- Email: [email protected]
The Brucella abortus vaccine strain B19 carries a deletion in the erythritol catabolic genes
FEMS Microbiology Letters 121 (1994) 337-342 © 1994 Federation of European Microbiological Societies 0378-1097/94/$07.00 Published by Elsevier
337
F E M S L E 06138
The Brucella abortus vaccine strain B19 carries a deletion in the erythritol catabolic genes F61ix J. Sangari, J u a n M. G a r c l a - L o b o * a n d Jesfis A g i l e r o Departamento de Biologla Molecular, Facultad de Medicina, Unit,ersidad de Cantabria, Polfgono de Cazofia s / n. 39011, Santander, Spain
Received 27 June 1994; accepted 4 July 1994
Abstract: Brucella abortus B19, an avirulent strain obtained by spontaneous mutation, is used worldwide as a vaccine for the control of bovine brucellosis. B19 differs from other B. abortus strains in its sensitivity to erythritol. We took advantage of a previously obtained erythritol sensitive T n 5 insertion mutant of B. abortus 2308 to clone the chromosomal region containing erythritol catabolic genes from this representative pathogenic strain and from the vaccine strain B19. Physical mapping with restriction endonucleases and nucleotide sequence determination revealed the existence of a 702 bp long deletion, occurring between two short direct repeats, in the chromosome of B19. This deletion rendered the B19 strain sensitive to erythritol. Two oligonucleotides whose sequences flank this deletion provided an easy method to differentiate B19 from all other B. abortus isolates. Key words: Brucella abortus B19; Erythritol; Polymerase chain reaction
Introduction Brucella abortus is one of the main causes of cattle disease worldwide. Infection with this organism usually results in abortion and eventually can also produce human disease, resulting in undulant fever and many other unrelated symptoms. Control of B. abortus infection in cattle is usually done by vaccination with the attenuated B. abortus strain B19. This vaccine was obtained after serial subculture of a pathogenic B. abortus strain under laboratory conditions [1]. B19 is non-pathogenic and usually produces a protective
* Corresponding author. Tel: + 34(42)201948; + 34(42)201945; email: [email protected].
SSDI 0 3 7 8 - 1 0 9 7 ( 9 4 ) 0 0 2 8 8 - 6
Fax:
immune response in vaccinated animals. However B19 offers several disadvantages as a low frequency of persistence when used on adult animals [2]. This causes some interference with serologic diagnostic tests for bovine brucellosis, in spite of the existence of serodiagnostic methods for the discrimination between B19 vaccinated and infected cattle [3,4]. In addition to its lack of virulence, B19 can also be distinguished by its sensitivity to erythritol, a four carbon polyalcohol which is utilized by all Brucella isolates with the exception of B. ouis and some strains of B. canis [5]. The nature of the genetic changes responsible for these B19 properties is unknown. We have previously described an efficient method for transposon mutagenesis of B. abortus [6] and used it for the construction of a B. abortus mu-
tam sensitive to erythritol by means of Tn.5 transposition [7]. Cloning of the putative eri::Tn_5 region from the chromosome of that mutant allowed the design of gene probes that revealed a restriction fragment polymorphism in the vaccine strain B19 [7]. We report here the cloning of the eri region from the chromosome of B. abortus 2308 and from the vaccine strain B19, and their study by restriction analysis. This revealed the existence of a deletion affecting about 0.7 kb in the chromosome of the vaccine strain B19. We confirmed this finding by nucleotide sequence determination. The deletion in B19 could affect the genes encoding the erythritol dissimilative pathway and be responsible of its reported erythritol sensitivity. In addition this deletion provided a method to distinguish B19 strain of the rest of B. abortus isolates by the polymerase chain reaction amplification of this genomic region using an appropriate pair of primers.
Materials
and Methods
Bacterial strains, plasmids and growth conditions B. abortus strains 2308 and B19 have been already described. Strain 227 is an erythritol sensitive Tn5 insertion mutant of 2308 carrying Tn5 in the erythritol catabolic genes of 2308 (eri::TnS). [7]. Plasmid pSU6001 consists in a 13 kb EcoRI fragment containing the eri::Tn5 region from the chromosome of the B. abortus strain 227, cloned into the EcoRI site of pBluescript II SK + . A restriction map of plasmid pSU6001 has already been published [71 and is presented in the top of Fig. 1. Ampicillin resistant vector pBluescriptIISK + (Stratagene) and the kanamycin resistant vector pK18 [8] were used for the cloning experiments. Plasmid pKT231 is an IncQ mobilizable vector with broad host range [9] including Brucella as shown in this work. E. coli HBlOl (ara, lacy, leu, mtl, pro, thi, xyl, rpsL, hsdS20, recA13) was used thoroughly. E. coli cells were usually grown in L-broth or L-agar plates. Tryptose broth (TB) or agar (TA) (Difco) was used for B. abortus cultures. In selective media, nalidixic acid was used at 1.5 pg/ml and kanamycin at 50 pg/ml. i-Erythritol (Sigma) was added at 1 mg/ml to TA
plates to test the susceptibility of B. abortus and at 10 mg/ml to McConkey agar base (Difco) to test the ability to utilize erythritol by E. coli transformants.
