGTTAGGGATCCACTCAACGAAG AAGTTTGGTTTCTCCGATTTCC CGGTATCGGTGGCGTTTG ATCCAGCGAACAAGGAATACG GGTGCCGAATCCATCAAATAG GTCTACGGTAAAGGAGGACGC CATCATCAAGCCCATTATCAGC TCAGAAGAGGACGATGAGGATG TTGCCACGAAGTTGAAACCA GGCCAAATTCTATGCTGCT CATCTGGGTGAATGTAGGGA CCGTATCACCAGGAACAGCA ATGTCCTAACCCATTTCCGTC AATCATCGTCCTCCTCCCC TTGACACCTCTCGTTCCGTG CTATCAAACCCTGCGAGCCT CTGGTCGCAACATATTCTGTCA GGAGTAAAGCGATGGACCGA AGAAGAGTAAACGCTGCCTCC
Fig. 1. Phenotypic analysis of WT, BCt41, and BCt41/BcSDR1 (CE). (a). Colony morphology of WT, BCt41, and BCt41/BcSDR1 (10 dpi) on PDA medium. (b). Mycelium morphology of WT, BCt41, and BCt41/BcSDR1 (10 dpi). (c). Detection of growth rates of WT, BCt41, and BCt41/BcSDR1. (d). Conidial production of WT, BCt41, and BCt41/BcSDR1 under optical microscopy. CE. BcSDR1-complementing mutant BCt41/BcSDR1; a and b indicate significant differences at the 0.05 probability level. 123
Physiological and Molecular Plant Pathology 103 (2018) 122–129
J. Zang et al.
medium.
Some components of signaling pathways, such as cAMP (cyclic adenosine monophosphate), MAPK (mitogen-activated protein kinase), and Ca2+/calcineurin-dependent signaling pathways, have been characterized and their effects on growth, development, and pathogenicity have already been reported [10,11]. The functions of the three different α subunits of heterotrimeric G proteins (BCG1, BCG2, and BCG3) in B. cinerea and their effects on growth and pathogenicity have also been identified [12,13]. The Ga subunit BCG1 is essential for pathogenicity of B. cinerea [18]. Knockout of bcg1 results in severely reduced pathogenicity on bean and tomato and failed to produce secondary spreading lesions and soft rots. In contrast, both Δbcg2 and Δbcg3 mutants had only slightly delayed host infection compared to the wild-type (WT). The adenylate cyclase (BAC) in B. cinerea is required for full pathogenicity [5]. Mutant Δbac did not produce conidia on leaves inoculated. But, conidia of Δbac could germinate, penetrate the host leaves and caused soft rot lesions, although these were slower to develop than that of WT. The cAMP protein kinase catalytic subunit gene pka1 and regulatory subunit gene pkaR impairs growth, colony morphology, and virulence in B. cinerea [11]. The small GTP-binding protein gene RAS2 influences germination of conidia and vegetative growth in B. cinerea [5]. Deletion mutants of the MAP kinase BMP1, BcSAK1, the MAP triple kinase Ste11, the MAP kinase kinase Ste7, and the MAP kinase adaptor protein Ste50 all resulted in non-pathogenic phenotype [14–16]. The Reg1 protein is required for pathogenicity, conidiogenesis, and the production of secondary metabolites in B. cinerea [21]. However, mutants that lacked the putative downstream transcription factor Ste12 only resulted in low penetration efficiency and delayed infection [15]. In addition, deletion of the calcineurin-responsive zinc finger transcription factor BcCRZ1, acting downstream of BCG1 and calcineurin, severely impaired growth, hyphal morphology, conidiation, sclerotium formation, and pathogenicity [11]. Until now, in B. cinerea, more than 100 genes have been reported to be involved in the production of secondary metabolites, conidial development, pathogenicity, and other aspects [4,17]. In this study, we obtained the mutant BCt41 that does not produce sclerotia by screening the T-DNA insertion mutant library of B. cinerea. The mutant gene of the mutant BCt41 was identified and named BcSDR1 (B. cinerea sclerotia deficient related; BC1G_02176). It encodes unknown proteins and has no conserved domains or homologous genes in B. cinerea and other organisms. To further identify the BcSDR1 gene function and its regulatory mechanisms, a gene complementation technique was used to construct a complementary recovery mutant of BcSDR1 named BCt41/BcSDR1. Via analyzing the phenotype and pathogenicity of both mutants BCt41 and BCt41/BcSDR1, we determined the effects of the gene on growth, development, and pathogenicity of B. cinerea. Cell wall degradation enzyme activity, toxin activity, acid production, appressoria formation, and penetrating ability, as well as expression levels of cAMP and MAPK signaling pathways key genes in WT, BCt41, and BCt41/BcSDR1 were obtained to analyze the regulatory mechanisms of the BcSDR1 gene. These results will aid the further understanding of the regulatory mechanisms of BcSDR1 for growth, development, and pathogenicity of B. cinerea.
2.2. Phenotypic assay The mycelia of WT, BCt41, and BCt41/BcSDR1 were incubated on PDA media and at 21 °C in the dark. The colony morphous, mycelia morphous, sclerotia formation, growth rate, and conidiation were observed and measured. To compare the microscopic morphology of hyphae, the hyphae of all strains were placed on glass slides with 10 μl of distilled water each. The slides were then covered with a coverslip and assessed under a microscope (Nikon Eclipse E−200). For growth assays, 6 mm mycelial blocks of all strains were incubated at the center of PDA plates. Colony diameters were measured every 24 h. For conidiation assays, 15-day-old conidia of all strains were collected with 5 mL of sterile water per PDA plate and counted under a microscope. 2.3. Pathogenicity assay Soybean leaves were washed thrice with sterilized water, that had been sterilized with 75% alcohol for 4 min, and washed twice or thrice with sterilized water for the infection assay. Infection assays of B. cinerea were performed as previously described [18]. 3-day-old culture blocks of WT, BCt41, and BCt41/BcSDR1 were inoculated on soybean leaves. Inoculated soybean leaves were moisturized at 22 °C in darkness and were observed daily. 2.4. Enzymatic activity analysis Mycelial blocks of WT, BCt41, and BCt41/BcSDR1 were independently cultured for 22 d in 100 mL of liquid pectin medium and cellulose medium under constant shaking at 22 °C in darkness. The cellulase (Cx), endopolygalacturonase (PG), pectin methylesterase (PMG), polygalacturonic acid transeliminase (PGTE), and pectin methyl transelimination enzyme (PMTE) of WT, BCt41, and BCt41/BcSDR1 were extracted and purified from the filtrates, and their enzymatic activity was determined based on methods described by Berto et al. and Soulie et al. [19,20]. 2.5. Toxin activity analysis Mycelial blocks of WT, BCt41, and BCt41/BcSDR1 were cultured for 22 d in Fries III medium under constant shaking at 22 °C. Then, the culture filtrate was extracted with ethyl acetate for 24 h at room temperature and evaporated under reduced pressure at 50 °C to remove the solvent. The final ethyl acetate extract was dissolved in 1 mL methanol and used to determine biological activity. Soybean leaves were acupunctured and used to determine the biological activity of the toxin. Soybean leaves inoculated with crude toxin were placed in moisturizing cylinder at 22 °C and observed daily. Furthermore, methanol was used as control. 2.6. Acid production assay
2. Materials and methods
Mycelial blocks of WT, BCt41, and BCt41/BcSDR1 were inoculated on PDA media supplemented with 0.05% (w/v) bromothymol blue and incubated in complete darkness at 22 °C for 7 d. The resulting color of media was observed. Bromothymol blue is a pH indicator for weak acids and bases. The color of media became yellow, suggesting that the pH of media declined and that strains secreted acid. For pH detection, mycelial blocks of WT, BCt41, and BCt41/BcSDR1 were inoculated in 100 mL of PD media each and cultured for 7 d in darkness at 22 °C.
