- Email: [email protected]
The Bin1 Gene Localizes to Human Chromosome 2q14 by PCR Analysis of Somatic Cell Hybrids and Fluorescencein SituHybridization
329
BRIEF REPORTS
ACKNOWLEDGMENTS We thank Frances Cousins and Dennis Duggan for their technical assistance and EUCIB for provision of Mus spretus DNA. All animal experiments were performed under Home Office license. The work was supported by the MRC and CRC. M.B. was the recipient of a scholarship from the Ministry of Culture, Iran.
The Bin1 Gene Localizes to Human Chromosome 2q14 by PCR Analysis of Somatic Cell Hybrids and Fluorescence in Situ Hybridization Dmitri Negorev,* Harold Riethman,† Robert Wechsler-Reya,† Daitoku Sakamuro,† George C. Prendergast,† and Daniela Simon*,†,1
REFERENCES 1. Cui, W., Fowlis, D. J., Cousins, F. M., Duffie, E., Bryson, S., Balmain, A., and Akhurst, R. J. (1995). Concerted action of TGFb1 and its type II receptor in control of epidermal homeostasis in transgenic mice. Genes Dev. 9: 945– 955. 2. Cui, W., and Akhurst, R. J. (1996). Transforming growth factors b. In ‘‘Cytokines in Health and Disease’’ (C. Brody and D. LeRoith, Eds.), JAI Press, New York, in press. 3. Dietrich, W. F., Miller, J. C., Steen, R. G., et al. (1994). A genetic map of the mouse with 4,006 simple sequence length polymorphisms. Nature Genet. 7: 220–245. 4. Grainger, D. J., Kemp, P. R., Metcalfe, J. C., Liu, A. C., Lawn, R. M., Williams, N. R., Grace, A. A., Schofield, P. M., and Chauhan, A. (1995). The serum concentration of active transforming growth factor-b is severely depressed in advanced atherosclerosis. Nature Med. 1: 74–79. 5. Green, E. L. (1989). Catalog of mutant genes and polymorphic loci. In ‘‘Genetic Variants and Strains of the Laboratory Mouse’’ (M. F. Lyon and A. G. Searle, Eds.), pp. 12–403, Oxford Univ. Press, Oxford. 6. Laiho, M., Weis, F. M. B., and Massague, J. (1990). Concomitant loss of transforming growth factor (TGF)-b receptor types I and II in TGF-b-resistant cell mutants implicates both receptor types in signal transduction. J. Biol. Chem. 265: 18518 –18524. 7. Lander, E., Green, P., Abrahamson, J., Barlow, A., Daley, M., Lincoln, S., and Newburg, L. (1987). MAPMAKER: An interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 1: 174–181. 8. Lane, P. W. (1984). Tippy. Trends Genet. 71: 31. 9. Lawler, S., Candia, A. F., Ebner, R., Shum, L., Lopez, A. R., Moses, H. L., Wright, C. V., and Derynck, R. (1994). The murine type II TGF-b receptor has a coincident embryonic expression and binding preference for TGFb1. Development 120: 165 –175. 10. Markowitz, S., Wang, J., Myeroff, L., Parsons, R., Sun, L., Lutterbaugh, J., Fan, R. S., Zborowska, E., Kinzler, K. W., Vogelstein, B., Brittain, M., and Willson, J. K. V. (1995). Inactivation of the type II TGF-b receptor in colon cancer cells with microsatellite instability. Science 268: 1336 –1338. 11. Mathew, S., Murty, V. V. V. S., Cheifetz, S., George, D., Massague, M., and Chaganti, R. S. K. (1994). Transforming growth factor receptor gene TGFBR2 maps to human chromosome band 3p22. Genomics 20: 114– 115. 12. Shull, M. M., Ormsby, I., Kier, A. B., Pawlowski, S., Diebold, R. J., Yin, M., Allen, R., Sidman, C., Proetzel, G., Calvin, D., Annunziata, N., and Doetschman, T. (1992). Targeted disruption of the mouse transforming growth factor-b1 gene results in multifocal inflammatory disease. Nature 359: 693–699. 13. Snell, G. D. (1955). ducky, a new second chromosome mutation in the mouse. J. Hered. 46: 27–29. 14. Wrana, J. L., Attisano, L., Weiser, R., Ventura, F., and Massague, J. (1994). Mechanism of activation of the TGF-b receptor. Nature 370: 341–347.