Cloning of B. abortus chromosomal genes Chromosomal DNA from B. abortus was purified from stationary phase cultures after lysis with guanidinium thiocyanate basically as described [lo]. Appropriate DNA fragments from plasmid pSU6001 were labeled with dUTP-digoxigenin by a random priming method (Boehringer Mannheim) and used as probes in Southern blot hybridization experiments to identify the corresponding fragments from the chromosomes of B. abortus strains 2308 and B19. Chromosomal DNA from these strains was digested with restriction enzymes and fragments were size fractionated in agarose gels. DNA was eluted from gel pieces containing fragments of the appropriate sizes by absorption on glass powder (Geneclean, BiolOl) and ligated into linearized vectors. Plasmid DNA was isolated from recombinant clones by the alkaline lysis procedure [ll] and analyzed with restriction endonucleases. Plasmids containing inserts of correct size were screened by dot blot hybridization with the same probes used in the Southern blot experiments. Positive clones were selected for further work.
Conjugation to B. abortus B19 Plasmids derived from pKT231 were transferred from E. coli S17.1 [12] to a nalidixic acid resistant spontaneous mutant of B19 following a previously described filter mating procedure [61. Transconjugants were selected on TA plates supplemented with kanamycin and nalidixic acid.
Nucleotide sequence determination Nucleotide sequence was determined on double stranded plasmid DNA using the FemtoMol sequencing kit from Promega. To determine the B19 sequence, the 0.3 kb Bali fragment was cloned in the HincII site of pK18. DNA sequence was determined on both DNA strands using both standard and reverse Ml3 sequencing primers. The sequence of 2308 was determined from the plasmid pSU6004. Insertions of Tn1725 in the
339
227• pSU6001
2308• p S U 6 0 0 4
B19/pSU6020
E
H
E
HB
S
i
II
I
HB
S
I I t,
I
I
H
i
BhBH II
II
II
I m
I
CB B PNh I I
I
/
BhBB
II
BPNh I
I
H I
H
I
II
HC I I
HCBhNE t
I II
III
H I
C I
I i
1 kb
i s ,
Fig. 1. Restriction maps of D N A from the eri regions of 227 (top), 2308 (middle) and B19 (bottom). The black region in the pSU6001 insert represents Tn5. T h e open bar signals the 2.7-kb HindlII fragment used as probe in the cloning experiments. The dotted boxes in the pSU6004 and pSU6020 inserts signal the regions whose nucleotide sequence was determined. Key to restriction enzymes: B: Bali, C: Clal, E: EcoRI, h: Hincll, H: HindllI, N: NruI, P: PvuI, S: SspI.
Bali I00 TGGCCAT~CGA~GGGA~GTG~G~G~TATTATGTGGA~TGGTT~AAGA~TTTG~GATATTAT~G~GGAT~TTGG~GG~AAGTCCGTCGGTA~GCAG
20O TTTGCAATCTTCACCTATAAGGATTTCGATGATCCGGCGCGCCGCGAAGAACTTATCAAGATCGCCATCGACTGCTGGGCCGAGGTGGCCGAACATGCGG HindIII 300 CAGGT~CGGGCCT~G~TATGTGTT~TGGGAG~CGATGA~ATCGG~C+G~%AT~(~GCGA~CGATT~GAATGCATGAAGM~TTCA~GATCGG~TC~
4O0 CGCCGCTAACATGGCGATCCCCATGTGGATGATGGCCGATATCGACCATGGTGACGTGACATCCGCTAACCCGGACGACTACGATCCTTACGCATGGGCC 5OO CGCACCGTGCCGAAAGTCTCGCCCATCATCCATATCAAGCAAAGCCTGATGGACAAGGGCGGGCATCGTCCTTTCACAGCCGCGTTCAATGCCAAGGGCC 6OO GCATCCAGCCGGAACCGCTTTTGAAAGCCTTTGCCGACGGCGCGGTGGATAATGAAATCTGTCTTGAACTTTCGTTCAAGGAGCGCGAGCCGAACGACCG 7OO TGAAGTCATTCCACAGATTGCAGAAAGTGTGGCTTTCTGGGCGCCGCACATTGACACCGGCGCTAAGGACTTGAAGATATAGGAAATTTCCAGAACCGGA 800 CCGCGTTCAATC.GCAGATGCAGACGATTCTCTGGCGCTTCGCGCCGCCTGGCTTCATTTCGTCGCCGGCATGACTCAGTCTGCCGTTGCCAAGCGCCTTG ClaI 900
GC~TGCCTTCGGTGAAAGCGCATCGT~T~ATCG~CAAGGC~GT`~CCGACGG~G~GGTGAAAGTGAC~ATCGA~GGTGA~AT~ACCGAATG~ATC~.T~T Bali i000 GGAAAACCGTCTGG~CGATCTTTA~GG~CTCGATTATTG~GAGGTCGCA~GATATTGGCGA~AAGGCCTGCCGCTGATGGCGCTTGGcCATGCGGGC
1100 GCGAATTTCATGCGCCGCGAAATCGAACATGGCGATCATGAGGTCATCGGCATCGGCCATGGCCGCACACTTTCGGCAGCGGTTGGTTATATGCCGCGTG 1200 TCATGGCCAATGATCTGCGTTTCGTCTCGcTTCTGGGCGGCCTCACGCGCAATTTTGCCGCCAACCCGCATGACGTGATGCACCGCATCGCGGAAAAAAC
CGGAATG CCCG CTTATGTGATGC CGGTGC CCTTCTTCGC CAATACGGCGGAAGAC CGCGAAGTGCTGCTGG
Fig. 2. Nucleotide sequence of part of the eri region from the chromosome of B. abortus 2308. The sequence of the B19 chromosome between the two marked Bali sites was also determined. T h e 702 bp between positions 263 and 964 were missing in this sequence. T h e open boxes mark the position of two direct repeats probably involved in the genesis of this deletion. T h e oligonucleotides chosen as primers for the P C R reaction are underlined. These sequences have been deposited in the E M B L and G e n B a n k databases u n d e r accession n u m b e r s X78881 (for the 2308 sequence) and X78882 (for the B19 sequence).
