The C. elegans unc-18 gene encodes a protein expressed in motor neurons

Neuron,

Vol. 11, 703-711,

October,

1993, Copyright

0 1993 by Cell Press

The C. elegans mc-78 Gene Encodes a Protein Expressed in Motor Neurons Keiko Cengyo-Ando,*+ Yasuko Kamiya,+ Ayanori Yamakawa,* Ken-ichi KodairaJl Kiyoji Nishiwaki,# Johji Miwa,# lsao Hori,*§ and Ryuji Hosono* *Department of Biochemistry School of Medicine Kanazawa University Kanazawa *Department of Biochemistry SDepartment of Biology Kanazawa Medical University Uchinada IlDepartment of Technology Toyama University Toyama #Fundamental Research Laboratories NEC Corporation Tsukuba Japan

Summary The C. elegans uric-78 gene is required to maintain normal acetylcholine levels. We determined the complete structure of an uric-18 cDNA that encodes a protein of 591 highly charged and hydrophilic amino acids. The protein shows sequence similarity with elements of the secretory pathway in the yeast S. cerevisiae. Antibodies raised against a portion of the uric-18-encoded protein (UNC-18) detected a 68 kd soluble antigen on immunoblots and intensely stained all ventral cord motor neurons in situ. These findings suggest that UNC-18 participates in the axonal transport system and influences the acetylcholine flow in motor neurons.

choline acetyltransferase (ChAT) (Rand and Russell, 1984); ace-l, ace-2, and ace-3, structural genes for acetylcholinesterase (Culotti et al., 1981; Johnson et al., 1988; Kamiya et al., 1993); and uric-29, uric-38, and lev1, structural genes for potential ACh receptors (Lewis et al., 1987; J. Lewis, personal communication). To identify the genes affecting ACh levels, we screened available uncoordinated Cum) mutants and found seven such genes: uric-II, uric-13, uric-17, unc18, uric-41, uric-63, and uric-64 (Hosono et al., 1987, 1989,1992; Hosono and Kamiya, 1991). In addition to the abnormal accumulation of ACh, these mutants possess common phenotypes: resistance to acetylcholinesterase inhibitors, uncoordinated movement, retardation of postembryonic development, and small body size in adulthood. These results suggest that mutants in these genes are defective in overlapping functions. These genes raise several genetic, developmental, and molecular questions concerning the temporal and spatial expression of their gene products and their actions in establishing and maintaining a differentiated cellular state. Our previous biochemical findings have suggested that uric-78 plays a key role in the specification of ACh levels. Mutations in uric-78 result in a severely uncoordinated phenotype. The uric-78 gene was cloned and shown to encode a single protein (Hosono et al., 1992). In this study, we determined the complete structure of the uric-78 cDNA. It encodes a protein homologous to the yeast proteins that participate in protein, vacuole, and/or vesicle transport (Aalto et al., 1992). We prepared and characterized antibodies against a synthetic peptide corresponding to a portion of UNC-18 and localized UNC-18 by means of indirect immunofluorescence. The roles of UNC-18 are discussed in relation to ACh transport.

Introduction Results Neurotransmitters play an important role in synaptic transmission. The flow of neurotransmitters involves several steps including synthesis, axonal transport, storage and release at a synaptic terminal, receptor binding,and hydrolysis(Dunant,1986). However, how these steps are regulated remains to be determined. Mutants lacking single elements of these steps could be used to study the regulatory mechanisms of transmitter flow, because mutations in genes involved in these steps would affect the transmitter levels. Caenorhabditis elegans cholinergic neurons are useful for such studies, since several genes related to acetylcholine (ACh) metabolism have been identified and characterized. These include &a-?, a structural gene for +Present address: Laboratory of Molecular Oncology, Life Science Center, Institute of Physical and Chemical Koyadai, Tsukuba, lbaraki 305, Japan.

Tsukuba Research

Sequence Analysis of the 5’ End of an uric-18 cDNA Although uric-78 genomic DNA covering the entire coding region has already been sequenced, our largest cDNA lacked about one-third of the full-length at the 5’ end (Hosono et al., 1992). To determine the entire coding sequence, oligonucleotide primers were prepared, based on the genomic sequence and its predicted exon-intron structures (Figure IA). Poly(A)’ RNAs were reverse transcribed, using oligo 1 as the primer, and amplified by polymerase chain reaction (PCR) using oligos 2 and 5. The PCR product, campA, was subsequently cloned and sequenced, revealing exons II-V, which were deduced from the uric-78 genomic sequence. Because all cDNAs contained part of the SLI sequence (lTGAG) at the Sterminus, when cDNAs were synthesized with oligo 1 as a primer and amplified by inverse PCR (Maniatis et al., 1989) using