*Medical College of Pennsylvania and Hahnemann University, Department of Pathology and Laboratory Medicine, 2900 Queen Lane, Philadelphia, Pennsylvania 19129; and †Wistar Institute, 3601 Spruce Street, Philadelphia, Pennsylvania 19104 Received November 17, 1995; accepted January 17, 1996
Bin1 (Box-dependent myc-interacting protein-1), a novel human gene product with features of a tumor suppressor protein, was identified in a two-hybrid screen for proteins that interact with the Myc oncoprotein (3). Recent data indicate that the loss of Bin1 expression is a frequent aberration in human hepatocellular carcinomas (unpublished results). We therefore decided to identify its cytogenetic location; the Bin1 gene was mapped as described below. A part of the 3*-untranslated region (3*UTR), which corresponds to a 179-bp fragment of a full-length Bin1 cDNA, was the DNA target to be amplified by the polymerase chain reaction (PCR) (Fig. 1A, lane D). The same size DNA fragment was specifically amplified from human genomic DNA (Fig. 1A, lane Hu). PCR performed on genomic DNA isolated from the NIGMS panel of rodent–human somatic cell hybrids, each of which contain a different human chromosome (obtained from the Human Genetic Mutant Cell Repository, Coriell Institute for Medical Research, Camden, NJ), amplified a specific PCR product only in the hybrid NA10826B. This somatic cell hybrid contained only human chromosome 2 DNA (Fig. 1A, lane 2). An identical product was amplified from genomic Bin1 l phage clone 3.4 (Fig. 1A, lane G), used as a positive control. This clone was obtained by hybridization of a WI-38 normal human diploid fibroblast genomic library with the Bin1 cDNA (W.-R., R., and P.G.C., unpublished results). The 179-bp Bin1-specific PCR product was not detected in hamster or mouse genomic DNA (Fig. 1A, lanes Ha and Mo, respectively). Several PCR analyses through the coding region of the Bin1 gene were performed, and all support the evidence of its localization to human chromosome 2. Each assay amplified a human fragment, as expected, and some of the primers generated an additional fragment in the mouse DNA but not in the hamster genomic DNA. This indicates that there is homology between the mouse and the human Bin1 sequences (data not shown). To map the exact location of the Bin1 gene, we performed fluorescence in situ hybridization (FISH) on human metaphase chromosomes. FISH was carried out with an Ç15-kb DNA frag1 To whom correspondence and reprint requests should be addressed. Telephone: (215) 991-8495. Fax: (215) 843-6471. E-mail: [email protected].
GENOMICS
33, 329–331 (1996) ARTICLE NO. 0205
0888-7543/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
AID Genom BREP
/
6r13$$$201
03-23-96 00:06:18
gnmbr
AP: Genomics
330
BRIEF REPORTS
FIG. 1. (A) Localization of the human Bin1 gene by PCR from the NIGMS panel of the rodent –human somatic hybrid cell lines. Target DNA was subjected to amplification under the following conditions: 35 cycles of amplification, with denaturation for 1 min at 947C, annealing for 1 min at 607C, and extension for 1 min at 727C. Each reaction was carried out in a 10-ml volume containing 50 ng of genomic or 250 pg of plasmid and cosmid DNA template, 1 mM each of the primers 5*CTAGTTGAGTTTCTGGCGCC3* and 5*GCAGAGCAGGCTAGGCTG3 *, 10 mM Tris– HCl (pH 8.3), 1.5 mM MgCl 2 , 50 mM KCl, 50 mM each dNTP, 0.5 U Taq DNA polymerase. (Lanes 1– 22, X, and Y) Samples with genomic DNA isolated from the NIGMS panel of rodent –human somatic cell hybrids; (lane C) sample without any DNA; (lane Hu) sample with human genomic DNA; (lane Ha) hamster genomic DNA; (lane Mo) mouse genomic DNA; (lane D) human Bin1 cDNA clone; (lane G) genomic P1 plasmid clone 3.4 with Bin1 gene; (lane M) molecular weight marker fX174/HaeIII. Arrows indicate the 179-bp product. (B) FISH analysis of the human Bin1 gene. (a) DAPI staining; (b) the same metaphase after FISH. Bin1-specific signal is indicated by the arrowheads. Human metaphase chromosomes were prepared from an EBV/40 transformed human lymphoid cell line (4) by standard techniques. The Bin1 genomic clone 3.4, with human Bin1 gene, was labeled by nick-translation with biotin-14– dATP (BRL, Gaithersburg, MD). Hybridization and detection were performed with 100 ng of labeled probe, and conditions were as described elsewhere (2). Hybridization signals were detected by a sandwich of biotinylated anti-avidin between two layers of FITC –avidin (Vector Laboratories, Burlingame, CA). Propidium iodide was used for counterstaining in an antifade solution (Vysis, Flamington, MA).