340
cloned fragment were obtained as described [13] and the sequence was determined on both DNA strands using as primers the oligonucleotides GAGCTGTCACGAGAACACCG and CCCTTACGGATGCCCGGAAA taken from each end of the transposon.
was introduced by transformation in E. coli HBlOl. Transformed E. coli cells formed red colonies on erythritol supplemented McConkey agar base plates. Parental E. coli HBlOl formed white colonies on the same medium. A deletion in the eri region of B19
Polymerase chain reaction
About 100 ng of purified chromosomal DNA were used in 100 ~1 amplification reactions with the primers described below. Polymerase chain reaction (PCR) conditions were 30 cycles consisting in 94°C for 1 min, 59°C for 30 s and 72°C for 30 s. PCR products were analyzed in 1% agarose gels.
3. Results Cloning of the eri region from the chromosome of B. abortus strains 2308 and B19 A 2.7 kb Hind111 DNA fragment of Brucella
genomic DNA from pSU6001 (Fig. l), was used as a probe in a Southern blot experiment. This procedure identified a 7.75 EcoRI DNA fragment in the chromosome of the B. abortus strain 2308. This EcoRI fragment was cloned into pBluescriptII-SK + . The resulting plasmid, called pSU6004, was analyzed by restriction endonucleases and its map is shown in Fig. 1. The same probe identified a 5.1 kb Hind111 fragment in the B19 chromosome. This DNA fragment was cloned in pK18. The resulting plasmid was called pSU6020. A restriction map of this plasmid is also shown in Fig. 1. The 7.75 kb DNA EcoRl fragment in pSU6004 contained genes for erythritol catabolism The 7.75 kb EcoRI fragment from B. abortus 2308 chromosome present in plasmid pSU6004
was cloned in the plasmid pKT231. The resulting plasmid, called pSU6010, was introduced by conjugation into the erythritol sensitive strains B19 and 227. The transconjugants containing pSU6010 could grow equally well in TA plates with and without erythritol while the growth of plasmidfree strains was completely inhibited in erythritol containing plates. In addition, plasmid pSU6004
Comparative analysis of the restriction maps of eri regions from 2308 and B19 shown in Fig. 1
suggested that there was a deletion in the B19 chromosome spanning about 1 kb including at least a C/a1 and a Hind111 site. To demonstrate this possibility we determined the nucleotide sequence of the 0.3 kb Bali DNA fragment from the B19 chromosome and of the corresponding region from the B. abortus 2308 chromosome (Fig. 1). Upon comparison of both sequences it was evident that they were identical except for the existence of a 702 bp gap between them (Fig. 2). Two short repeated sequences were found in the 2308 chromosome flanking the sequence missing in B19. These repeats could be either seen as perfect 8 base repeats (TTGGCGAG) or imperfect (11/13) repeats (CGAatTTGGCGAG and
12
3 4 5 6 7
891011
Fig. 3. Agarose gel of the products of the amplification of chromosomal DNA from several B. abortus strains belonging to different biovars with the primers described in the text. Lane 2: B19; lane 3: 2308 (biovar 1); lane 4: 544 (biovar 1); lane 5: 86/8/59 (biovar 2); lane 6: Tulya (biovar 3); lane 7: 292 (biovar 4); lane 8: B3196 (biovar 5); lane 9: 870 (biovar 6). Lane 10 contains the amplification products obtained when the same amount of E. coli DNA was used as substrate as a negative control. Lanes 1 and 11 contain Hue111 digested @X174 DNA as molecular mass marker. Sizes of visible bands are 1353,1078,872,603 and 310 bp.
341
C G A t a T T G G C G A G ) . These repetitions could account for the mechanism of deletion formation in the B19 strain. PCR amplification of the eri region Two oligonucleotides were designed from the D N A sequence of B. abortus 2308, one to each side of the endpoints of the deletion found in B19. They were used as primers for amplification of genomic D N A from several B. abortus strains. Oligo 1 was a 20 mer comprised between positions 75 and 94 T T G G C G G C A A G T C C G T C G G T and oligo 2, also a 20 mer, was comprised between positions 1137 and 1118 on the complementary strand: C C C A G A A G C G A G A C G A A ACG. As expected these primers sustained the specific amplification of a 1,063 bp fragment from strain 2308 and a 361 bp fragment from strain B19 We tested in this way other pathogenic B. abortus strains representing several different biovars which always showed the 1 kb amplification fragment (Fig. 3).