Neuron 704

20Obp ATG Xbal

TGA 3’ )\

,-, 5

AAAA c10-2

: campn 2

v.---A-? PSLI +

A

camps 2

c 2RE 2E

camplw7

B genom~

DNA

,,ATTCAA1‘~TG’~TTCGGTT(;~AG~l”~AATTG’~GAti

cDNA

T [ g a g GTTAATTGTCAGTGCAl

I

C(;ACGAGGATTTTTGAG’I‘G

g g t t t a a I I a c c c a a g t t t g a g GTTA.L\TI‘~TGAGTGCATCGACGAGGATTTTTG.4~;’1’G

predicted cDNA

100

200 ,

1

300

400

500

591 COOH

NHz 4 591

17L L55 468 Ii%

Figure

I(; ,

ggtttaattacccaagtttgag

SI.1 observed

D

TGCA’T(‘~;,~(‘GAGG~~l~~~~~l’(,.4(;

1. Sequence

and Schematic

Structure

p10-2

520 531 571 591 KF4Z

G3

of uric-78

(A) The uric-78 gene consists of nine exons. The initiating ATC and the terminating TCA are located in exon I and exon IX, respectively. The 3’ Xbal site of a 3.5 kb Xbal fragment used for B-galactosidase reporter gene constructs is shown. The four cDNAs (~10-2, campA, campSL1, camplNV7) used to determine the complete cDNA sequence are shown. For PCR amplifications of mRNA sequences, oligos 1, 2, 5, pSL1,2E, and 2RE (arrows) were used as primers. The sequences of the primer oligonucleotides are described in Experimental Procedures. The complete cDNA was constructed by joining cl02 and camp SLI cDNAs at the Kpnl site. (B) Nucleotide sequences at the 5’ end of camplNV7 cDNA compared with those of genomic and SLI consensus DNA. The cDNAs synthesized with oligo 1 as a primer, then amplified using oligos 2E and 2RE, contained TTGAC, which matched the last 5 residues of the 22 nucleotide C. elegans trans-spliced leader RNA, SLI (Krause and Hirsh, 1987). The numbers correspond to base pairs in the genomic DNA, with base pair 1 designating the first base that encodes the initiating methionine. A potential 3’ splice site (TTGCAG) is underlined. (C) The nucleotide sequence of the uric-78 cDNA coding region and the predicted amino acid sequence. The amino acid sequence deduced from the uric-78 open reading frame is shown. A potential N-glycosylation site is underlined. (D) A schematic representation of the predicted protein with the locations of the immunogens. The black bars indicate the positions of the peptides used as immunogens within the sequences: the synthetic peptides KDRI (457-468, KTWTPTKKERPH), KDR2 (520-534, QWHKERGQQSNYRSC), and KDR3 (577-591, KFLTNLRDLNKPRDI) and the peptide ~10-2 (174-591).

oligos 2E and 2RE (Figure IB), uric-78 was predicted to be trans-spliced. Therefore, the cDNA was amplified using an oligonucleotide consisting of the SLI transspliced leader sequence (pSL1) and oligo 2. A single cDNA (campSL1) was amplified in which ATG was located 36 bp downstream from the SLI sequence. An RNAase protection assay, done with an RNA probe covering exon I, detected the uric-18 transcript containing part of the SLI sequence (data not shown). These findings also support the above results. The nucleotide sequence of the uric-18 coding region is a composite based on the analysis of the cDNA clones ~10-2, campA, and campSL1 (Figure IC). Primary

Structure

of Deduced

UNC-18

The open reading frame of 1773 bp encodes a polypeptide of 591 amino acids. Twenty-six percent of the protein consists of charged amino acid residues (14% acidic and 12% basic) distributed throughout the protein. The hydropathy profile of UNC-18 is character-

istic of a soluble protein, both in length and hydrophobicity. UNC-18 does not appear to contain a transmembrane domain. Comparison of the predicted amino acid sequence for UNC-18 with those of other proteins revealed sequence similarity with the yeast SECI, SLYI, and SLPI sequences (Figure 2A). Within the highly conserved 100 amino acid portion between UNC-18 and the three yeast proteins, 37 amino acid residues in the SEC1 protein, 25 in SLYI, and 22 in SLPI are identical. UNC-18 is therefore significantly homologous to the three yeast proteins, according to the criteria outlined by Doolittle (1990). The three yeast proteins constitute a family of related proteins that are involved in intracellular transport (Aalto et al., 1992): SLY1 operates in transport between the endoplasmic reticulum (ER) and the Golgi apparatus (Dascher et al., 1991), SEC1 between the Golgi apparatus and the plasma membrane (Aalto et al., 1991), and SLPI between the Golgi apparatus and the vacuole (Wada et al., 1990). The similarity between UNC-18

Expression 705

of the

uric-18

Gene

raised a polyclonal antiserum against the peptide ~10-2, corresponding to a portion of cDNA ~10-2 that contains about the two-thirds of the open reading frame from the 3’end of uric-78. The cDNA sequence was inserted downstream of the ma/E gene, which encodes the maltose-binding protein (MBP), and the MBP-~10-2 fusion protein was obtained. DNA inserts in 9 clones were electrophoresed on agarose gels, and the production of fusion proteins was verified by SDS-polyacrylamide gel electrophoresis. Induction of the fusion protein by isopropyl 8-o-thiogalactopyranoside gave rise to a 97 kd protein when probed with anti-MBP antisera (Figure 3, lane 8) and a monoclonal antibody against KDR3 (lane 10). The fusion proteinswerepurifiedonanamylosecolumnandcleaved with protease factor Xa. The UNC-18 peptide ~10-2 was separated from MBP through a second affinity column, and antisera were raised against it.