2.1. B. cinerea strains and growth conditions The B. cinerea WT strain BC22 was isolated by the Mycotoxin and Molecular Plant Pathology Laboratory of the Hebei Agriculture University in China and was used for all experiments. The mutant BCt41 was obtained from a T-DNA insertion mutant library of the WT strain BC22. B. cinerea strains were grown on potato dextrose agar (PDA) at 22 °C. For conidia, the strains were incubated in complete darkness for one week at 22 °C. For sclerotial formation, the strains were incubated for four weeks at 21 °C in darkness. For DNA and RNA mini-preparation, mycelia were grown for 5 d–7 d at 22 °C in potato dextrose (PD)
2.7. Assays of penetration ability and appressoria formation To detect the penetration ability, mycelial blocks of WT, BCt41, and BCt41/BcSDR1 were inoculated onto cellophane, which was spread on 124
Physiological and Molecular Plant Pathology 103 (2018) 122–129
J. Zang et al.
3. Results 3.1. BcSDR1 positively regulates mycelia growth and sclerotia development, but negatively regulates conidia formation This study investigated colony morphology, mycelium morphology, growth rate, and conidial yield of WT, BCt41, and BCt41/BcSDR1. The WT and BCt41/BcSDR1 colonies were gray brown, and produced large amounts of sclerotia. The BCt41 colonies always remained gray and did not produce sclerotia (Fig. 1A). Under optical microscopy, the BCt41 mycelia were gray, slender, and had longer transverse septa compared to the WT and BCt41/BcSDR1 (Fig. 1B). The growth rate of the mutant BCt41 was slightly lower than that of the WT and BCt41/BcSDR1 (Fig. 1C). Conidiation of the mutant BCt41 was significantly higher than that of WT and BCt41/BcSDR1 (Fig. 1D). These results indicated that BcSDR1 positively influences mycelia growth and sclerotia development, while it negatively influence conidia formation of B. cinerea. Fig. 2. Pathogenicity analyses of WT, BCt41, and BCt41/BcSDR1 mutants. (a). Pathogenicity analyses of mutants on kidney bean leaves. (b). Lesion areas were estimated. CE. Mutant BCt41/BcSDR1; a, b, and c indicate significant differences at the 0.05 probability level.
3.2. BcSDR1 played a positive role in the pathogenicity of B. cinerea Culture blocks of WT, BCt41, and BCt41/BcSDR1 were inoculated onto detached soybean leaves. At 4 dpi, lesions appeared on soybean leaves inoculated with WT, BCt41, and BCt41/BcSDR1 (Fig. 2A). Compared to the WT and BCt41/BcSDR1, lesion areas of the BCt41 mutant on soybean leaves were dramatically reduced (Fig. 2B). These results indicate that BcSDR1 positively associates with the pathogenicity of B. cinerea.
PDA medium and incubated for 48 h at 22 °C. Then, the cellophane and mycelial blocks were removed, and the plates continued to incubate at 22 °C to observe colony formation. The removed onion epidermis was stained with trypan blue. Mycelium suspension of WT, BCt41, and BCt41/BcSDR1 were prepared and inoculated onto cellophane and onion epidermis, covered on agar medium and incubated at 22 °C in the dark; the penetration of strains were observed every 12 h. After 72 h, the back of the onion epidermis was stained with trypan blue to assess mycelium penetration and appressoria formation under the microscope.
3.3. BcSDR1 positively influences the activities of CWDEs, toxins, and acid production To investigate the mechanism underlying the reduced pathogenicity of BCt41, we examined the activities of several CWDEs, toxins, and acid production in the WT, BCt41, and BCt41/BcSDR1. The activities of PMTE, PGTE, CX, PMG, and PG were significantly reduced in the mutant BCt41 compared to WT and BCt41/BcSDR1 (Fig. 3A). The crude toxins of WT, BCt41, and BCt41/BcSDR1 were extracted and inoculated onto punctured soybean leaves to analyze the biological activity of toxins. At 4 dpi, lesions appeared on inoculated soybean leaves, and the lesion areas of BCt41 were significantly smaller than those of both WT and BCt41/BcSDR1 (Fig. 3B). Bromothymol blue was added to the PDA medium to measure the acid production ability of WT, BCt41, and BCt41/BcSDR1. The media of WT and BCt41/BcSDR1 yellowed, while the color of BCt41 media showed no obvious change (Fig. 3C). The pH values of WT, BCt41, and BCt41/BcSDR1 media at 7 d post-inoculation were 5.22, 6.47, and 5.80, respectively (Fig. 3C). These results indicated that BcSDR1 positively influences the activities of CWDEs, toxins, and acid production in B. cinerea.
2.8. Assessment of mutant cell wall integrity NaCl, KCl, Fluconazole, and CFW were used to assess cell wall integrity. Optimal concentrations of 0.8 mol/L, 0.8 mol/L, 5 μg/mL, and 100 μg/mL were used for NaCl, KCl, Fluconazole, and CFW, respectively.
2.9. Quantitative real-time PCR analysis Quantitative real-time PCR was used to measure the transcript levels of BcSDR1 and pathogenicity-related genes, using ABI SYBR Green PCR Master Mix (Applied Biosystems, USA). Pathogenicity-related genes included the G protein alpha subunit genes bcg2 and bcg3 [13], the adenylate cyclase gene bac [2], the PKA catalytic subunit genes pka1 and pka2 [11], the PKA regulatory subunit gene pkaR [11], the small GTP-binding protein gene RAS2 [5], the MAP kinase gene bmp1 [14], the MAP kinases BcSak1 and Bmp3, and the downstream target gene Bcreg1 [21]. The total RNA of each strain was isolated via Total RNA preparation kit (Omega). Samples of total RNA were digested with DNase I (Promega) to remove genomic DNAs. The cDNAs were synthesized with a revert aid first-strand cDNA synthesis kit (Invitrogen) according to the manufacturer's instructions. Quantitative real-time PCR was performed in triplicates at three independent times using SYBR green PCR master mix. Tubulin was used to achieve equal loading. Primers used in this study were listed in Table 1. The relative expression levels were calculated using the 2(–ΔCt) analysis method.
3.4. BcSDR1 regulates appressoria development and does not affect penetration ability The penetration ability and appressoria formation were assessed on cellophane and onion epidermis. It was found that WT, BCt41, and BCt41/BcSDR1 can penetrate cellophane and form colonies on the PDA medium (Fig. 4A). The mycelia of BCt41 appeared no rule curl and produced large amounts of appressoria compared to WT and BCt41/ BcSDR1 (Fig. 4B). The size of appressoria of BCt41 is bigger than that of WT and BCt41/BcSDR1 (Fig. 4C). These results indicated that BcSDR1 might influence appressoria development and does not affect penetration. 3.5. BcSDR1 affects hyphal cell walls When BC22, BCt41, and BCt41/BcSDR1 strains were inoculated onto PDA medium with 0.8 mol/L NaCl, 0.8 mol/L KCl, 5 μg/mL 125
Physiological and Molecular Plant Pathology 103 (2018) 122–129
J. Zang et al.
Fig. 3. Analysis of CWDEs activities, toxins activities, and acid producing ability of WT, BCt41, and BCt41/BcSDR1 mutants. (a). CWDE activity of WT, BCt41, and BCt41/BcSDR1 mutants; Cx: cellulose; PG: polygalactuconase; PMG: pectin methylgalactuionase; PGTE: polygalacturonic acid transeliminase; PMTE: pectin methyl transelimination enzyme. Mean values were tested in triplicate, standard errors are indicated. (b). Toxin activity of WT, BCt41, and BCt41/BcSDR1 mutants on wounded bean leaf; Bean leaf was wounded with a needle prior to the inoculation with 50 μL crude toxin methanol solution of the different strains. Furthermore, methanol was used as contrast. Photographs were taken 48 hpi. (c). Acid producing ability of WT, BCt41, and BCt41/ BcSDR1 mutants; Acid production assays was performed on PDA medium with bromothymol blue and the pH of the PD liquid medium inoculated with the BC22, BCt41, and BCt41/BcSDR1 was measured. a, b, c, and d indicate significant differences at the 0.05 probability level.