ment containing Bin1 genomic sequence (clone 3.4). Fifteen metaphases were examined. All demonstrated hybridization to chromosome region 2q14. Mapping was carried out using the fractional length (FL) of the whole chromosome relative to pter (Flpter) method, as described (1). Fluorescent signals were clearly visible as symmetrical spots on both mitotic metaphase chromatids of the two chromosomes 2. No signals were detected on any other chromosome region (see Fig. 1B). Our results indicated that the human Bin1 message is encoded by a single gene, which resides on chromosome region 2q14. This region is shared with the PROC gene, which encodes protein C; the GYPC gene, which encodes the blood group antigen Gerbich (glycophorin C); interleukin-1A and a family of interleukin-related genes; and the liver cancer oncogene, LCO (5). Comparison of the nucleotide sequence of the Bin1 gene with the nucleotide sequences of these genes did not reveal any significant homologies. The proximity of Bin1 to LCO, a gene involved in cell growth regulation, was interesting given that Bin1 was identified as a Myc-interacting protein. However, LCO and Bin1 are likely to represent different loci, since the former is an oncogene while the latter exhibits tumor suppressor activity. Knowledge of the Bin1 location on the 2q14 region could assist in the ongoing development of a physical map of chromosome 2.
AID Genom BREP
/
6r13$$$521
03-23-96 00:06:18
ACKNOWLEDGMENTS This project was supported in part by National Institutes of Health Grants CA58525, CA10815, and HG600954.
REFERENCES 1. Lichter, P., Tang, C.-J. C., Call, K., Hermanson, G., Evans, G. A., Housman, D., and Ward, D. C. (1990). High-resolution mapping of human chromosome 11 by in situ hybridization with cosmid clones. Science 247: 64 –69. 2. Riethman, H. C., Moyzis, R. K., Meyne, J., Burke, D. T., and Olson, M. V. (1989). Cloning human telomeric DNA fragments into Saccharomyces cerevisiae using a yeast artificial chromosome vector. Proc. Natl. Acad. Sci. USA 86: 6240 –6244. 3. Sakamuro, D., Elliott, K., Wechsler-Reya, R., and Prendergast, G. C. (1996). Bin 1, a novel tumor suppressor protein that interacts with and inhibits Myc. Nature Genet., submitted for publication. 4. Simon, D., and Carr, B. J. (1995). Integration of hepatitis B virus and alteration of the 1p36 region found in cancerous tissue of primary hepatocellular carcinoma with viral replication evi-
gnmbr
AP: Genomics
331
BRIEF REPORTS denced only in non-cancerous, cirrhotic tissue. Hepatology 22: 1393 –1398. 5. Spurr, N. K., Barton, H., Bashir, R., et al. (1994). Report of the third international workshop on human chromosome 2 mapping 1994. Cytogenet. Cell Genet. 67: 215– 244.
Assignment of the Human FKBP12Rapamycin-Associated Protein (FRAP) Gene to Chromosome 1p36 by Fluorescence in Situ Hybridization Paul A. Moore, Craig A. Rosen, and Kenneth C. Carter1 Human Genome Sciences, 9410 Key West Avenue, Rockville, Maryland 20850-3331 Received August 29, 1995; accepted November 13, 1995
Rapamycin and the structurally related compound FK506 are potent immunosuppressive drugs. Both immu1 To whom correspondence should be addressed. Telephone: (301) 309-8504. Fax: (301) 309-8511.