and SEC1 is much higher than that between the other two yeast proteins. As illustrated graphically in Figure 28, a comparison of the predicted amino acid sequence of UNC-18 with that for SEC1 revealed a striking overall continuity. In addition, the two proteins have similar properties, such as pl value, hydrophobicity, and contentsof polar and charged amino acids. These results indicatethat UNC-lftfunctions invesicle transport, as does SECI. Expression of the uric-18 cDNA Sequence in Escherichia coli We previously obtained monoclonal antibodies against the synthetic peptides KDRl, KDR2, and KDR3 (Figure ID). Of these, the antibody against KDR3 positively reacted on immunoblots, but the immunoreactivity was weak (to be published elsewhere). Therefore, we

Identification of the uric-18 Gene Product Figure 4A shows the presence of a 68 kd band in wildtype animals (lane 4) but its absence from uric-18 (e&37) mutant animals (lane 5). The remaining uric-18 alleles, cn347, mdl18, md120, md183, md193, and b403, showed no detectable band (data not shown). Previously, the uric-18 gene transcript was shown to be prominent at the early larval stages (Hosono et al., 1992). Therefore, the developmental pattern of UNC18 was investigated (Figure 4B). The protein was detected throughout the larval stage, but decreased at the adult stage. Some degradation of the protein was apparent, as bands of lower molecular weights were also detected. Since the proportion of neural tissue in the nematode changes as it grows, expression levels of UNC-18 during development were compared using ChAT levels as a control. In the wild-type C. elegans, ChAT levels are the highest at the early larval stage and steeply decrease with development (Figure 4C, legend; Sassa et al., 1987), reflecting the near completion of nervous system development at this stage. To understand the expression level of UNC-18 during development in relation to the proportion of neural tissue,ChATwasusedasacontrol.Asshown in Figure 4C, UNC-18 contents were not constant, but reached the maximal level at the adult stage, which was not coincident with the expression pattern of ChAT. Thus, UNC-18 is maximally accumulated at the late larval stage. The developmental profile of UNC-18 is not coincident with that of ChAT activity, suggesting that the expression of each protein is regulated differently. localization of UNC-18 in C. elegans To detect UNC-18 using the antisera against the ~10-2 peptide, whole-mount specimens of wild-type and AIOTI transgenic animals, which contain the cosmid clone C09AlO carrying the intact uric-18 gene, were observed by indirect immunofluorescence. In Figure 5, staining of transgenic animals is shown simply because the animals were more intensely stained than wild-type animals. In the newly hatched larva, the ven-

Nf3JKF 706

400

0,

, 0

200

400

600

UNC-I8

Figure2 quences Proteins

Comparison of UNC-18

of the Protein Sewith Those for Yeast

(A) Similarity of the predicted amino acid sequences for UNC-18 (Figure IB), SEC1 (Aalto et al., 1991), SLY1 (Dascher et al., 1991), and SLPI (Wada et al., 1990) proteins. Alignment of sequences is shown with gaps introduced to optimize matches with the program HOMOCAP in GENETYX software (Software Development). (B) Dot matrix of sequences in UNC-18 and SECI. The analysis was performed with the program HARR PLOT in GENETYX software, with a spanof30andaminimum scoreofl.O.The axes are labeled in residue numbers,

IPTG-+-+

-+-t

-+

tral nerve cord has 15 motor neurons, of which 11 are thought to be cholinergic neurons and the remaining 4, GABAergic (Figure 5D). At this stage, all 15 motor neurons in the wild-type and transgenic animals were stained. The ventral nerve cord consists of 57 motor neurons at the adult stage. All were positively stained by the antibody (data not shown). These results indicate that UNC-I8 is not localized at specific motor neurons, but is found at all motor neurons of the ventral cord. UNC-18 was not detected in the uric-78 (e81) mutant (data not shown). Discussion

Mutations in the C. elegans uric-18 gene cause abnormal elevation of ACh (Hosono et al., 1989). Pharmacological studies suggest that the accumulation of ACh

Figure

3. Expression

of uric-78

cDNA

as a Fusion

Protein

Cultures of transformed JM109 were induced f+) or not induced (-) with isopropyl B-D-thiogalactopyranoside for fusion protein production. Cleared lysates were prepared from cultures, separated on 10% SDS-polyacrylamide gels, and stained with Coomassie brilliant blue (I). The blotted nitrocellulose strips were

incubated with antisera against MBP (II) (New England Biolabs) or with the monoclonal antibody against the synthetic peptide KDR3 of UNC-18 (III). Lanes 1, 2, 5, 6, and 9, JM109 transformed with pMAL-c, which expresses MBP; lanes 3,4,7,8, and 10, JM109 transformed with pMAL-cl&L, which expresses the fusion protein (arrowhead).