Discussion
Erythritol utilization is a hallmark of the genus Brucella. The B. abortus vaccine strain B19 has lost the capability to utilize erythritol. The catabolic pathway for erythritol in B. abortus was determined some time ago [14]. It was also found that the vaccine strain B19 was defective in one of the enzymes of the pathway (D-erythrulose 1-P dehydrogenase). This defect blocks erythritol degradation and results in both accumulation of the toxic intermediate D-erythrulose 1-P and depletion of ATP levels by the activity of erythritol kinase. This is thought to be the basis of the sensitivity to erythritol of B19 [15]. By means of T n 5 insertion mutagenesis we obtained a B. abortus 2308 derivative which was sensitive to erythritol. This mutant allowed us the cloning of an EcoRI chromosomal fragment presumably involved in erythritol catabolism in B. abortus. Plasmid pSU6004, which contained that fragment, was able to trans-complement the erythritol sensitivity of B19 and 227. In addition, this plasmid rendered E. coli cells able to utilize erythritol,
since they produced red colonies on McConkey agar base plates supplemented with erythritol. We can then conclude that erythritol catabolic genes were present in plasmid pSU6004. However, we cannot establish at this point if the insert in plasmid pSU6004 contains the genes for the whole erythritol catabolic pathway or only a part of it. At least, it should contain the gene for the o-erythrulose 1-P dehydrogenase (this activity is absent in B19), and it should encode enough enzymatic activities to transform erythritol in a compound able to be metabolized by E. coli cells. The analysis of the coding capacity of the sequence presented in Fig. 2 does not make this point any clearer. Current investigation in our laboratory focuses on the characterization of genes for the erythritol catabolic pathway in B. abortus. The sequence data provided in this paper in addition to confirming previous results on the presence of a polymorphism in B. abortus B19 [7] further identified a deletion in its chromosome. This deletion could explain the defective erythritol phenotype of B19 since it would inactivate at least one of the genes of the erythritol catabolic pathway. On the other hand, deletions are frequent among spontaneous mutations in bacteria and it has been well established that deletion endpoints tend to occur in short direct repeats. The observed sequence gap could be nicely explained as a deletion occurred by template slippage at the reported direct repeats during chromosome replication [16]. A few inverted repeats have also been found inside the deleted region. Annealing of these palindromic sequences in single stranded D N A would help the slippage between the directed repeats, resulting in deletion formation [17]. The presence of a deletion in B19 has been easily made evident by means of PCR amplification using a pair of flanking oligonucleotides. The application of this method on a group of representative B. abortus isolates indicated that this deletion occurs only in B19. This finding, if confirmed by a more extensive screening, would provide a fast and reliable diagnostic method to differentiate B19 from all the other members of the genus Brucella. Such a diagnostic test would
342
be very valuable as a fast, easy method for B19 identification and could help in quality control of vaccine production as well as to solve some of the problems posed by the use of this live vaccine in the control of bovine brucellosis.
Acknowledgments
This work has been supported with grants GAN89/0223 and BI093-1187-C03-02 from the Plan national de I + D. Comision Interministerial de Ciencia y Tecnologia (CICYT). F.J.S. was recipient of a fellowship from the Plan National de Formation de1 Personal Investigador. We thank to M. Llosa for reading and correcting the manuscript.
9
10
11
References 1 Graves, R.R. (1943) The story of John M. Buck’s and Matilda’s contribution to the cattle industry. J. Am. Vet. Med. Assoc. 102, 193-195. 2 Nicoletti, P. (1981) Prevalence and persistence of Brucella abortus strain 19 infections and prevalence of other biotypes in vaccinated adult dairy cattle. J. Am. Vet. Med. Assoc. 178, 143-145. 3 Diaz, R., Gareta, P., Jones L.M. and Moriyon, I. (1979) Radial immunodiffusion test with a Brucella polysaccharide antigen for differentiating infected from vaccinated cattle. J. Clin. Microbial. 10, 37-41. 4 Nielsen, K., Cherwonogrodzky, J.W., Duncan, J.R. and Bundle, D.R.. (1989) Enzyme-linked immunoabsorbent assay for differentiation of the antibody response of cattle naturally infected with Brucella abortus or vaccinated with strain 19. Am. J. Vet. Res. 50, 5-9.
12
13
14 15
16
17
Corbel, M.J. and Brinley-Morgan, W.J. (1984) Genus Brucella, In: Bergey’s manual of systematic bacteriology, vol. 1 (Krieg, N.R. and Holt, J.G., Eds), pp. 377-388, Williams and Wilkins Co., Baltimore MD. Sangari, F.J., and Agiiero, J. (1991) Mutagenesis of Brucella abortus, Comparative efficiency of three transposon delivery systems. Microbial Pathogenesis 11, 443-446. Sangari, F.J. and Agiiero, J. (1994) Identification of Brzcella abortus B19 vaccine strain by the detection of DNA polymorphism at the en’ locus. Vaccine 12, 435-438. Pridmore, R.D. (19871 New and versatile cloning vectors with kanamycin-resistance marker. Gene 56, 309-312. Bagdasarian, M., Lurz, R., Riickert, B., Franklin, F.C.H., Bagdasarian, M.M., Frey, J. and Timmis, K.N. (1981) Specific-purpose plasmid cloning vectors. II. Broad host range, high copy number, RSFlOlO-derived vectors, and a host-vector system for gene cloning in Pseudomonas. Gene 16, 237-247. Pitcher, D.G., Saunders, N.A. and Owen, R.J. (1989) Rapid extraction of genomic DNA with guanidinium thiocyanate. Lett. Appl. Microbial. 8, 151-156. Ish-Horowitz, D. and Burke, J.F. (1981) Rapid and efficient cosmid cloning. Nucl. Acids Res. 9, 2989-2998. Simon, R., Priefer, U. and Piihler, A. (1983) A broad host range mobilization system for in uico genetic engineering, transposon mutagenesis in gram negative bacteria. Bio/Technology 1, 784-791. Ubben, D. and Schmitt, R. (1986) Tn1721 derivatives for transposon mutagenesis, restriction mapping and nucleotide sequence analysis. Gene 41, 141-152. Sperry, J.F. and Robertson, D.C. (19751 Erythritol catabolism by Brucella abortus. J. Bacterial. 121, 619-630. Sperry, J.F. and Robertson, D.C. (1975) Inhibition of growth by erythritol catabolism in Brucella abortus. J. Bacterial. 124, 391-397. Weston-Hafer, K. and Berg, D. (1991) Deletions in plasmid pBR322; Replication slippage involving leading and lagging strands. Genetics 127, 649-655. Albertini, A.M., Hofer, M., Calos, M.P. and Miller, J.H. (1982) On the formation of spontaneous deletions, the importance of short sequence homologies in the generation of large deletions. Cell 29, 319-328.