nosuppressants mediate their cellular effect by binding to the same intracellular receptor, the FK506 binding protein (FKBP12) (8 and references therein). The FKBP12 – FK506 complex interacts with and inhibits the calcium-activated protein phosphatase activity of calcineurin (10), which is required for the activation of the T lymphocyte via the T-cell receptor. In contrast, the immediate downstream target of the FKBP12 – rapamycin complex has recently been identified as a protein called FKBP-rapamycin-associated protein (FRAP (3); also called RAFT1 (11) and RAPT1 (5)). Biochemical studies demonstrated that FKBP12 and FRAP interact only in the presence of rapamycin, not in the presence of FK506 (3, 11). Likewise, genetic studies in yeast, using the two-hybrid system, demonstrated that FRAP and FKBP12 interact only when yeast are grown in the presence of rapamycin (5). The downstream target of the rapamycin – FKBP12 – FRAP complex is unknown, but their interaction somehow arrests T cells at the G1 phase of the cell cycle, leading to a block in the T-cell response and immunosuppression. While the precise functions of FRAP and the highly related homologs DRR1/TOR1 and DRR2/TOR2 from the yeast Saccharomyces cerevisiae are unknown, they demonstrate amino acid homology to the catalytic domain of the p110 subunit of phosphatidylinositol 3-kinase, suggesting that
FIG. 1. Fluorescence in situ hybridization mapping of the human FRAP gene. A 3.5-kb FRAP cDNA was nick-translated using digoxigenin– dUTP (Boehringer Mannheim), and fluorescence in situ hybridization was performed as described in Ref. 7. Individual chromosomes were counterstained with DAPI, and color digital images, containing both DAPI and gene signal, were recorded using a triple-band-pass filter set (Chroma Technology Inc., Brattleboro, VT) in combination with a charged coupled-device camera (Photometrics Inc., Tucson, AZ) and variable excitation wavelength filters. Images were analyzed using the ISEE software package (Inovision Corp., Durham, NC). (A) A chromosome spread from a single cell showing hybridization of the FRAP cDNA to 1p36 of each chromosome 1 (green arrows). Also shown is hybridization of CDC2L1 (6), a gene previously mapped to 1p36 (red arrows). (B) An example of hybridization to an individual chromosome 1. (Left) DAPI G-band-like pattern shown as a inverse contrast enhanced image. (Right) FRAP signal (green), DAPI counterstain (blue signal). (C) ISCN idiogram showing the assigned position of the gene. GENOMICS 33, 331– 332 ARTICLE NO. 0206
(1996)
0888-7543/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
AID Genom BREP
/
6r13$$$521
03-23-96 00:06:18
gnmbr
AP: Genomics
BRIEF REPORTS
ACKNOWLEDGMENTS We thank Frances Cousins and Dennis Duggan for their technical assistance and EUCIB for provision of Mus spretus DNA. All animal experiments were performed under Home Office license. The work was supported by the MRC and CRC. M.B. was the recipient of a scholarship from the Ministry of Culture, Iran.
The Bin1 Gene Localizes to Human Chromosome 2q14 by PCR Analysis of Somatic Cell Hybrids and Fluorescence in Situ Hybridization Dmitri Negorev,* Harold Riethman,† Robert Wechsler-Reya,† Daitoku Sakamuro,† George C. Prendergast,† and Daniela Simon*,†,1
REFERENCES 1. Cui, W., Fowlis, D. J., Cousins, F. M., Duffie, E., Bryson, S., Balmain, A., and Akhurst, R. J. (1995). Concerted action of TGFb1 and its type II receptor in control of epidermal homeostasis in transgenic mice. Genes Dev. 9: 945– 955. 2. Cui, W., and Akhurst, R. J. (1996). Transforming growth factors b. In ‘‘Cytokines in Health and Disease’’ (C. Brody and D. LeRoith, Eds.), JAI Press, New York, in press. 3. Dietrich, W. F., Miller, J. C., Steen, R. G., et al. (1994). A genetic map of the mouse with 4,006 simple sequence length polymorphisms. Nature Genet. 7: 220–245. 4. Grainger, D. J., Kemp, P. R., Metcalfe, J. C., Liu, A. C., Lawn, R. M., Williams, N. R., Grace, A. A., Schofield, P. M., and Chauhan, A. (1995). The serum concentration of active transforming growth factor-b is severely depressed in advanced atherosclerosis. Nature Med. 1: 74–79. 5. Green, E. L. (1989). Catalog of mutant genes and polymorphic loci. In ‘‘Genetic Variants and Strains of the Laboratory Mouse’’ (M. F. Lyon and A. G. Searle, Eds.), pp. 12–403, Oxford Univ. Press, Oxford. 