Expression 707

of the uric-18

Gene

12345 kD 97-

Figure

4. lmmunoblots

of UNC-I8

Protein extracts prepared from whole homogenates of nematodes. Twenty micrograms of total protein was fractionated on 10% SDS-polyacrylamide gels, transferred to a nitrocellulose membrane, and probed with purified anti-UNC-18 ~10-2 using horseradish peroxidase-labeled goat anti-mouse immunoglobulin. (A) Detection of UNC-18 in the wild type and e87 mutant allele. The electrophoresed samples were analyzed by Coomassie brilliant blue staining (lanes 2 and 3) and by immunostaining (lanes 4 and 5). The molecular mass markers (lane 1) were phosphorylase b (97 kd), bovine serum albumin (66 kd), ovalbumin (43 kd), and carbonic anhydrase (31 kd). Wild type (lanes 2 and 4); e87 (lanes 3 and 5). (B and C) Developmental expression of UNC-18. Each lane contains either 20 ug of total protein (8) or protein containing 1.62 nmoll hr ChAT activity at IOOC (C) (Sassa et al., 1987). Activity of ChAT (nmollhr per mg of protein) in each lane was 105 + 11.0 (10 hr, Ll), 97 + 10.0 (18 hr, L2), 84 f 10.0 (32 hr, L3), 73 * 6.0 (40 hr, L4), 41 * 5.5 (57 hr, A), 33 f 2.0 (65 hr, A), respectively. Ll-L4, first to fourth stage larvae; A, adults. Numbers refer to the period (hours) of postembryonic development after hatching at 20°C.

in the uric-78 mutants occurs at presynaptic terminals rather than in synaptic gaps. In this report, we described the molecular characterization of the uric-78 gene product, UNC-18. We found that the gene was expressed in the motor neurons of wild-type C. elegans, in which the product was also localized. These findings suggest that the UNC-18 influences neurotransmitter flow at motor neurons. There are seven main classes of neurons in the ventral cord: VAn, DAn, VBn, DDn, A%, VDn, and VCn (White et al., 1976). DDn and VDn motor neurons are inhibitory and contain the neurotransmitter y-amino butyric acid (GABA) (Mclntire et al., 1992). The remaining DBn, VBn, DAn, and VAn neurons areconsidered to be cholinergic, based upon equivalent Ascaris motor neurons (White et al., 1986). Antibodies directed against a peptide ~10-2 specific to a portion of UNC-18 were used to identify and localize the gene product. UNC-18 gene product was localized at all ventral motor neurons including the GABAergic neurons. Thus, uric-78 may function in the flow of neurotransmitters other than ACh. Although the gene product is detected predominantly in motor neurons and their processes, the product is alsodetected in several other neurons, which we have not investigated enough to identify. The nerve ring and only a limited number of neurons in the ganglia were intensely stained

at the

anterior

region

of the

C. elegans

body.

To identify further cells expressing UNC-18, uric-78 was fused with a B-galactosidase reporter gene (Fire et al., 1990). The fusion construct was injected into C. elegans, and 8-galactosidase expression was examined by histochemical staining. Expression of the B-galactosidase reporter gene was generally consistent with the results obtained from the antibody staining, that is, the gene is expressed in motor neurons and a limited number of neurons constituting nerve ganglia (unpublished data). Two additional, indirect lines of evidence also supis specifically expressed in port the view that uric-78 the nervous system. First, uric-78 transcript has a long 3’ untranslated sequence (Hosono et al., 1989), which is characteristic of neuron-specific mRNAs (Milver and Satcliffe, 1983). Second, the selective expression of uric-78 and the appearance of the gene product coincide approximately with the development of the motor nervous system as summarized. The B-galactosidaseactivityinthetransformants isfirstdetectable in late embryogenesis, such as in pretzel stage emtranscript is bryos (unpublished data). The uric-78 present throughout development and is especially abundant during the embryonic and early larval stages (Hosono et al., 1992). UNC-18 is most abundant at around the L2 and L3 stages. The ventral nerve cord is reconstructed during the Ll stage by the addition of three-quarters of the ventral cord cells (Sulston,

Neuron 708

Figure

5. lmmunostaining

of Newly

Hatched

Larvae

with

Anti-UNC-18

~10-2 Antisera

(A, B, and C) Whole mounts of AlOTl transgenic animals were stained with anti-UNC-18 ~10-2 antisera followed by a secondary FITC-conjugated streptavidin-labeled goat anti-rabbit antibody (6). 4,&Diamido-2-phenylindole (DAPI) staining was used to visualize nuclei (C). (D and E) lmmunostaining of newly hatched larvae with anti-CABA antibodies. The same preparations stained with antiUNC-18 ~10-2 antisera were stained with DAPI (D) and anti-CABA antibodies (E). Bar, 20 Km.