Fluconazole, and 100 μg/mL CFW (Fig. 5A), the BCt41 mutant sensitivity to NaCl, KCl, and Fluconazole were remarkably increased compared to that of the WT and BCt41/BcSDR1 during the assessment of the colony growth rate. The results indicated that BcSDR1 gene deletion reduced the resistance to osmotic stress in B. cinerea and the cellular integrity was reduced in the BCt41 mutant, suggesting that the BcSDR1 gene was involved in the resistance to osmotic stress and cell wall integrity in B. cinerea. Furthermore, the growth rate showed in the same way (Fig. 5B).
3.6. BcSDR1 gene deficiency alters the expression of cAMP and MAPK signaling pathway key genes To investigate the molecular mechanism of BcSDR1 for the regulation of the pathogenicity of B. cinerea, we used quantitative real-time PCR to examine the expression levels of cAMP and MAPK signaling pathways key genes. Significant up-regulation in the mutant BCt41 was observed for bcg2, bcg3, bac, pka1, pka2, pkaR, RAS2, Bmp1, and Bcreg1 (Fig. 6). These results indicate that BcSDR1 negatively associates with key genes of the cAMP and MAPK signaling pathways.
126
Physiological and Molecular Plant Pathology 103 (2018) 122–129
J. Zang et al.
Fig. 4. Penetrability assays and appressoria formation of WT, BCt41, and BCt41/BcSDR1 mutants. (a). The growth status of each strain was observed. WT, BCt41, and BCt41/BcSDR1 can penetrate the cellophane and form colonies on the PDA medium, respectively. (b). Mycelia morphology on cellophane. The mycelia of the BCt41 appeared no rule curl compared to WT and BCt41/BcSDR1. (c). Morphology of mycelia and appressoria on onion epidermis. Trypan blue staining shows that all strains penetrated and invaded the epidermis. However, the appressoria of the BCt41 appeared significant difference compared to WT and BCt41/BcSDR1. Arrows indicates appressoria.
Fig. 5. BcSDR1 loss leads to reduced resistance to cell wall stress. (a). The BC22, BCt41, and BCt41/BcSDR1 strains were cultured on PDA media with 0.8 mol/L NaCl, 0.8 mol/L KCl, 5 μg/mL Fluconazole, and 100 μg/mL CFW. All strains were cultured for 7 d at 25 °C in the dark. (b). The growth rate of these three strains cultured on different media. PDA was used as control.
127
Physiological and Molecular Plant Pathology 103 (2018) 122–129
J. Zang et al.
Fig. 6. Expression levels of cAMP and MAPK signaling pathway key genes in WT, BCt41, and BCt41/BcSDR1 mutants. RNA was isolated from 5-day-old mycelial samples grown on PDA medium, using Tubulin as loading control.
4. Discussion
cinerea. Previous studies have indicated that cAMP and MAPK signaling pathways are essential factors that regulate growth, development, and pathogenicity in B. cinerea [4,10,11]. Therefore, we sought to identify the BcSDR1-mediated pathway via examination of the expression levels of cAMP and MAPK signaling pathway key genes in WT, BCt41, and BCt41/BcSDR1 strains. We found that the loss-of-function of BcSDR1 up-regulated the expressions of bcg2, bcg3, bac, pka1, pka2, pkaR, RAS2, Bmp1, and Bcreg1. These results suggest that BcSDR1 negatively influence the expression level of key genes of the cAMP and MAPK signaling pathways. Our study results provide a solid foundation for further examining the regulatory mechanisms of BcSDR1 in the growth, development, and pathogenicity of B. cinerea.
B. cinerea is a typical necrotrophic pathogenic fungus that causes severe diseases and significant economic losses in a wide range of plant species. Cloning of genes related to its growth, development, and pathogenicity is fundamental for successful pathogen control. In this study, the BcSDR1 gene was isolated based on a T-DNA insertion mutant that showed a sclerotia deficient phenotype. The homologous gene of the BcSDR1 gene was less frequent in B. cinerea and other organisms based on bioinformatics analysis, suggesting that the BcSDR1 gene may be unique to the B. cinerea genome. To validate the function of the BcSDR1 gene, phenotype and pathogenicity of the T-DNA insertion mutant of BcSDR1 gene (BCt41), WT strain BC22, and BcSDR1-complementing mutant (BCt41/BcSDR1) were analyzed in this study. The phenotype and pathogenicity of BCt41/BcSDR1 were similar to those of WT. Compared to the WT and BCt41/BcSDR1 strains, the BCt41 mutant grew slowly, did not produce sclerotia, produce more conidia, and pathogenicity significantly weakened. These results verified that the BcSDR1 gene positively associates with mycelia growth, sclerotia development, and pathogenicity, while it negatively regulates conidia formation of B. cinerea. B. cinerea produce various pathogenic factors, such as cell wall degrading enzymes (CWDE), toxins, and acidic substances, which change the signaling of host cells and induce host necrosis. The pathogenicity of the BCt41 mutant was significantly reduced in this study. To determine the mechanism underlying this reduced pathogenicity of mutants BCt41, we examined the activity of CWDEs, toxin, and the ability of acid production in WT, BCt41, and BCt41/BcSDR1 strains. The activity of several important CWDEs (PMTE, PGTE, CX, PMG, and PG) and toxin was significantly lower in the BCt41 mutant. Furthermore, the ability for acid production was lower in the BCt41 mutant. These results indicated that the function of BcSDR1 in the pathogenicity may be involved in the regulation of CWDEs, toxin, and acid production in B.
Acknowledgments This study was supported by the Natural Science Foundation of Hebei Province (No. C2018204045), the Higher Education Research Fund of Hebei (No.ZD2016001), and the Scientific Research Foundation for Returned Chinese Scholars of Hebei (No.0316012). References [1] E.Y. Abdelghani, K. Bala, B. Paul, Characterisation of Pythium paroecandrum and its antagonism towards Botrytis cinerea, the causative agent of grey mould disease of grape, FEMS Microbiol. Lett. 230 (2004) 177–183. [2] R.H. Cichewicz, S.A. Kouzi, M.T. Hamann, Dimerization of resveratrol by the grapevine pathogen Botrytis cinerea, J. Nat. Prod. 63 (2000) 29–33. [3] B. Williamson, B. Tudzynski, P. Tudzynski, J.A. van Kan, Botrytis cinerea: the cause of grey mould disease, Mol. Plant Pathol. 8 (2007) 561–580. [4] M. Choquer, E. Fournier, C. Kunz, C. Levis, J.M. Pradier, A. Simon, et al., Botrytis cinerea virulence factors: new insights into a necrotrophic and polyphageous pathogen, FEMS Microbiol. Lett. 277 (2007) 1–10. [5] A. Klimpel, C.S. Gronover, B. Williamson, J.A. Stewart, B. Tudzynski, The adenylate cyclase (BAC) in Botrytis cinerea is required for full pathogenicity, Mol. Plant Pathol. 3 (2002) 439–450.