6. Laiho, M., Weis, F. M. B., and Massague, J. (1990). Concomitant loss of transforming growth factor (TGF)-b receptor types I and II in TGF-b-resistant cell mutants implicates both receptor types in signal transduction. J. Biol. Chem. 265: 18518 –18524. 7. Lander, E., Green, P., Abrahamson, J., Barlow, A., Daley, M., Lincoln, S., and Newburg, L. (1987). MAPMAKER: An interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 1: 174–181. 8. Lane, P. W. (1984). Tippy. Trends Genet. 71: 31. 9. Lawler, S., Candia, A. F., Ebner, R., Shum, L., Lopez, A. R., Moses, H. L., Wright, C. V., and Derynck, R. (1994). The murine type II TGF-b receptor has a coincident embryonic expression and binding preference for TGFb1. Development 120: 165 –175. 10. Markowitz, S., Wang, J., Myeroff, L., Parsons, R., Sun, L., Lutterbaugh, J., Fan, R. S., Zborowska, E., Kinzler, K. W., Vogelstein, B., Brittain, M., and Willson, J. K. V. (1995). Inactivation of the type II TGF-b receptor in colon cancer cells with microsatellite instability. Science 268: 1336 –1338. 11. Mathew, S., Murty, V. V. V. S., Cheifetz, S., George, D., Massague, M., and Chaganti, R. S. K. (1994). Transforming growth factor receptor gene TGFBR2 maps to human chromosome band 3p22. Genomics 20: 114– 115. 12. Shull, M. M., Ormsby, I., Kier, A. B., Pawlowski, S., Diebold, R. J., Yin, M., Allen, R., Sidman, C., Proetzel, G., Calvin, D., Annunziata, N., and Doetschman, T. (1992). Targeted disruption of the mouse transforming growth factor-b1 gene results in multifocal inflammatory disease. Nature 359: 693–699. 13. Snell, G. D. (1955). ducky, a new second chromosome mutation in the mouse. J. Hered. 46: 27–29. 14. Wrana, J. L., Attisano, L., Weiser, R., Ventura, F., and Massague, J. (1994). Mechanism of activation of the TGF-b receptor. Nature 370: 341–347.
*Medical College of Pennsylvania and Hahnemann University, Department of Pathology and Laboratory Medicine, 2900 Queen Lane, Philadelphia, Pennsylvania 19129; and †Wistar Institute, 3601 Spruce Street, Philadelphia, Pennsylvania 19104 Received November 17, 1995; accepted January 17, 1996
Bin1 (Box-dependent myc-interacting protein-1), a novel human gene product with features of a tumor suppressor protein, was identified in a two-hybrid screen for proteins that interact with the Myc oncoprotein (3). Recent data indicate that the loss of Bin1 expression is a frequent aberration in human hepatocellular carcinomas (unpublished results). We therefore decided to identify its cytogenetic location; the Bin1 gene was mapped as described below. A part of the 3*-untranslated region (3*UTR), which corresponds to a 179-bp fragment of a full-length Bin1 cDNA, was the DNA target to be amplified by the polymerase chain reaction (PCR) (Fig. 1A, lane D). The same size DNA fragment was specifically amplified from human genomic DNA (Fig. 1A, lane Hu). PCR performed on genomic DNA isolated from the NIGMS panel of rodent–human somatic cell hybrids, each of which contain a different human chromosome (obtained from the Human Genetic Mutant Cell Repository, Coriell Institute for Medical Research, Camden, NJ), amplified a specific PCR product only in the hybrid NA10826B. This somatic cell hybrid contained only human chromosome 2 DNA (Fig. 1A, lane 2). An identical product was amplified from genomic Bin1 l phage clone 3.4 (Fig. 1A, lane G), used as a positive control. This clone was obtained by hybridization of a WI-38 normal human diploid fibroblast genomic library with the Bin1 cDNA (W.-R., R., and P.G.C., unpublished results). The 179-bp Bin1-specific PCR product was not detected in hamster or mouse genomic DNA (Fig. 1A, lanes Ha and Mo, respectively). Several PCR analyses through the coding region of the Bin1 gene were performed, and all support the evidence of its localization to human chromosome 2. Each assay amplified a human fragment, as expected, and some of the primers generated an additional fragment in the mouse DNA but not in the hamster genomic DNA. This indicates that there is homology between the mouse and the human Bin1 sequences (data not shown). To map the exact location of the Bin1 gene, we performed fluorescence in situ hybridization (FISH) on human metaphase chromosomes. FISH was carried out with an Ç15-kb DNA frag1 To whom correspondence and reprint requests should be addressed. Telephone: (215) 991-8495. Fax: (215) 843-6471. E-mail: [email protected].