1976). Thus the expression of uric-18 is correlated with the development of the nervous system. It is generally accepted that ACh, generated in the cell bodies, is axonally transported and stored in vesicles at the synaptic terminals (Dunant, 1986). The stored ACh is exocytotically released upon the depolarization of nerve terminals. The processes of synthe-

sis, storage, and release of ACh may be regulated in a specific fashion in cholinergic cells. UNC-18 may contribute to these processes because mutations in uric-78 cause an abnormal elevation of ACh levels. uric-78 is transcribed into a single 2.9 kb RNA species. We sequenced the coding region of the transcript, which shows that uric-18 encodes a highly charged,

Expressron 709

Figure

of the uric-76

6. A Proposed

Gene

Model

for the Function

of UNC-18

Formation of the cholinergic nerve terminal includes transmission of ACh, vesicles, and nerve terminal components. Macromolecular constituents of synaptic vesicles move in membranebound compartments from the Golgi apparatus in the cell body to the nerve terminals. For the supply of synaptic vesicles to the nerve terminals, several steps are included, such as synthesis of vesicles (A), axonal transport(B), packaging of neurotransmitters (C), translocation at the terminals (D), and vesicle release (E). Mutations in the uric-16 gene result in the accumulation of ACh presumably at the presynaptic terminals (Hosono et al., 1992). A model for the role of UNC-18 in the formation of the nerve terminal is proposed. In this model, UNC-18 functions in either step of the transport (C) of the synaptic vesicles generated at the Colgr apparatus through their release (E).

probably soluble protein. Sequencing also revealed that UNC-18 displays significant sequence similarity with the yeast SLYI, SECI, and SLPI proteins, which are encoded by a gene family and constitute essential elements of the yeast secretory pathway from the ER through post-Golgi. The secretory pathway is composed of three steps, by which the secretory proteins are guided to the exterior of the cell. Proteins are first localized into the lumen of the ER, then transferred to the Golgi apparatus, and finally secreted. SLY1 is required for the second step in transport from the ER to the Golgi apparatus. SLPI is required for transport from the Golgi apparatus to the vacuole, and SEC1 from the Golgi to the plasma membrane. Several lines of evidence suggest that the yeast secretory pathway is homologous to the neural transmission system, including the generation and axonal transport of synaptic vesicles and their translocation and release at the presynaptic terminal. For example, the YPTI protein encoded by another gene family is a small CTP-binding protein functioning in protein transport fr,m the ER through the Colgi (Segev et al., 1988). The mammalian counterpart rab3A participates in the regulation of the vesicle cycle by cyclically binding to and dissociating from the vesicle membrane (Mollard et al., 1990). SLY12, another suppressor gene of YPTI, encodes a protein similar to synaptobrevin, an integral membrane protein of synaptic vesicles (Baumert et al., 1989). Thus genes related to SLY7 encode proteins for the synaptic vesicle. UNC-18 is especially related to the SEC1 protein. In the secl mutant, membrane vesicles destined for the plasma membrane accumulate, indicating that SEC1 is required for the transfer of secretory vesicles from the Golgi to the plasma membrane. As discussed above, UNC-18 must contribute

to the synaptic function. Therefore, UNC-18 may also have a role in an essential step of synaptic transmission, in which the generation of synaptic vesicles at the Golgi apparatus, axonal transport, and translocation as well as release at the presynaptic terminals are involved (Figure 6). Both cha-7 and uric-704 mutants are similar to uric-78 mutants with regard to several phenotypes. They are abnormal in postembryonic development (slow growth and small body size in adulthood), kinky, and paralyzed. Similarities among uric-78, uric-104, and cha-l mutants may reflect lack of functions common to them. In cha-7 mutants, the synthesis of ACh is insufficient. In uric-18 mutants, on the other hand, the ACh levels elevate presumably at presynaptic terminals. In uric-104 mutants that encode a protein similar to the kinesin heavy chain (Otsuka et al., 1991), axons have few synaptic vesicles. Therefore, mutants in these gene may be defective in functional cholinergic synapses, including synaptic transmission. In addition to the cha-1 and uric-104 genes, several genes (uric-17, uric-13, uric-17, uric-41, uric-63, and uric-64) with phenotypes related to uric-78 have been identified in C. elegans (Hosono et al., 1987,1989,1992; Hosono and Kamiya, 1991). Mutations in these genes cause abnormal accumulation of ACh and resistance to acetylcholinesterase inhibitors. Of these, the uric-73 and uric-77 genes have been cloned, and DNA sequences have been determined (Maruyama and Brenner, 1991; J. Rand, personal communication). The uric-13 gene product has a diacylglycerol-binding site similar to that of protein kinase C and may be a component of a signal transduction pathway via a diacylglycerol signal to a different effector function in the nervous system (Maruyama and Brenner, 1991). The uric-17 gene is not a single entity, but constitutes a complex gene with cha-7. Although the functional properties of the uric-17-encoded protein remain unclear, it is assumed to be involved in ChAT localization (Rand, 1989). Thus, although the seven genes mentioned above were identified on the basis of similar mutant phenotypes, their mode of influencing the ACh flow appears to differ. Experimental Procedures Strains Wild-type C. elegans (N2) and uric-78 mutants (e87, cn347, md778, md793, md783, md720, and b403) were cultured as described by Brenner (1974). The transgenic animal AIOTI was introduced by microinjection of the cosmid CO9AlO into germ cells of the unc78te87) mutant, which carries C. elegans genomic DNAcovering the uric-78 gene (Hosono et al., 1992). PCR Methods and Oligonucleotides Oligonucleotide primers with restriction linker sequences were designed for the trans-splicing leader sequence SLI and the 5 regions of uric-78 genomic and cDNAs. 5’ primers and 3’ primers with EcoRl linkers had the following sequences : pSL1 S-TCTACAATTCCGCCClTTAATTACCCAACTlTC-3’; oligo 1 (-) TCCTCAACAAGGTGGCCGAG, 1946-1927; oligo 2 (-) GCGGAATTCATTTCTCTCAAAGTCAGCAC, 1920-1901; oligo 5 (+) GCGGAATTCAACTGCTCAACGATGTAATC, 1148-1167; oligo 2E f+)