128
Physiological and Molecular Plant Pathology 103 (2018) 122–129
J. Zang et al.
[6] R.M. Patel, J.A. van Kan, A.M. Bailey, G.D. Foster, RNA-mediated gene silencing of superoxide dismutase (bcsod1) in Botrytis cinerea, Phytopathology 98 (2008) 1334–1339. [7] R.W.S. Weber, Resistance of Botrytis cinerea to multiple fungicides in Northern German small-fruit production, Plant Dis. 95 (2011) 1263–1269. [8] C. Pinedo, C.M. Wang, J.M. Pradier, B. Dalmais, M. Choquer, P. Le Pecheur, et al., Sesquiterpene synthase from the botrydial biosynthetic gene cluster of the phytopathogen Botrytis cinerea, ACS Chem. Biol. 3 (2008) 791–801. [9] F.R. Rossi, A. Garriz, M. Marina, F.M. Romero, M.E. Gonzalez, I.G. Collado, et al., The sesquiterpene botrydial produced by Botrytis cinerea induces the hypersensitive response on plant tissues and its action is modulated by salicylic acid and jasmonic acid signaling, Mol. Plant Microbe Interact. 24 (2011) 888–896. [10] G. Doehlemann, P. Berndt, M. Hahn, Different signalling pathways involving a Galpha protein, cAMP and a MAP kinase control germination of Botrytis cinerea conidia, Mol. Microbiol. 59 (2006) 821–835. [11] J. Schumacher, L. Kokkelink, C. Huesmann, D. Jimenez-Teja, I.G. Collado, R. Barakat, et al., The cAMP-dependent signaling pathway and its role in conidial germination, growth, and virulence of the gray mold Botrytis cinerea, Mol. Plant Microbe Interact. 21 (2008) 1443–1459. [12] C.S. Gronover, C. Schorn, B. Tudzynski, Identification of Botrytis cinerea genes upregulated during infection and controlled by the Galpha subunit BCG1 using suppression subtractive hybridization (SSH), Mol. Plant Microbe Interact. 17 (2004) 537–546. [13] C.S. Gronover, D. Kasulke, P. Tudzynski, B. Tudzynski, The role of G protein alpha subunits in the infection process of the gray mold fungus Botrytis cinerea, Mol. Plant Microbe Interact. 14 (2001) 1293–1302. [14] J. Heller, N. Ruhnke, J.J. Espino, M. Massaroli, I.G. Collado, P. Tudzynski, The
[15]
[16]
[17] [18]
[19]
[20]
[21]
129
mitogen-activated protein kinase BcSak1 of Botrytis cinerea is required for pathogenic development and has broad regulatory functions beyond stress response, Mol. Plant Microbe Interact. 25 (2012) 802–816. A. Schamber, M. Leroch, J. Diwo, K. Mendgen, M. Hahn, The role of mitogen-activated protein (MAP) kinase signalling components and the Ste12 transcription factor in germination and pathogenicity of Botrytis cinerea, Mol. Plant Pathol. 11 (2010) 105–119. L. Zheng, M. Campbell, J. Murphy, S. Lam, J.R. Xu, The BMP1 gene is essential for pathogenicity in the gray mold fungus Botrytis cinerea, Mol. Plant Microbe Interact. 13 (2000) 724–732. J.J. Espino, G. Gutierrez-Sanchez, N. Brito, P. Shah, R. Orlando, C. Gonzalez, The Botrytis cinerea early secretome, Proteomics 10 (2010) 3020–3034. J. Schumacher, M. Viaud, A. Simon, B. Tudzynski, The G subunit BCG1, the phospholipase C (BcPLC1) and the calcineurin phosphatase co-ordinately regulate gene expression in the grey mould fungus Botrytis cinerea, Mol. Microbiol. 67 (5) (2008) 1027–1050. M.C. Soulie, A. Piffeteau, M. Choquer, M. Boccara, A. Vidal-Cros, Disruption of Botrytis cinerea class I chitin synthase gene Bcchs1 results in cell wall weakening and reduced virulence, Fungal Genet. Biol. 40 (2003) 38–46. P. Berto, M.H. Jijakli, P. Lepoivre, Possible role of colonization and cell wall-degrading enzymes in the differential ability of three Ulocladium atrum strains to control Botrytis cinerea on necrotic strawberry leaves, Phytopathology 91 (2001) 1030–1036. C.B. Michielse, M. Becker, J. Heller, J. Moraga, I.G. Collado, P. Tudzynski, The Botrytis cinerea Reg1 protein, a putative transcriptional regulator, is required for pathogenicity, conidiogenesis, and the production of secondary metabolites, Mol. Plant Microbe Interact. 24 (2011) 1074–1085.
Contents lists available at ScienceDirect
Physiological and Molecular Plant Pathology journal homepage: www.elsevier.com/locate/pmpp
The BcSDR1 gene is required for growth, development, and pathogenicity of Botrytis cinerea
T
Jinping Zanga,b,1, Xuemei Yuana,1, Fuxin Zhaoa,1, Kang Zhanga,b, Hongzhe Caoa, Jing Zhanga, Helong Sia,b, Jihong Xinga,b,∗, Jingao Donga,b,∗∗ a b
College of Life Sciences, Hebei Agricultural University, Baoding, 071001, China Key Laboratory of Hebei Province for Plant Physiology and Molecular Pathology, Baoding, 071001, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Botrytis cinerea BcSDR1 Growth Development Pathogenicity
The sclerotia-deficiency mutant BCt41 was found in the Agrobacterium tumefaciens-mediated transformation mutant library of Botrytis cinerea. The mutant gene of BCt41 was isolated and identified as BcSDR1, encoding a B. cinerea protein with unknown function. The BCt41 mutant had a significantly weakened pathogenicity compared to wild-type (WT) and BcSDR1-complementing mutant (BCt41/BcSDR1). Both phenotype and pathogenicity of BcSDR1-complementing mutant were similar to those of WT. The activity of cell wall degrading enzymes (CWDE) was significantly lower in the BCt41 mutant than in both WT and BCt41/BcSDR1. The toxin activity and acid production of the BCt41 mutant were also significantly reduced. However, appressoria of the BCt41 mutant appeared significantly different to that of WT and BCt41/BcSDR1. The BCt41 mutant sensitivity to NaCl, KCl, and Fluconazole were remarkably increased compared to WT and BCt41/BcSDR1. The expression levels of the key genes of the cAMP and MAPK signaling pathways were noticeably up-regulated in the BCt41 mutant. These results indicated that the BcSDR1 gene positively influences mycelia growth, sclerotia development, and pathogenicity, while it negatively regulates conidia formation of B. cinerea. The BcSDR1 gene is involved in the regulation of CWDEs, toxin, acid production, and the cAMP and MAPK signaling pathways.