GENOMICS
33, 329–331 (1996) ARTICLE NO. 0205
0888-7543/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
AID Genom BREP
/
6r13$$$201
03-23-96 00:06:18
gnmbr
AP: Genomics
330
BRIEF REPORTS
FIG. 1. (A) Localization of the human Bin1 gene by PCR from the NIGMS panel of the rodent –human somatic hybrid cell lines. Target DNA was subjected to amplification under the following conditions: 35 cycles of amplification, with denaturation for 1 min at 947C, annealing for 1 min at 607C, and extension for 1 min at 727C. Each reaction was carried out in a 10-ml volume containing 50 ng of genomic or 250 pg of plasmid and cosmid DNA template, 1 mM each of the primers 5*CTAGTTGAGTTTCTGGCGCC3* and 5*GCAGAGCAGGCTAGGCTG3 *, 10 mM Tris– HCl (pH 8.3), 1.5 mM MgCl 2 , 50 mM KCl, 50 mM each dNTP, 0.5 U Taq DNA polymerase. (Lanes 1– 22, X, and Y) Samples with genomic DNA isolated from the NIGMS panel of rodent –human somatic cell hybrids; (lane C) sample without any DNA; (lane Hu) sample with human genomic DNA; (lane Ha) hamster genomic DNA; (lane Mo) mouse genomic DNA; (lane D) human Bin1 cDNA clone; (lane G) genomic P1 plasmid clone 3.4 with Bin1 gene; (lane M) molecular weight marker fX174/HaeIII. Arrows indicate the 179-bp product. (B) FISH analysis of the human Bin1 gene. (a) DAPI staining; (b) the same metaphase after FISH. Bin1-specific signal is indicated by the arrowheads. Human metaphase chromosomes were prepared from an EBV/40 transformed human lymphoid cell line (4) by standard techniques. The Bin1 genomic clone 3.4, with human Bin1 gene, was labeled by nick-translation with biotin-14– dATP (BRL, Gaithersburg, MD). Hybridization and detection were performed with 100 ng of labeled probe, and conditions were as described elsewhere (2). Hybridization signals were detected by a sandwich of biotinylated anti-avidin between two layers of FITC –avidin (Vector Laboratories, Burlingame, CA). Propidium iodide was used for counterstaining in an antifade solution (Vysis, Flamington, MA).
ment containing Bin1 genomic sequence (clone 3.4). Fifteen metaphases were examined. All demonstrated hybridization to chromosome region 2q14. Mapping was carried out using the fractional length (FL) of the whole chromosome relative to pter (Flpter) method, as described (1). Fluorescent signals were clearly visible as symmetrical spots on both mitotic metaphase chromatids of the two chromosomes 2. No signals were detected on any other chromosome region (see Fig. 1B). Our results indicated that the human Bin1 message is encoded by a single gene, which resides on chromosome region 2q14. This region is shared with the PROC gene, which encodes protein C; the GYPC gene, which encodes the blood group antigen Gerbich (glycophorin C); interleukin-1A and a family of interleukin-related genes; and the liver cancer oncogene, LCO (5). Comparison of the nucleotide sequence of the Bin1 gene with the nucleotide sequences of these genes did not reveal any significant homologies. The proximity of Bin1 to LCO, a gene involved in cell growth regulation, was interesting given that Bin1 was identified as a Myc-interacting protein. However, LCO and Bin1 are likely to represent different loci, since the former is an oncogene while the latter exhibits tumor suppressor activity. Knowledge of the Bin1 location on the 2q14 region could assist in the ongoing development of a physical map of chromosome 2.
AID Genom BREP
/
6r13$$$521
03-23-96 00:06:18
ACKNOWLEDGMENTS This project was supported in part by National Institutes of Health Grants CA58525, CA10815, and HG600954.