337
F E M S L E 06138
The Brucella abortus vaccine strain B19 carries a deletion in the erythritol catabolic genes F61ix J. Sangari, J u a n M. G a r c l a - L o b o * a n d Jesfis A g i l e r o Departamento de Biologla Molecular, Facultad de Medicina, Unit,ersidad de Cantabria, Polfgono de Cazofia s / n. 39011, Santander, Spain
Received 27 June 1994; accepted 4 July 1994
Abstract: Brucella abortus B19, an avirulent strain obtained by spontaneous mutation, is used worldwide as a vaccine for the control of bovine brucellosis. B19 differs from other B. abortus strains in its sensitivity to erythritol. We took advantage of a previously obtained erythritol sensitive T n 5 insertion mutant of B. abortus 2308 to clone the chromosomal region containing erythritol catabolic genes from this representative pathogenic strain and from the vaccine strain B19. Physical mapping with restriction endonucleases and nucleotide sequence determination revealed the existence of a 702 bp long deletion, occurring between two short direct repeats, in the chromosome of B19. This deletion rendered the B19 strain sensitive to erythritol. Two oligonucleotides whose sequences flank this deletion provided an easy method to differentiate B19 from all other B. abortus isolates. Key words: Brucella abortus B19; Erythritol; Polymerase chain reaction
Introduction Brucella abortus is one of the main causes of cattle disease worldwide. Infection with this organism usually results in abortion and eventually can also produce human disease, resulting in undulant fever and many other unrelated symptoms. Control of B. abortus infection in cattle is usually done by vaccination with the attenuated B. abortus strain B19. This vaccine was obtained after serial subculture of a pathogenic B. abortus strain under laboratory conditions [1]. B19 is non-pathogenic and usually produces a protective
* Corresponding author. Tel: + 34(42)201948; + 34(42)201945; email: [email protected].
SSDI 0 3 7 8 - 1 0 9 7 ( 9 4 ) 0 0 2 8 8 - 6
Fax:
immune response in vaccinated animals. However B19 offers several disadvantages as a low frequency of persistence when used on adult animals [2]. This causes some interference with serologic diagnostic tests for bovine brucellosis, in spite of the existence of serodiagnostic methods for the discrimination between B19 vaccinated and infected cattle [3,4]. In addition to its lack of virulence, B19 can also be distinguished by its sensitivity to erythritol, a four carbon polyalcohol which is utilized by all Brucella isolates with the exception of B. ouis and some strains of B. canis [5]. The nature of the genetic changes responsible for these B19 properties is unknown. We have previously described an efficient method for transposon mutagenesis of B. abortus [6] and used it for the construction of a B. abortus mu-
tam sensitive to erythritol by means of Tn.5 transposition [7]. Cloning of the putative eri::Tn_5 region from the chromosome of that mutant allowed the design of gene probes that revealed a restriction fragment polymorphism in the vaccine strain B19 [7]. We report here the cloning of the eri region from the chromosome of B. abortus 2308 and from the vaccine strain B19, and their study by restriction analysis. This revealed the existence of a deletion affecting about 0.7 kb in the chromosome of the vaccine strain B19. We confirmed this finding by nucleotide sequence determination. The deletion in B19 could affect the genes encoding the erythritol dissimilative pathway and be responsible of its reported erythritol sensitivity. In addition this deletion provided a method to distinguish B19 strain of the rest of B. abortus isolates by the polymerase chain reaction amplification of this genomic region using an appropriate pair of primers.
Materials
and Methods
Bacterial strains, plasmids and growth conditions B. abortus strains 2308 and B19 have been already described. Strain 227 is an erythritol sensitive Tn5 insertion mutant of 2308 carrying Tn5 in the erythritol catabolic genes of 2308 (eri::TnS). [7]. Plasmid pSU6001 consists in a 13 kb EcoRI fragment containing the eri::Tn5 region from the chromosome of the B. abortus strain 227, cloned into the EcoRI site of pBluescript II SK + . A restriction map of plasmid pSU6001 has already been published [71 and is presented in the top of Fig. 1. Ampicillin resistant vector pBluescriptIISK + (Stratagene) and the kanamycin resistant vector pK18 [8] were used for the cloning experiments. Plasmid pKT231 is an IncQ mobilizable vector with broad host range [9] including Brucella as shown in this work. E. coli HBlOl (ara, lacy, leu, mtl, pro, thi, xyl, rpsL, hsdS20, recA13) was used thoroughly. E. coli cells were usually grown in L-broth or L-agar plates. Tryptose broth (TB) or agar (TA) (Difco) was used for B. abortus cultures. In selective media, nalidixic acid was used at 1.5 pg/ml and kanamycin at 50 pg/ml. i-Erythritol (Sigma) was added at 1 mg/ml to TA
plates to test the susceptibility of B. abortus and at 10 mg/ml to McConkey agar base (Difco) to test the ability to utilize erythritol by E. coli transformants.
Cloning of B. abortus chromosomal genes Chromosomal DNA from B. abortus was purified from stationary phase cultures after lysis with guanidinium thiocyanate basically as described [lo]. Appropriate DNA fragments from plasmid pSU6001 were labeled with dUTP-digoxigenin by a random priming method (Boehringer Mannheim) and used as probes in Southern blot hybridization experiments to identify the corresponding fragments from the chromosomes of B. abortus strains 2308 and B19. Chromosomal DNA from these strains was digested with restriction enzymes and fragments were size fractionated in agarose gels. DNA was eluted from gel pieces containing fragments of the appropriate sizes by absorption on glass powder (Geneclean, BiolOl) and ligated into linearized vectors. Plasmid DNA was isolated from recombinant clones by the alkaline lysis procedure [ll] and analyzed with restriction endonucleases. Plasmids containing inserts of correct size were screened by dot blot hybridization with the same probes used in the Southern blot experiments. Positive clones were selected for further work.