1. Introduction Botrytis cinerea is a necrotrophic plant pathogen with the ability to infect more than 200 plants worldwide. Infection causes the gray mould disease, which results in the loss of important vegetables, ornamentals, and fruit crops such as tomatoes, beans, grape vines, or strawberries [1]. Mycelia of B. cinerea have a septum, the color of the sclerotia ranges from black to gray, the shape is irregular and hard, and the conidia is unicellular, colorless, spherical to oval, and these can be separate or branched [2,3]. Infection happens via attachment of conidia on the host surface and then, the conidia germinated and produced the germ tube, before penetration of the host plant. Once the conidia or sclerotia of B. cinerea have attached to the host surface, they can germinate and form both the germination tube and appressoria to penetrate the surface of host tissues under appropriate conditions. The first genomic sequencing of strains B05.10 and T4 were performed using Sanger technology. 10,427 protein-coding genes were found in strain B05.10, and 10,467 protein-coding genes were predicted in strain T4. It
∗
was found that 96.5% of the T4 genome and 97.3% of the B05.10 genome could be aligned and 88.6% of the predicted genes in strain T4 had a complete match in strain B05.10. The completion of B. cinerea genome sequences is helpful for us to understand the molecular and cellular pathogenesis of B. cinerea. B. cinerea produces a variety of pathogenic factors, i.e., cell wall degrading enzymes (CWDEs), toxins, and other low-molecular-weight compounds such as oxalic acid [4,5]. CWDEs (such as hemicelluloses, cutinase, pectin methylesterase, and endopolygalacturonase) have been reported to degrade plant cuticle and cell wall components. Mutation of the superoxide dismutase gene BcSOD1 as well as the endopolygalacturonase genes BcPG1 and BcPG2 resulted in severely reduced pathogenicity on several different hosts [6,7]. Nonspecific phytotoxins secreted by B. cinerea (including the sesquiterpene botrydial and the polyketide botcinic acid) have been reported to be involved in colonization, growth, and development inside plant tissues [8,9]. Oxalic acid may stimulate the production of various secreted enzymes, and may be a cofactor in pathogenesis [3].
Corresponding author. College of Life Sciences, Hebei Agricultural University, Baoding, 071001, China. Corresponding author. Key Laboratory of Hebei Province for Plant Physiology and Molecular Pathology, Baoding, 071001, China. E-mail addresses: [email protected] (J. Zang), [email protected] (J. Xing), [email protected] (J. Dong). 1 Equal contribution. ∗∗
https://doi.org/10.1016/j.pmpp.2018.05.009 Received 14 February 2018; Received in revised form 18 May 2018; Accepted 28 May 2018 Available online 01 June 2018 0885-5765/ © 2018 Published by Elsevier Ltd.
Physiological and Molecular Plant Pathology 103 (2018) 122–129
J. Zang et al.
Table 1 Primers used in this study. Gene name
Gene ID
Function
Primer name
Sequence (5′ - 3′)
Tubulin
5441652
Tubulin
bcg2
5433321
Ga subunit of G-proteins
bcg3
543895
Ga subunit of G-proteins
bac
5438818
Adenylate cyclase
Pka1
5431658
PKA catalytic subunit
Pka2
5427084
PKA catalytic subunit
PkaR
5431368
PKA regulatory subunit
RAS2
5437772
Small GTP-binding protein
bmp1
5428095
MAP kinase
Bcreg1
36394051
Transcriptional regulator
Tubulin-F Tubulin-R bcg2-F bcg2-R bcg3-F bcg3-R bac-F bac-R pka1-F pka1-R pka2-F pka2-R PkaR-F PkaR-R RAS2-F RAS2-R bmp1-F bmp1-R Bcreg1-F Bcreg1-R
ACATGCTCTGCCATTTTCCG TTGTTAGGGATCCACTCAACGAAG AAGTTTGGTTTCTCCGATTTCC CGGTATCGGTGGCGTTTG ATCCAGCGAACAAGGAATACG GGTGCCGAATCCATCAAATAG GTCTACGGTAAAGGAGGACGC CATCATCAAGCCCATTATCAGC TCAGAAGAGGACGATGAGGATG TTGCCACGAAGTTGAAACCA GGCCAAATTCTATGCTGCT CATCTGGGTGAATGTAGGGA CCGTATCACCAGGAACAGCA ATGTCCTAACCCATTTCCGTC AATCATCGTCCTCCTCCCC TTGACACCTCTCGTTCCGTG CTATCAAACCCTGCGAGCCT CTGGTCGCAACATATTCTGTCA GGAGTAAAGCGATGGACCGA AGAAGAGTAAACGCTGCCTCC
Fig. 1. Phenotypic analysis of WT, BCt41, and BCt41/BcSDR1 (CE). (a). Colony morphology of WT, BCt41, and BCt41/BcSDR1 (10 dpi) on PDA medium. (b). Mycelium morphology of WT, BCt41, and BCt41/BcSDR1 (10 dpi). (c). Detection of growth rates of WT, BCt41, and BCt41/BcSDR1. (d). Conidial production of WT, BCt41, and BCt41/BcSDR1 under optical microscopy. CE. BcSDR1-complementing mutant BCt41/BcSDR1; a and b indicate significant differences at the 0.05 probability level. 123
Physiological and Molecular Plant Pathology 103 (2018) 122–129
J. Zang et al.
medium.
Some components of signaling pathways, such as cAMP (cyclic adenosine monophosphate), MAPK (mitogen-activated protein kinase), and Ca2+/calcineurin-dependent signaling pathways, have been characterized and their effects on growth, development, and pathogenicity have already been reported [10,11]. The functions of the three different α subunits of heterotrimeric G proteins (BCG1, BCG2, and BCG3) in B. cinerea and their effects on growth and pathogenicity have also been identified [12,13]. The Ga subunit BCG1 is essential for pathogenicity of B. cinerea [18]. Knockout of bcg1 results in severely reduced pathogenicity on bean and tomato and failed to produce secondary spreading lesions and soft rots. In contrast, both Δbcg2 and Δbcg3 mutants had only slightly delayed host infection compared to the wild-type (WT). The adenylate cyclase (BAC) in B. cinerea is required for full pathogenicity [5]. Mutant Δbac did not produce conidia on leaves inoculated. But, conidia of Δbac could germinate, penetrate the host leaves and caused soft rot lesions, although these were slower to develop than that of WT. The cAMP protein kinase catalytic subunit gene pka1 and regulatory subunit gene pkaR impairs growth, colony morphology, and virulence in B. cinerea [11]. The small GTP-binding protein gene RAS2 influences germination of conidia and vegetative growth in B. cinerea [5]. Deletion mutants of the MAP kinase BMP1, BcSAK1, the MAP triple kinase Ste11, the MAP kinase kinase Ste7, and the MAP kinase adaptor protein Ste50 all resulted in non-pathogenic phenotype [14–16]. The Reg1 protein is required for pathogenicity, conidiogenesis, and the production of secondary metabolites in B. cinerea [21]. However, mutants that lacked the putative downstream transcription factor Ste12 only resulted in low penetration efficiency and delayed infection [15]. In addition, deletion of the calcineurin-responsive zinc finger transcription factor BcCRZ1, acting downstream of BCG1 and calcineurin, severely impaired growth, hyphal morphology, conidiation, sclerotium formation, and pathogenicity [11]. Until now, in B. cinerea, more than 100 genes have been reported to be involved in the production of secondary metabolites, conidial development, pathogenicity, and other aspects [4,17]. In this study, we obtained the mutant BCt41 that does not produce sclerotia by screening the T-DNA insertion mutant library of B. cinerea. The mutant gene of the mutant BCt41 was identified and named BcSDR1 (B. cinerea sclerotia deficient related; BC1G_02176). It encodes unknown proteins and has no conserved domains or homologous genes in B. cinerea and other organisms. To further identify the BcSDR1 gene function and its regulatory mechanisms, a gene complementation technique was used to construct a complementary recovery mutant of BcSDR1 named BCt41/BcSDR1. Via analyzing the phenotype and pathogenicity of both mutants BCt41 and BCt41/BcSDR1, we determined the effects of the gene on growth, development, and pathogenicity of B. cinerea. Cell wall degradation enzyme activity, toxin activity, acid production, appressoria formation, and penetrating ability, as well as expression levels of cAMP and MAPK signaling pathways key genes in WT, BCt41, and BCt41/BcSDR1 were obtained to analyze the regulatory mechanisms of the BcSDR1 gene. These results will aid the further understanding of the regulatory mechanisms of BcSDR1 for growth, development, and pathogenicity of B. cinerea.