REFERENCES 1. Lichter, P., Tang, C.-J. C., Call, K., Hermanson, G., Evans, G. A., Housman, D., and Ward, D. C. (1990). High-resolution mapping of human chromosome 11 by in situ hybridization with cosmid clones. Science 247: 64 –69. 2. Riethman, H. C., Moyzis, R. K., Meyne, J., Burke, D. T., and Olson, M. V. (1989). Cloning human telomeric DNA fragments into Saccharomyces cerevisiae using a yeast artificial chromosome vector. Proc. Natl. Acad. Sci. USA 86: 6240 –6244. 3. Sakamuro, D., Elliott, K., Wechsler-Reya, R., and Prendergast, G. C. (1996). Bin 1, a novel tumor suppressor protein that interacts with and inhibits Myc. Nature Genet., submitted for publication. 4. Simon, D., and Carr, B. J. (1995). Integration of hepatitis B virus and alteration of the 1p36 region found in cancerous tissue of primary hepatocellular carcinoma with viral replication evi-
gnmbr
AP: Genomics
331
BRIEF REPORTS denced only in non-cancerous, cirrhotic tissue. Hepatology 22: 1393 –1398. 5. Spurr, N. K., Barton, H., Bashir, R., et al. (1994). Report of the third international workshop on human chromosome 2 mapping 1994. Cytogenet. Cell Genet. 67: 215– 244.
Assignment of the Human FKBP12Rapamycin-Associated Protein (FRAP) Gene to Chromosome 1p36 by Fluorescence in Situ Hybridization Paul A. Moore, Craig A. Rosen, and Kenneth C. Carter1 Human Genome Sciences, 9410 Key West Avenue, Rockville, Maryland 20850-3331 Received August 29, 1995; accepted November 13, 1995
Rapamycin and the structurally related compound FK506 are potent immunosuppressive drugs. Both immu1 To whom correspondence should be addressed. Telephone: (301) 309-8504. Fax: (301) 309-8511.
nosuppressants mediate their cellular effect by binding to the same intracellular receptor, the FK506 binding protein (FKBP12) (8 and references therein). The FKBP12 – FK506 complex interacts with and inhibits the calcium-activated protein phosphatase activity of calcineurin (10), which is required for the activation of the T lymphocyte via the T-cell receptor. In contrast, the immediate downstream target of the FKBP12 – rapamycin complex has recently been identified as a protein called FKBP-rapamycin-associated protein (FRAP (3); also called RAFT1 (11) and RAPT1 (5)). Biochemical studies demonstrated that FKBP12 and FRAP interact only in the presence of rapamycin, not in the presence of FK506 (3, 11). Likewise, genetic studies in yeast, using the two-hybrid system, demonstrated that FRAP and FKBP12 interact only when yeast are grown in the presence of rapamycin (5). The downstream target of the rapamycin – FKBP12 – FRAP complex is unknown, but their interaction somehow arrests T cells at the G1 phase of the cell cycle, leading to a block in the T-cell response and immunosuppression. While the precise functions of FRAP and the highly related homologs DRR1/TOR1 and DRR2/TOR2 from the yeast Saccharomyces cerevisiae are unknown, they demonstrate amino acid homology to the catalytic domain of the p110 subunit of phosphatidylinositol 3-kinase, suggesting that
FIG. 1. Fluorescence in situ hybridization mapping of the human FRAP gene. A 3.5-kb FRAP cDNA was nick-translated using digoxigenin– dUTP (Boehringer Mannheim), and fluorescence in situ hybridization was performed as described in Ref. 7. Individual chromosomes were counterstained with DAPI, and color digital images, containing both DAPI and gene signal, were recorded using a triple-band-pass filter set (Chroma Technology Inc., Brattleboro, VT) in combination with a charged coupled-device camera (Photometrics Inc., Tucson, AZ) and variable excitation wavelength filters. Images were analyzed using the ISEE software package (Inovision Corp., Durham, NC). (A) A chromosome spread from a single cell showing hybridization of the FRAP cDNA to 1p36 of each chromosome 1 (green arrows). Also shown is hybridization of CDC2L1 (6), a gene previously mapped to 1p36 (red arrows). (B) An example of hybridization to an individual chromosome 1. (Left) DAPI G-band-like pattern shown as a inverse contrast enhanced image. (Right) FRAP signal (green), DAPI counterstain (blue signal). (C) ISCN idiogram showing the assigned position of the gene. GENOMICS 33, 331– 332 ARTICLE NO. 0206
(1996)
0888-7543/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
AID Genom BREP
/
6r13$$$521
03-23-96 00:06:18
gnmbr
AP: Genomics