CCGGAATTCCTAAACAAAAGGAGAGAGCC, 1351-1370; oligo 2RE (-) CCCCAAT~CCTCAACCATCACAACATTCC, 1202-1221. The entire uric-78 genomic sequence has been published (Hosono et al., 1992). (+) and (-) indicate sense and antisense strands, respectively. Total RNA from wild-type C. elegans N2 was extracted with guanidinium isothiocyanate (Chomczynski and Sacchi, 1987). Poly(A)’ RNA was obtained using oligo(dT)-cellulose according to Maniatis et al. (1989). First-strand cDNA templates were synthesized by priming these RNAs (5 pg) with 0.5 pmol of oligonucleotide primer according to the conditions described for Moloney murine leukemia virus reverse transcriptase (BRL) in a 50 ul reaction mixture. The cDNA synthesized from 0.5 ug of RNA was PCR amplified (50 11 reaction volume) in the presence of 100 pmol of each primer plus 1.5 mM MgC12 and other reagents provided in the Gene Amp kit (Takara) according to the following schedule: initiation at 94OC for 3 min, followed by 30 cycles at 94OC for 1 min, 55OC for 2 min, and 72OC for 3 min. PCR products were ligated into pUC118. The plasmid was sequenced with a 7-deaza-dGTP DNA Sequencing Kit (Toyobo) by the method of Sanger et al. (1977). RNAase Protection Poly(A)’ RNA obtained from the wild-type N2 was hybridized to antisense RNA probes produced in vitro from a genomic subclone spanning exons I and II with the Ribonuclease Protection Assay Kit (Ambion). Hybridization was carried out at 45’C, and the hybridized poly(A)+ RNA was digested with RNAase A and RNAase Tl. The resulting fragments were analyzed on 6% ureapolyacrylamide gels. Expression of the UNC-18 Protein An uric-78 cDNA clone, ~10-2 (Figure IA), was inserted downstream of the ma/f gene in the pMAL plasmid, which encodes a MBP, to produce the MBP-UNC-18 fusion protein (Guan et al., 1987). E. coli JM109 containing the fusion plasmid was grown in LB medium at 37°C to 0.2 x 108 cells per ml and induced with 0.3 mM isopropyl B-o-thiogalactopyranoside for 2 hr. The harvested cellswerefrozen at -7O”C, thawed, and sonicated. After centrifugation, the supernatant of the crude extract was applied to an amylose column (1 x 2 cm). The fusion protein was eluted with 10 mM maltose and digested with the specific protease factor Xa at room temperature overnight. The digest was again applied to an amylose column to separate the UNC-18 protein from MBP. The protein fusion and purification system was from New England Biolabs. Antibody Production To prepare polyclonal antisera, BALB/c mice were injected subcutaneously with 50 ug of protein (~182) expressed from ~10-2 emulsified in an equal volume of complete Freund’s adjuvant for the first immunization and in an equal volume of incomplete Freund’s adjuvant for the following immunizations. The animals were boosted five times at 3 week intervals. Antibodies to bacterial antigens in the sera were removed by adsorption against bacterial cells lysed by boiling (Helfman et al., 1983). Monoclonal antibodies were prepared from mice immunized with synthetic peptides corresponding to the three regions of the UNC-18 protein (Figure 1D). lmmunoblot Analysis Nematodes were suspended in 0.0625 M Tris-HCI (pH 6.8), 10 mM EDTA, 0.5 mM phenylmethysulfonyl fluoride and then disrupted with a glass homogenizer. ChAT activity in the crude extracts was determined as described elsewhere (Sassa et al., 1987). For electrophoresis, 10% glycerol and 0.002% bromophenol blue were mixed with the homogenates. Proteins were separated on 10% SDS-polyacrylamide gels and transferred to nitrocellulose membranes, which were stained with Coomassie blue to visualize total proteins. The blots were incubated with primary antibody at 4OC overnight, washed in 108 mM Tris (pH 7.5), 0.9% NaCl (TBS), incubated with horseradish peroxidase-conjugated goat anti-mouse secondary antibody for 4 hr, and washed in