Conjugation to B. abortus B19 Plasmids derived from pKT231 were transferred from E. coli S17.1 [12] to a nalidixic acid resistant spontaneous mutant of B19 following a previously described filter mating procedure [61. Transconjugants were selected on TA plates supplemented with kanamycin and nalidixic acid.
Nucleotide sequence determination Nucleotide sequence was determined on double stranded plasmid DNA using the FemtoMol sequencing kit from Promega. To determine the B19 sequence, the 0.3 kb Bali fragment was cloned in the HincII site of pK18. DNA sequence was determined on both DNA strands using both standard and reverse Ml3 sequencing primers. The sequence of 2308 was determined from the plasmid pSU6004. Insertions of Tn1725 in the
339
227• pSU6001
2308• p S U 6 0 0 4
B19/pSU6020
E
H
E
HB
S
i
II
I
HB
S
I I t,
I
I
H
i
BhBH II
II
II
I m
I
CB B PNh I I
I
/
BhBB
II
BPNh I
I
H I
H
I
II
HC I I
HCBhNE t
I II
III
H I
C I
I i
1 kb
i s ,
Fig. 1. Restriction maps of D N A from the eri regions of 227 (top), 2308 (middle) and B19 (bottom). The black region in the pSU6001 insert represents Tn5. T h e open bar signals the 2.7-kb HindlII fragment used as probe in the cloning experiments. The dotted boxes in the pSU6004 and pSU6020 inserts signal the regions whose nucleotide sequence was determined. Key to restriction enzymes: B: Bali, C: Clal, E: EcoRI, h: Hincll, H: HindllI, N: NruI, P: PvuI, S: SspI.
Bali I00 TGGCCAT~CGA~GGGA~GTG~G~G~TATTATGTGGA~TGGTT~AAGA~TTTG~GATATTAT~G~GGAT~TTGG~GG~AAGTCCGTCGGTA~GCAG
20O TTTGCAATCTTCACCTATAAGGATTTCGATGATCCGGCGCGCCGCGAAGAACTTATCAAGATCGCCATCGACTGCTGGGCCGAGGTGGCCGAACATGCGG HindIII 300 CAGGT~CGGGCCT~G~TATGTGTT~TGGGAG~CGATGA~ATCGG~C+G~%AT~(~GCGA~CGATT~GAATGCATGAAGM~TTCA~GATCGG~TC~
4O0 CGCCGCTAACATGGCGATCCCCATGTGGATGATGGCCGATATCGACCATGGTGACGTGACATCCGCTAACCCGGACGACTACGATCCTTACGCATGGGCC 5OO CGCACCGTGCCGAAAGTCTCGCCCATCATCCATATCAAGCAAAGCCTGATGGACAAGGGCGGGCATCGTCCTTTCACAGCCGCGTTCAATGCCAAGGGCC 6OO GCATCCAGCCGGAACCGCTTTTGAAAGCCTTTGCCGACGGCGCGGTGGATAATGAAATCTGTCTTGAACTTTCGTTCAAGGAGCGCGAGCCGAACGACCG 7OO TGAAGTCATTCCACAGATTGCAGAAAGTGTGGCTTTCTGGGCGCCGCACATTGACACCGGCGCTAAGGACTTGAAGATATAGGAAATTTCCAGAACCGGA 800 CCGCGTTCAATC.GCAGATGCAGACGATTCTCTGGCGCTTCGCGCCGCCTGGCTTCATTTCGTCGCCGGCATGACTCAGTCTGCCGTTGCCAAGCGCCTTG ClaI 900
GC~TGCCTTCGGTGAAAGCGCATCGT~T~ATCG~CAAGGC~GT`~CCGACGG~G~GGTGAAAGTGAC~ATCGA~GGTGA~AT~ACCGAATG~ATC~.T~T Bali i000 GGAAAACCGTCTGG~CGATCTTTA~GG~CTCGATTATTG~GAGGTCGCA~GATATTGGCGA~AAGGCCTGCCGCTGATGGCGCTTGGcCATGCGGGC
1100 GCGAATTTCATGCGCCGCGAAATCGAACATGGCGATCATGAGGTCATCGGCATCGGCCATGGCCGCACACTTTCGGCAGCGGTTGGTTATATGCCGCGTG 1200 TCATGGCCAATGATCTGCGTTTCGTCTCGcTTCTGGGCGGCCTCACGCGCAATTTTGCCGCCAACCCGCATGACGTGATGCACCGCATCGCGGAAAAAAC
CGGAATG CCCG CTTATGTGATGC CGGTGC CCTTCTTCGC CAATACGGCGGAAGAC CGCGAAGTGCTGCTGG
Fig. 2. Nucleotide sequence of part of the eri region from the chromosome of B. abortus 2308. The sequence of the B19 chromosome between the two marked Bali sites was also determined. T h e 702 bp between positions 263 and 964 were missing in this sequence. T h e open boxes mark the position of two direct repeats probably involved in the genesis of this deletion. T h e oligonucleotides chosen as primers for the P C R reaction are underlined. These sequences have been deposited in the E M B L and G e n B a n k databases u n d e r accession n u m b e r s X78881 (for the 2308 sequence) and X78882 (for the B19 sequence).