2.2. Phenotypic assay The mycelia of WT, BCt41, and BCt41/BcSDR1 were incubated on PDA media and at 21 °C in the dark. The colony morphous, mycelia morphous, sclerotia formation, growth rate, and conidiation were observed and measured. To compare the microscopic morphology of hyphae, the hyphae of all strains were placed on glass slides with 10 μl of distilled water each. The slides were then covered with a coverslip and assessed under a microscope (Nikon Eclipse E−200). For growth assays, 6 mm mycelial blocks of all strains were incubated at the center of PDA plates. Colony diameters were measured every 24 h. For conidiation assays, 15-day-old conidia of all strains were collected with 5 mL of sterile water per PDA plate and counted under a microscope. 2.3. Pathogenicity assay Soybean leaves were washed thrice with sterilized water, that had been sterilized with 75% alcohol for 4 min, and washed twice or thrice with sterilized water for the infection assay. Infection assays of B. cinerea were performed as previously described [18]. 3-day-old culture blocks of WT, BCt41, and BCt41/BcSDR1 were inoculated on soybean leaves. Inoculated soybean leaves were moisturized at 22 °C in darkness and were observed daily. 2.4. Enzymatic activity analysis Mycelial blocks of WT, BCt41, and BCt41/BcSDR1 were independently cultured for 22 d in 100 mL of liquid pectin medium and cellulose medium under constant shaking at 22 °C in darkness. The cellulase (Cx), endopolygalacturonase (PG), pectin methylesterase (PMG), polygalacturonic acid transeliminase (PGTE), and pectin methyl transelimination enzyme (PMTE) of WT, BCt41, and BCt41/BcSDR1 were extracted and purified from the filtrates, and their enzymatic activity was determined based on methods described by Berto et al. and Soulie et al. [19,20]. 2.5. Toxin activity analysis Mycelial blocks of WT, BCt41, and BCt41/BcSDR1 were cultured for 22 d in Fries III medium under constant shaking at 22 °C. Then, the culture filtrate was extracted with ethyl acetate for 24 h at room temperature and evaporated under reduced pressure at 50 °C to remove the solvent. The final ethyl acetate extract was dissolved in 1 mL methanol and used to determine biological activity. Soybean leaves were acupunctured and used to determine the biological activity of the toxin. Soybean leaves inoculated with crude toxin were placed in moisturizing cylinder at 22 °C and observed daily. Furthermore, methanol was used as control. 2.6. Acid production assay
2. Materials and methods
Mycelial blocks of WT, BCt41, and BCt41/BcSDR1 were inoculated on PDA media supplemented with 0.05% (w/v) bromothymol blue and incubated in complete darkness at 22 °C for 7 d. The resulting color of media was observed. Bromothymol blue is a pH indicator for weak acids and bases. The color of media became yellow, suggesting that the pH of media declined and that strains secreted acid. For pH detection, mycelial blocks of WT, BCt41, and BCt41/BcSDR1 were inoculated in 100 mL of PD media each and cultured for 7 d in darkness at 22 °C.
2.1. B. cinerea strains and growth conditions The B. cinerea WT strain BC22 was isolated by the Mycotoxin and Molecular Plant Pathology Laboratory of the Hebei Agriculture University in China and was used for all experiments. The mutant BCt41 was obtained from a T-DNA insertion mutant library of the WT strain BC22. B. cinerea strains were grown on potato dextrose agar (PDA) at 22 °C. For conidia, the strains were incubated in complete darkness for one week at 22 °C. For sclerotial formation, the strains were incubated for four weeks at 21 °C in darkness. For DNA and RNA mini-preparation, mycelia were grown for 5 d–7 d at 22 °C in potato dextrose (PD)
2.7. Assays of penetration ability and appressoria formation To detect the penetration ability, mycelial blocks of WT, BCt41, and BCt41/BcSDR1 were inoculated onto cellophane, which was spread on 124
Physiological and Molecular Plant Pathology 103 (2018) 122–129
J. Zang et al.
3. Results 3.1. BcSDR1 positively regulates mycelia growth and sclerotia development, but negatively regulates conidia formation This study investigated colony morphology, mycelium morphology, growth rate, and conidial yield of WT, BCt41, and BCt41/BcSDR1. The WT and BCt41/BcSDR1 colonies were gray brown, and produced large amounts of sclerotia. The BCt41 colonies always remained gray and did not produce sclerotia (Fig. 1A). Under optical microscopy, the BCt41 mycelia were gray, slender, and had longer transverse septa compared to the WT and BCt41/BcSDR1 (Fig. 1B). The growth rate of the mutant BCt41 was slightly lower than that of the WT and BCt41/BcSDR1 (Fig. 1C). Conidiation of the mutant BCt41 was significantly higher than that of WT and BCt41/BcSDR1 (Fig. 1D). These results indicated that BcSDR1 positively influences mycelia growth and sclerotia development, while it negatively influence conidia formation of B. cinerea. Fig. 2. Pathogenicity analyses of WT, BCt41, and BCt41/BcSDR1 mutants. (a). Pathogenicity analyses of mutants on kidney bean leaves. (b). Lesion areas were estimated. CE. Mutant BCt41/BcSDR1; a, b, and c indicate significant differences at the 0.05 probability level.
3.2. BcSDR1 played a positive role in the pathogenicity of B. cinerea Culture blocks of WT, BCt41, and BCt41/BcSDR1 were inoculated onto detached soybean leaves. At 4 dpi, lesions appeared on soybean leaves inoculated with WT, BCt41, and BCt41/BcSDR1 (Fig. 2A). Compared to the WT and BCt41/BcSDR1, lesion areas of the BCt41 mutant on soybean leaves were dramatically reduced (Fig. 2B). These results indicate that BcSDR1 positively associates with the pathogenicity of B. cinerea.
PDA medium and incubated for 48 h at 22 °C. Then, the cellophane and mycelial blocks were removed, and the plates continued to incubate at 22 °C to observe colony formation. The removed onion epidermis was stained with trypan blue. Mycelium suspension of WT, BCt41, and BCt41/BcSDR1 were prepared and inoculated onto cellophane and onion epidermis, covered on agar medium and incubated at 22 °C in the dark; the penetration of strains were observed every 12 h. After 72 h, the back of the onion epidermis was stained with trypan blue to assess mycelium penetration and appressoria formation under the microscope.
3.3. BcSDR1 positively influences the activities of CWDEs, toxins, and acid production To investigate the mechanism underlying the reduced pathogenicity of BCt41, we examined the activities of several CWDEs, toxins, and acid production in the WT, BCt41, and BCt41/BcSDR1. The activities of PMTE, PGTE, CX, PMG, and PG were significantly reduced in the mutant BCt41 compared to WT and BCt41/BcSDR1 (Fig. 3A). The crude toxins of WT, BCt41, and BCt41/BcSDR1 were extracted and inoculated onto punctured soybean leaves to analyze the biological activity of toxins. At 4 dpi, lesions appeared on inoculated soybean leaves, and the lesion areas of BCt41 were significantly smaller than those of both WT and BCt41/BcSDR1 (Fig. 3B). Bromothymol blue was added to the PDA medium to measure the acid production ability of WT, BCt41, and BCt41/BcSDR1. The media of WT and BCt41/BcSDR1 yellowed, while the color of BCt41 media showed no obvious change (Fig. 3C). The pH values of WT, BCt41, and BCt41/BcSDR1 media at 7 d post-inoculation were 5.22, 6.47, and 5.80, respectively (Fig. 3C). These results indicated that BcSDR1 positively influences the activities of CWDEs, toxins, and acid production in B. cinerea.