TBS. The primary antibody signal was visualized using 0.2 mgi ml diaminobenzidine, 0.03% H,O,, 0.0008% NiCI, in TBS. For developmental immunoblots, protein levels at different stages were normalized by loading equal amounts of total protein. Indirect lmmunofluorescence Animals were stained essentially according to the procedure of Michael Finney (Massachusetts General Hospital, personal communication). Animals were fixed in 1 x MRWB (80 mM KCI, 20 mM NaCI, 10 mM Na*-EGTA, 5 mM spermidine HCI, 15 mM PIPES [pH 7.4],25% methanol, 1% formaldehyde), frozen in liquid nitrogen, and thawed at OOC. Fixed animals were washed in Tris Triton buffer (100 mM Tris-HCI [pH 7.41, 0.5% Nonidet P-40, 0.5 mM EDTA) and incubated in Tris Triton buffer containing 1% B-mercaptoethanol for 1.5 hr at 37X The sample was washed in BOX buffer (25 mM HsBOJ, 12.5 mM NaOH) and incubated in BO1 buffer containing 10 mM dithiothreitol for 15 min at 20X The sample was incubated in BO, buffer containing 0.3% H,OL for 15 min at 20°C, washed with BOI buffer, and incubated with antibody buffer A (1.0% dried milk, 0.5% Nonidet P-40, 0.05% sodium azide, 1 mM EDTA in PBS) for 15 min at 20°C. The sample was incubated in primary antibody (1:400) for 18 hr at 20°C and washed three times with antibody buffer B (as buffer A without forO.l% dried milk). The samplewas incubated with 1% biotinylated anti-mouse IgG diluted with antibody buffer A for 2 hr at 20°C and washed three times in buffer B. The sample was incubated with 5% FITC-conjugated streptavidin diluted with buffer A for 2 hr at 37”C, and the antibody was washed three times in buffer B and PBS. StainingforCABAwasaccordingto the procedureof Mclntire et al. (1992). Acknowledgments We thank Dr. H. Yamamoto for support and encouragement, Dr. Y. lkawa for giving K. G.-A. a chance to do the part of the work, Drs. S. Kuno and A. Otsuka for critical reading of the manuscript, Mrs. R. Kitamura and Mr. S. Matsudairaforexcellent technical assistance, Dr. T. Hashimoto (Hoechst Japan) for synthetic peptides, and H. Kimura (Shiga University of Medical Science) for anti-GABA antiserum. We also thank Drs. H. Ogawa and T. Sano for the computer search of homologous proteins. This study was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science and Culture of Japan and by funds for Medical Treatment of the Elderly, School of Medicine Kanazawa University, 1990 K. G.-A. is the recipient of a Grant-in-Aid for Japanese Junior Scientists (02954213) from the Ministry of Education, Science and Culture of Japan. Correspondence should be addressed to R. H. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC Section 1734 solely to indicate this fact. Received

September

2, 1992; revised

August

5, 1993.

References Aalto, M. K., Ruohonen, L., Hosono, K., and Keranen, S. (1991). Cloning and sequencing of the yeast Saccharomyces cerevisiae SEC7 gene localized on chromosome IV. Yeast 7, 643-650. Aalto, M. K., KerInen, S., and teins involved in intracellular

Ronne, sorting.

H. (1992). A family Cell 68, 181-182.

of pro-

Baumert, M., Maycox, P. R., Francesca, N., Camilli, P. D., and Jahn, R. (1989). Synaptobrevin: an integral membrane protein of 18000 daltons present in small synaptic vesicles of rat brain. EMBO J. 8, 379-384. Brenner, S. (1974). netics 77, 71-93. Chomczynski, RNA isolation form extraction.

The genetics

of Caenorhabditis

elegans.

P., and Sacchi, N. (1987). Single-step method by acid guanidinium thiocyanate-phenolchloro Anal. Biochem. 762, 156-159.

Ceof

Expression

of the uric-78

Gene

711

Culotti, J. G., von Ehrenstein, C., Culotti, M. R., and R. L. (1981). A second class of acetylcholinesterasedeficient tants of the nematode Caenorhabditis elegans. Genetics 305. Dascher, C., Ossig, R., Gollwitz, D., Identification and structure of four able to suppress the functional loss RAS superfamily. Mol. Cell. Biol. 77, Doolittle, R. F. (1990). Searching Meth. Enzymol. 783, 99-110.

Russell, mu97,281-

and Schmitt, H. D. (1991). yeast genes (SLM that are of YPTI, a member of the 872-885.

through

Dunant, Y. (1986). On the mechanism Prog. Neurobiol. 26, 55-92.

sequence

databases.

of acetylcholine

release.

like protein.

Neuron

Rand, J. B. (1989). in Caenorhabditis

6, 113-122.

Genetic analysis of the cha-l’unc-77complex elegans. Genetics 722, 73-80.

Rand, J. B., and Russell, R. L. (1984). Choline acetyltransferasedeficient mutants of the nematode Caenorhabditis elegans. Genetics 706, 227-248. Sanger, F., Nicklen, S., and Coulson, A. (1977). DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5467. Sassa, T., Hosono, R., and Kuno, S. (1987). Choline acetyltransferase from a temperature-sensitive mutant of Caenorhabditis elegans. Neurochem. Int. 77, 323-329.