340
cloned fragment were obtained as described [13] and the sequence was determined on both DNA strands using as primers the oligonucleotides GAGCTGTCACGAGAACACCG and CCCTTACGGATGCCCGGAAA taken from each end of the transposon.
was introduced by transformation in E. coli HBlOl. Transformed E. coli cells formed red colonies on erythritol supplemented McConkey agar base plates. Parental E. coli HBlOl formed white colonies on the same medium. A deletion in the eri region of B19
Polymerase chain reaction
About 100 ng of purified chromosomal DNA were used in 100 ~1 amplification reactions with the primers described below. Polymerase chain reaction (PCR) conditions were 30 cycles consisting in 94°C for 1 min, 59°C for 30 s and 72°C for 30 s. PCR products were analyzed in 1% agarose gels.
3. Results Cloning of the eri region from the chromosome of B. abortus strains 2308 and B19 A 2.7 kb Hind111 DNA fragment of Brucella
genomic DNA from pSU6001 (Fig. l), was used as a probe in a Southern blot experiment. This procedure identified a 7.75 EcoRI DNA fragment in the chromosome of the B. abortus strain 2308. This EcoRI fragment was cloned into pBluescriptII-SK + . The resulting plasmid, called pSU6004, was analyzed by restriction endonucleases and its map is shown in Fig. 1. The same probe identified a 5.1 kb Hind111 fragment in the B19 chromosome. This DNA fragment was cloned in pK18. The resulting plasmid was called pSU6020. A restriction map of this plasmid is also shown in Fig. 1. The 7.75 kb DNA EcoRl fragment in pSU6004 contained genes for erythritol catabolism The 7.75 kb EcoRI fragment from B. abortus 2308 chromosome present in plasmid pSU6004
was cloned in the plasmid pKT231. The resulting plasmid, called pSU6010, was introduced by conjugation into the erythritol sensitive strains B19 and 227. The transconjugants containing pSU6010 could grow equally well in TA plates with and without erythritol while the growth of plasmidfree strains was completely inhibited in erythritol containing plates. In addition, plasmid pSU6004
Comparative analysis of the restriction maps of eri regions from 2308 and B19 shown in Fig. 1
suggested that there was a deletion in the B19 chromosome spanning about 1 kb including at least a C/a1 and a Hind111 site. To demonstrate this possibility we determined the nucleotide sequence of the 0.3 kb Bali DNA fragment from the B19 chromosome and of the corresponding region from the B. abortus 2308 chromosome (Fig. 1). Upon comparison of both sequences it was evident that they were identical except for the existence of a 702 bp gap between them (Fig. 2). Two short repeated sequences were found in the 2308 chromosome flanking the sequence missing in B19. These repeats could be either seen as perfect 8 base repeats (TTGGCGAG) or imperfect (11/13) repeats (CGAatTTGGCGAG and
12
3 4 5 6 7
891011
Fig. 3. Agarose gel of the products of the amplification of chromosomal DNA from several B. abortus strains belonging to different biovars with the primers described in the text. Lane 2: B19; lane 3: 2308 (biovar 1); lane 4: 544 (biovar 1); lane 5: 86/8/59 (biovar 2); lane 6: Tulya (biovar 3); lane 7: 292 (biovar 4); lane 8: B3196 (biovar 5); lane 9: 870 (biovar 6). Lane 10 contains the amplification products obtained when the same amount of E. coli DNA was used as substrate as a negative control. Lanes 1 and 11 contain Hue111 digested @X174 DNA as molecular mass marker. Sizes of visible bands are 1353,1078,872,603 and 310 bp.
341
C G A t a T T G G C G A G ) . These repetitions could account for the mechanism of deletion formation in the B19 strain. PCR amplification of the eri region Two oligonucleotides were designed from the D N A sequence of B. abortus 2308, one to each side of the endpoints of the deletion found in B19. They were used as primers for amplification of genomic D N A from several B. abortus strains. Oligo 1 was a 20 mer comprised between positions 75 and 94 T T G G C G G C A A G T C C G T C G G T and oligo 2, also a 20 mer, was comprised between positions 1137 and 1118 on the complementary strand: C C C A G A A G C G A G A C G A A ACG. As expected these primers sustained the specific amplification of a 1,063 bp fragment from strain 2308 and a 361 bp fragment from strain B19 We tested in this way other pathogenic B. abortus strains representing several different biovars which always showed the 1 kb amplification fragment (Fig. 3).