2.8. Assessment of mutant cell wall integrity NaCl, KCl, Fluconazole, and CFW were used to assess cell wall integrity. Optimal concentrations of 0.8 mol/L, 0.8 mol/L, 5 μg/mL, and 100 μg/mL were used for NaCl, KCl, Fluconazole, and CFW, respectively.
2.9. Quantitative real-time PCR analysis Quantitative real-time PCR was used to measure the transcript levels of BcSDR1 and pathogenicity-related genes, using ABI SYBR Green PCR Master Mix (Applied Biosystems, USA). Pathogenicity-related genes included the G protein alpha subunit genes bcg2 and bcg3 [13], the adenylate cyclase gene bac [2], the PKA catalytic subunit genes pka1 and pka2 [11], the PKA regulatory subunit gene pkaR [11], the small GTP-binding protein gene RAS2 [5], the MAP kinase gene bmp1 [14], the MAP kinases BcSak1 and Bmp3, and the downstream target gene Bcreg1 [21]. The total RNA of each strain was isolated via Total RNA preparation kit (Omega). Samples of total RNA were digested with DNase I (Promega) to remove genomic DNAs. The cDNAs were synthesized with a revert aid first-strand cDNA synthesis kit (Invitrogen) according to the manufacturer's instructions. Quantitative real-time PCR was performed in triplicates at three independent times using SYBR green PCR master mix. Tubulin was used to achieve equal loading. Primers used in this study were listed in Table 1. The relative expression levels were calculated using the 2(–ΔCt) analysis method.
3.4. BcSDR1 regulates appressoria development and does not affect penetration ability The penetration ability and appressoria formation were assessed on cellophane and onion epidermis. It was found that WT, BCt41, and BCt41/BcSDR1 can penetrate cellophane and form colonies on the PDA medium (Fig. 4A). The mycelia of BCt41 appeared no rule curl and produced large amounts of appressoria compared to WT and BCt41/ BcSDR1 (Fig. 4B). The size of appressoria of BCt41 is bigger than that of WT and BCt41/BcSDR1 (Fig. 4C). These results indicated that BcSDR1 might influence appressoria development and does not affect penetration. 3.5. BcSDR1 affects hyphal cell walls When BC22, BCt41, and BCt41/BcSDR1 strains were inoculated onto PDA medium with 0.8 mol/L NaCl, 0.8 mol/L KCl, 5 μg/mL 125
Physiological and Molecular Plant Pathology 103 (2018) 122–129
J. Zang et al.
Fig. 3. Analysis of CWDEs activities, toxins activities, and acid producing ability of WT, BCt41, and BCt41/BcSDR1 mutants. (a). CWDE activity of WT, BCt41, and BCt41/BcSDR1 mutants; Cx: cellulose; PG: polygalactuconase; PMG: pectin methylgalactuionase; PGTE: polygalacturonic acid transeliminase; PMTE: pectin methyl transelimination enzyme. Mean values were tested in triplicate, standard errors are indicated. (b). Toxin activity of WT, BCt41, and BCt41/BcSDR1 mutants on wounded bean leaf; Bean leaf was wounded with a needle prior to the inoculation with 50 μL crude toxin methanol solution of the different strains. Furthermore, methanol was used as contrast. Photographs were taken 48 hpi. (c). Acid producing ability of WT, BCt41, and BCt41/ BcSDR1 mutants; Acid production assays was performed on PDA medium with bromothymol blue and the pH of the PD liquid medium inoculated with the BC22, BCt41, and BCt41/BcSDR1 was measured. a, b, c, and d indicate significant differences at the 0.05 probability level.
Fluconazole, and 100 μg/mL CFW (Fig. 5A), the BCt41 mutant sensitivity to NaCl, KCl, and Fluconazole were remarkably increased compared to that of the WT and BCt41/BcSDR1 during the assessment of the colony growth rate. The results indicated that BcSDR1 gene deletion reduced the resistance to osmotic stress in B. cinerea and the cellular integrity was reduced in the BCt41 mutant, suggesting that the BcSDR1 gene was involved in the resistance to osmotic stress and cell wall integrity in B. cinerea. Furthermore, the growth rate showed in the same way (Fig. 5B).
3.6. BcSDR1 gene deficiency alters the expression of cAMP and MAPK signaling pathway key genes To investigate the molecular mechanism of BcSDR1 for the regulation of the pathogenicity of B. cinerea, we used quantitative real-time PCR to examine the expression levels of cAMP and MAPK signaling pathways key genes. Significant up-regulation in the mutant BCt41 was observed for bcg2, bcg3, bac, pka1, pka2, pkaR, RAS2, Bmp1, and Bcreg1 (Fig. 6). These results indicate that BcSDR1 negatively associates with key genes of the cAMP and MAPK signaling pathways.
126
Physiological and Molecular Plant Pathology 103 (2018) 122–129
J. Zang et al.
Fig. 4. Penetrability assays and appressoria formation of WT, BCt41, and BCt41/BcSDR1 mutants. (a). The growth status of each strain was observed. WT, BCt41, and BCt41/BcSDR1 can penetrate the cellophane and form colonies on the PDA medium, respectively. (b). Mycelia morphology on cellophane. The mycelia of the BCt41 appeared no rule curl compared to WT and BCt41/BcSDR1. (c). Morphology of mycelia and appressoria on onion epidermis. Trypan blue staining shows that all strains penetrated and invaded the epidermis. However, the appressoria of the BCt41 appeared significant difference compared to WT and BCt41/BcSDR1. Arrows indicates appressoria.
Fig. 5. BcSDR1 loss leads to reduced resistance to cell wall stress. (a). The BC22, BCt41, and BCt41/BcSDR1 strains were cultured on PDA media with 0.8 mol/L NaCl, 0.8 mol/L KCl, 5 μg/mL Fluconazole, and 100 μg/mL CFW. All strains were cultured for 7 d at 25 °C in the dark. (b). The growth rate of these three strains cultured on different media. PDA was used as control.
127
Physiological and Molecular Plant Pathology 103 (2018) 122–129
J. Zang et al.
Fig. 6. Expression levels of cAMP and MAPK signaling pathway key genes in WT, BCt41, and BCt41/BcSDR1 mutants. RNA was isolated from 5-day-old mycelial samples grown on PDA medium, using Tubulin as loading control.
4. Discussion
cinerea. Previous studies have indicated that cAMP and MAPK signaling pathways are essential factors that regulate growth, development, and pathogenicity in B. cinerea [4,10,11]. Therefore, we sought to identify the BcSDR1-mediated pathway via examination of the expression levels of cAMP and MAPK signaling pathway key genes in WT, BCt41, and BCt41/BcSDR1 strains. We found that the loss-of-function of BcSDR1 up-regulated the expressions of bcg2, bcg3, bac, pka1, pka2, pkaR, RAS2, Bmp1, and Bcreg1. These results suggest that BcSDR1 negatively influence the expression level of key genes of the cAMP and MAPK signaling pathways. Our study results provide a solid foundation for further examining the regulatory mechanisms of BcSDR1 in the growth, development, and pathogenicity of B. cinerea.