Fire, A., Harrison, S. W., and Dixon, D. (1990). A modulator set of /acZ fusion vectors for studying gene expression in Caenorhabditis elegans. Gene 93, 189-198.

Segev, N., Mulholland, J., and Botstein, D. (1988). The yeast GTPbinding YPTI protein and a mammalian counterpart are associated with the secretion machinery. Cell 52, 915-924.

Guan, C., Li, P., Riggs, P. D., and Inouye, H. (1987). Vectors that facilitate the expression and purification of foreign peptides in Escherichia co/i by fusion to maltose-binding protein. Gene 67, 21-30.

Sulston, J. E. (1976). Post-embryonic development in the ventral cord of Caenorhabditis elegans. Phil. Trans. R. Sot. Lond. (B) 275, 287-297.

Helfman, D. M., Feramisco, J. R., Fiddes, I. C., Thomas, C. P.. and Hughes, S. H. (1983). Identification of clones that encode chicken tropomyosin by direct immunological screening of a cDNA expression library. Proc. Natl. Acad. Sci. USA 80, 31-35. Hosono, R., and Kamiya, Y. (1991). Additional genes which result in an elevation of acetylcholine levels by mutations in Caenorhabditis elegans. Neurosci. Lett. 728, 243-244. Hosono, R., Sassa, T., and Kuno, S. (1987). Mutations acetylcholine levels in the nematode Caenorhabditis Neurochem. 49, 1820-1823.

affecting elegans. J.

Hosono, R., Sassa, T., and Kuno, S. (1989). Spontaneous mutations of trichlorfon resistance in the nematode Caenorhabditis elegans. Zool. Sci. 6, 697-708. Hosono, R., Hekimi, S., Kamiya,Y., Sassa,T., Murakami, S., Nishiwaki, S., Miwa, J., Taketo, A., and Kodaira, K.-l. (1992). The uric-78 gene encodes a novel protein affecting the kinetics of acetylcholine metabolism in the nematode Caenorhabditfs elegans J. Neurochem. 58, 1517-1525. Johnson, C. D., Rand, J. B., Herman, R. K., Stern, sell, R. L. (1988). The acetylcholinesterase genes identification of a third gene (ace-3) and mosaic synthetic lethal phenotype. Neuron 7, 165-173.

B. D., and Rusof C. elegans: mapping of a

Kamiya, Y., Harada, S., Okoyama, S.,Yamamoto, H.,and R. (1993). Developmental and pharmacological studies cholinesterase-defective mutants of Caenorhabditis Zool. Sci. 70, 43-51. Krause, M., and Hirsh, D. (1987). A trans.spliced leader on actin mRNA in C. elegans. Cell 49, 753-761.

Hosono, of acetylelegans. sequence

Lewis, J. A., Elmer, J. S., Skimming, J., McLafferty, S., Fleming, J., and McGee, T. (1987). Cholinergic receptor mutants of the nematode Caenorhabditis elegans. J. Neurosci. 7, 3059-3071. Maniatis. T., Fritsch, Cloning: A Laboratory Cold Spring Harbor

E. F., and Sambrook, Manual (Cold Spring Laboratory).

J. (1989). Molecular Harbor, New York:

Maruyama, I. N., and Brenner, S. (1991). A phorbol estendiacylglycerol-binding protein encoded by the uric-73 gene of Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 88, 5729-5733. Mclntire, S. L., Garriga, G., White, J., Jacobson, D., and Horvitz, H. R. (1992). Genes necessary for directed axonal elongation or fasciculation in C. elegans. Neuron 8, 307-322. Milver, brain.

R. J., and Sutcliffe, J. C. (1983). Nucl. Acids Res. 77, 5497-5520.

Gene

expression

in rat

Mollard, C. F. V., Mignery, C. A., Baumert, M., Perin, M. S., Hanson, T. J., Burger, P. M., Jahn, R., and Si.idhof,T. C. (1990). rab3 is a small CTP-binding protein exclusively localized to synaptic vesicles. Proc. Natl. Acad. Sci. USA 87, 1988-1992. Otsuka, A. J., Jeyaprakash, A., Car&a-Arioveros, J., Tang, L. Z., Fisk, C., Hartshorne, T., France, R., and Born, T. (1991). The C. elegans uric-704 gene encodes a putative kinesin heavy chain-

Wada, Y., Kitamoto, K., Kanbe, T., Tanaka, K., and Anraku, Y. (1990). The SLP7 gene of Saccharomyces cerevisiae is essential for vacuolar morphogenesis and function. Mol. Cell. Biol. 70, 2214-2223. White, J.G., Southgate, E.,Thomson, J. N., and Brenner, S. (1976). The structure of the ventral nerve cord of Caenorhabditis e/egans. Phil. Trans. R. Sot. Lond. (B) 275, 327-348. White, J. C., Southgate, E.,Thomson, J. N., and Brenner, S. (1986). The structure of the nervous system of the nematode Caenorhabditis elegans. Phil. Trans. R. Sot. Lond. (B) 374, I-340.