Discussion
Erythritol utilization is a hallmark of the genus Brucella. The B. abortus vaccine strain B19 has lost the capability to utilize erythritol. The catabolic pathway for erythritol in B. abortus was determined some time ago [14]. It was also found that the vaccine strain B19 was defective in one of the enzymes of the pathway (D-erythrulose 1-P dehydrogenase). This defect blocks erythritol degradation and results in both accumulation of the toxic intermediate D-erythrulose 1-P and depletion of ATP levels by the activity of erythritol kinase. This is thought to be the basis of the sensitivity to erythritol of B19 [15]. By means of T n 5 insertion mutagenesis we obtained a B. abortus 2308 derivative which was sensitive to erythritol. This mutant allowed us the cloning of an EcoRI chromosomal fragment presumably involved in erythritol catabolism in B. abortus. Plasmid pSU6004, which contained that fragment, was able to trans-complement the erythritol sensitivity of B19 and 227. In addition, this plasmid rendered E. coli cells able to utilize erythritol,
since they produced red colonies on McConkey agar base plates supplemented with erythritol. We can then conclude that erythritol catabolic genes were present in plasmid pSU6004. However, we cannot establish at this point if the insert in plasmid pSU6004 contains the genes for the whole erythritol catabolic pathway or only a part of it. At least, it should contain the gene for the o-erythrulose 1-P dehydrogenase (this activity is absent in B19), and it should encode enough enzymatic activities to transform erythritol in a compound able to be metabolized by E. coli cells. The analysis of the coding capacity of the sequence presented in Fig. 2 does not make this point any clearer. Current investigation in our laboratory focuses on the characterization of genes for the erythritol catabolic pathway in B. abortus. The sequence data provided in this paper in addition to confirming previous results on the presence of a polymorphism in B. abortus B19 [7] further identified a deletion in its chromosome. This deletion could explain the defective erythritol phenotype of B19 since it would inactivate at least one of the genes of the erythritol catabolic pathway. On the other hand, deletions are frequent among spontaneous mutations in bacteria and it has been well established that deletion endpoints tend to occur in short direct repeats. The observed sequence gap could be nicely explained as a deletion occurred by template slippage at the reported direct repeats during chromosome replication [16]. A few inverted repeats have also been found inside the deleted region. Annealing of these palindromic sequences in single stranded D N A would help the slippage between the directed repeats, resulting in deletion formation [17]. The presence of a deletion in B19 has been easily made evident by means of PCR amplification using a pair of flanking oligonucleotides. The application of this method on a group of representative B. abortus isolates indicated that this deletion occurs only in B19. This finding, if confirmed by a more extensive screening, would provide a fast and reliable diagnostic method to differentiate B19 from all the other members of the genus Brucella. Such a diagnostic test would
342
be very valuable as a fast, easy method for B19 identification and could help in quality control of vaccine production as well as to solve some of the problems posed by the use of this live vaccine in the control of bovine brucellosis.
Acknowledgments
This work has been supported with grants GAN89/0223 and BI093-1187-C03-02 from the Plan national de I + D. Comision Interministerial de Ciencia y Tecnologia (CICYT). F.J.S. was recipient of a fellowship from the Plan National de Formation de1 Personal Investigador. We thank to M. Llosa for reading and correcting the manuscript.
9
10
11
References 1 Graves, R.R. (1943) The story of John M. Buck’s and Matilda’s contribution to the cattle industry. J. Am. Vet. Med. Assoc. 102, 193-195. 2 Nicoletti, P. (1981) Prevalence and persistence of Brucella abortus strain 19 infections and prevalence of other biotypes in vaccinated adult dairy cattle. J. Am. Vet. Med. Assoc. 178, 143-145. 3 Diaz, R., Gareta, P., Jones L.M. and Moriyon, I. (1979) Radial immunodiffusion test with a Brucella polysaccharide antigen for differentiating infected from vaccinated cattle. J. Clin. Microbial. 10, 37-41. 4 Nielsen, K., Cherwonogrodzky, J.W., Duncan, J.R. and Bundle, D.R.. (1989) Enzyme-linked immunoabsorbent assay for differentiation of the antibody response of cattle naturally infected with Brucella abortus or vaccinated with strain 19. Am. J. Vet. Res. 50, 5-9.
12
13
14 15
16
17
Corbel, M.J. and Brinley-Morgan, W.J. (1984) Genus Brucella, In: Bergey’s manual of systematic bacteriology, vol. 1 (Krieg, N.R. and Holt, J.G., Eds), pp. 377-388, Williams and Wilkins Co., Baltimore MD. Sangari, F.J., and Agiiero, J. (1991) Mutagenesis of Brucella abortus, Comparative efficiency of three transposon delivery systems. Microbial Pathogenesis 11, 443-446. Sangari, F.J. and Agiiero, J. (1994) Identification of Brzcella abortus B19 vaccine strain by the detection of DNA polymorphism at the en’ locus. Vaccine 12, 435-438. Pridmore, R.D. (19871 New and versatile cloning vectors with kanamycin-resistance marker. Gene 56, 309-312. Bagdasarian, M., Lurz, R., Riickert, B., Franklin, F.C.H., Bagdasarian, M.M., Frey, J. and Timmis, K.N. (1981) Specific-purpose plasmid cloning vectors. II. Broad host range, high copy number, RSFlOlO-derived vectors, and a host-vector system for gene cloning in Pseudomonas. Gene 16, 237-247. Pitcher, D.G., Saunders, N.A. and Owen, R.J. (1989) Rapid extraction of genomic DNA with guanidinium thiocyanate. Lett. Appl. Microbial. 8, 151-156. Ish-Horowitz, D. and Burke, J.F. (1981) Rapid and efficient cosmid cloning. Nucl. Acids Res. 9, 2989-2998. Simon, R., Priefer, U. and Piihler, A. (1983) A broad host range mobilization system for in uico genetic engineering, transposon mutagenesis in gram negative bacteria. Bio/Technology 1, 784-791. Ubben, D. and Schmitt, R. (1986) Tn1721 derivatives for transposon mutagenesis, restriction mapping and nucleotide sequence analysis. Gene 41, 141-152. Sperry, J.F. and Robertson, D.C. (19751 Erythritol catabolism by Brucella abortus. J. Bacterial. 121, 619-630. Sperry, J.F. and Robertson, D.C. (1975) Inhibition of growth by erythritol catabolism in Brucella abortus. J. Bacterial. 124, 391-397. Weston-Hafer, K. and Berg, D. (1991) Deletions in plasmid pBR322; Replication slippage involving leading and lagging strands. Genetics 127, 649-655. Albertini, A.M., Hofer, M., Calos, M.P. and Miller, J.H. (1982) On the formation of spontaneous deletions, the importance of short sequence homologies in the generation of large deletions. Cell 29, 319-328.