B. cinerea is a typical necrotrophic pathogenic fungus that causes severe diseases and significant economic losses in a wide range of plant species. Cloning of genes related to its growth, development, and pathogenicity is fundamental for successful pathogen control. In this study, the BcSDR1 gene was isolated based on a T-DNA insertion mutant that showed a sclerotia deficient phenotype. The homologous gene of the BcSDR1 gene was less frequent in B. cinerea and other organisms based on bioinformatics analysis, suggesting that the BcSDR1 gene may be unique to the B. cinerea genome. To validate the function of the BcSDR1 gene, phenotype and pathogenicity of the T-DNA insertion mutant of BcSDR1 gene (BCt41), WT strain BC22, and BcSDR1-complementing mutant (BCt41/BcSDR1) were analyzed in this study. The phenotype and pathogenicity of BCt41/BcSDR1 were similar to those of WT. Compared to the WT and BCt41/BcSDR1 strains, the BCt41 mutant grew slowly, did not produce sclerotia, produce more conidia, and pathogenicity significantly weakened. These results verified that the BcSDR1 gene positively associates with mycelia growth, sclerotia development, and pathogenicity, while it negatively regulates conidia formation of B. cinerea. B. cinerea produce various pathogenic factors, such as cell wall degrading enzymes (CWDE), toxins, and acidic substances, which change the signaling of host cells and induce host necrosis. The pathogenicity of the BCt41 mutant was significantly reduced in this study. To determine the mechanism underlying this reduced pathogenicity of mutants BCt41, we examined the activity of CWDEs, toxin, and the ability of acid production in WT, BCt41, and BCt41/BcSDR1 strains. The activity of several important CWDEs (PMTE, PGTE, CX, PMG, and PG) and toxin was significantly lower in the BCt41 mutant. Furthermore, the ability for acid production was lower in the BCt41 mutant. These results indicated that the function of BcSDR1 in the pathogenicity may be involved in the regulation of CWDEs, toxin, and acid production in B.
Acknowledgments This study was supported by the Natural Science Foundation of Hebei Province (No. C2018204045), the Higher Education Research Fund of Hebei (No.ZD2016001), and the Scientific Research Foundation for Returned Chinese Scholars of Hebei (No.0316012). References [1] E.Y. Abdelghani, K. Bala, B. Paul, Characterisation of Pythium paroecandrum and its antagonism towards Botrytis cinerea, the causative agent of grey mould disease of grape, FEMS Microbiol. Lett. 230 (2004) 177–183. [2] R.H. Cichewicz, S.A. Kouzi, M.T. Hamann, Dimerization of resveratrol by the grapevine pathogen Botrytis cinerea, J. Nat. Prod. 63 (2000) 29–33. [3] B. Williamson, B. Tudzynski, P. Tudzynski, J.A. van Kan, Botrytis cinerea: the cause of grey mould disease, Mol. Plant Pathol. 8 (2007) 561–580. [4] M. Choquer, E. Fournier, C. Kunz, C. Levis, J.M. Pradier, A. Simon, et al., Botrytis cinerea virulence factors: new insights into a necrotrophic and polyphageous pathogen, FEMS Microbiol. Lett. 277 (2007) 1–10. [5] A. Klimpel, C.S. Gronover, B. Williamson, J.A. Stewart, B. Tudzynski, The adenylate cyclase (BAC) in Botrytis cinerea is required for full pathogenicity, Mol. Plant Pathol. 3 (2002) 439–450.
128
Physiological and Molecular Plant Pathology 103 (2018) 122–129
J. Zang et al.
[6] R.M. Patel, J.A. van Kan, A.M. Bailey, G.D. Foster, RNA-mediated gene silencing of superoxide dismutase (bcsod1) in Botrytis cinerea, Phytopathology 98 (2008) 1334–1339. [7] R.W.S. Weber, Resistance of Botrytis cinerea to multiple fungicides in Northern German small-fruit production, Plant Dis. 95 (2011) 1263–1269. [8] C. Pinedo, C.M. Wang, J.M. Pradier, B. Dalmais, M. Choquer, P. Le Pecheur, et al., Sesquiterpene synthase from the botrydial biosynthetic gene cluster of the phytopathogen Botrytis cinerea, ACS Chem. Biol. 3 (2008) 791–801. [9] F.R. Rossi, A. Garriz, M. Marina, F.M. Romero, M.E. Gonzalez, I.G. Collado, et al., The sesquiterpene botrydial produced by Botrytis cinerea induces the hypersensitive response on plant tissues and its action is modulated by salicylic acid and jasmonic acid signaling, Mol. Plant Microbe Interact. 24 (2011) 888–896. [10] G. Doehlemann, P. Berndt, M. Hahn, Different signalling pathways involving a Galpha protein, cAMP and a MAP kinase control germination of Botrytis cinerea conidia, Mol. Microbiol. 59 (2006) 821–835. [11] J. Schumacher, L. Kokkelink, C. Huesmann, D. Jimenez-Teja, I.G. Collado, R. Barakat, et al., The cAMP-dependent signaling pathway and its role in conidial germination, growth, and virulence of the gray mold Botrytis cinerea, Mol. Plant Microbe Interact. 21 (2008) 1443–1459. [12] C.S. Gronover, C. Schorn, B. Tudzynski, Identification of Botrytis cinerea genes upregulated during infection and controlled by the Galpha subunit BCG1 using suppression subtractive hybridization (SSH), Mol. Plant Microbe Interact. 17 (2004) 537–546. [13] C.S. Gronover, D. Kasulke, P. Tudzynski, B. Tudzynski, The role of G protein alpha subunits in the infection process of the gray mold fungus Botrytis cinerea, Mol. Plant Microbe Interact. 14 (2001) 1293–1302. [14] J. Heller, N. Ruhnke, J.J. Espino, M. Massaroli, I.G. Collado, P. Tudzynski, The
[15]
[16]
[17] [18]
[19]
[20]
[21]
129
mitogen-activated protein kinase BcSak1 of Botrytis cinerea is required for pathogenic development and has broad regulatory functions beyond stress response, Mol. Plant Microbe Interact. 25 (2012) 802–816. A. Schamber, M. Leroch, J. Diwo, K. Mendgen, M. Hahn, The role of mitogen-activated protein (MAP) kinase signalling components and the Ste12 transcription factor in germination and pathogenicity of Botrytis cinerea, Mol. Plant Pathol. 11 (2010) 105–119. L. Zheng, M. Campbell, J. Murphy, S. Lam, J.R. Xu, The BMP1 gene is essential for pathogenicity in the gray mold fungus Botrytis cinerea, Mol. Plant Microbe Interact. 13 (2000) 724–732. J.J. Espino, G. Gutierrez-Sanchez, N. Brito, P. Shah, R. Orlando, C. Gonzalez, The Botrytis cinerea early secretome, Proteomics 10 (2010) 3020–3034. J. Schumacher, M. Viaud, A. Simon, B. Tudzynski, The G subunit BCG1, the phospholipase C (BcPLC1) and the calcineurin phosphatase co-ordinately regulate gene expression in the grey mould fungus Botrytis cinerea, Mol. Microbiol. 67 (5) (2008) 1027–1050. M.C. Soulie, A. Piffeteau, M. Choquer, M. Boccara, A. Vidal-Cros, Disruption of Botrytis cinerea class I chitin synthase gene Bcchs1 results in cell wall weakening and reduced virulence, Fungal Genet. Biol. 40 (2003) 38–46. P. Berto, M.H. Jijakli, P. Lepoivre, Possible role of colonization and cell wall-degrading enzymes in the differential ability of three Ulocladium atrum strains to control Botrytis cinerea on necrotic strawberry leaves, Phytopathology 91 (2001) 1030–1036. C.B. Michielse, M. Becker, J. Heller, J. Moraga, I.G. Collado, P. Tudzynski, The Botrytis cinerea Reg1 protein, a putative transcriptional regulator, is required for pathogenicity, conidiogenesis, and the production of secondary metabolites, Mol. Plant Microbe Interact. 24 (2011) 1074–1085.