The C-terminal region of the Turnip mosaic virus P3 protein is essential for viral infection via targeting P3 to the viral replication complex

Virology 510 (2017) 147–155

Contents lists available at ScienceDirect

Virology journal homepage: www.elsevier.com/locate/yviro

The C-terminal region of the Turnip mosaic virus P3 protein is essential for viral infection via targeting P3 to the viral replication complex

MARK

Xiaoyan Cuia,b,c, Hoda Yaghmaieanb,c,1, Guanwei Wua,b,c, Xiaoyun Wub,d, Xin Chena, ⁎ Greg Thornc, Aiming Wangb,c, a

Institute of Vegetable Crops, Jiangsu Academy of Agricultural Sciences, Nanjing, Jiangsu 210014, China London Research and Development Centre, Agriculture and Agri-Food Canada, London, Ontario N5V 4T3, Canada c Department of Biology, Western University, London, Ontario N6A 5B7, Canada d College of Agriculture and Food Science, Zhejiang A & F University, Linan, Zhejiang 311300, China b

A R T I C L E I N F O

A BS T RAC T

Keywords: Plant RNA virus Potyvirus Turnip mosaic virus P3 P3N-PIPO Movement protein Cell-to-cell movement Punctate inclusion Virus replication complex

Like other positive-strand RNA viruses, plant potyviruses assemble viral replication complexes (VRCs) on modified cellular membranes. Potyviruses encode two membrane proteins, 6K2 and P3. The former is known to play pivotal roles in the formation of membrane-associated VRCs. However, P3 remains to be one of the least characterized potyviral proteins. The P3 cistron codes for P3 as well as P3N-PIPO which results from RNA polymerase slippage. In this study, we show that the P3N-PIPO of Turnip mosaic virus (TuMV) is required for viral cell-to-cell movement but not for viral replication. We demonstrate that the C-terminal region of P3 (P3C) is indispensable for P3 to form cytoplasmic punctate inclusions and target VRCs. We reveal that TuMV mutants that lack P3C are replication-defective. Taken together, these data suggest that the P3 cistron has two distinct functions: P3N-PIPO as a dedicated movement protein and P3 as an essential component of the VRC.

1. Introduction Potyviruses comprise the largest group of known plant viruses and include many agriculturally important viruses such as Turnip mosaic virus (TuMV), Tobacco etch virus (TEV), Plum pox virus (PPV), Soybean mosaic virus (SMV), and Potato virus Y (PVY) (Revers and García, 2015; Wylie et al., 2017). Potyviruses have a single-stranded, positive-sense RNA genome of approximately 9500 nucleotides (nt) that encodes a long open reading frame (ORF) and a relatively short ORF (in the -1 reading frame) that results from viral RNA polymerase slippage leading to the insertion of an additional nucleotide (nt) “A” within the highly conserved GAAAAAA sequence in the P3 coding sequence (Chung et al., 2008; Olspert et al., 2015; Rodamilans et al., 2015). The two polyproteins are co- and posttranslationally processed by three viral encoded proteases (P1, HCPro, NIa-Pro) to generate 11 mature protein products (Revers and García, 2015; Wylie et al., 2017). These viral proteins are, from the N to C terminus of the polyprotein: P1 (the first protein), HC-Pro (the helper component/protease), P3 (the third 3 protein), P3NPIPO (resulting from the frame-shift in the P3 cistron), 6K1 (the first 6 kDa peptide), CI (the cylindrical inclusion protein), 6K2 (the

⁎

1

second 6 kDa peptide), NIa- VPg (nuclear inclusion ‘a′ – viral genome-linked protein; also VPg), NIa-Pro (nuclear inclusion ‘a′ protein – the protease), NIb (the nuclear inclusion ‘b′ protein), and CP (coat protein). For some potyviruses, transcriptional slippage also takes place in the P1 cistron to produce P1-PISPO (Mingot et al., 2016; Untiveros et al., 2016) and in the P3 cistron (+1 frameshift) to yield P3N-ALT (Hagiwara-Komoda et al., 2016). Among these viral proteins, P3 and 6K2 are the only two viral membrane proteins (Cui et al., 2010; Eiamtanasate et al., 2007; Restrepo-Hartwig and Carrington, 1994). 6K2 has a central hydrophobic domain and plays a pivotal role in the remodeling of the endoplasmic reticulum (ER) and formation of the membraneassociated viral replication complex (VRC) ( Wei and Wang, 2008; Wei et al., 2010a; Wei et al., 2013). Upon viral infection, 6K2 induces ER-derived vesicles that target chloroplasts for viral genome replication (Schaad et al., 1997; Wei and Wang, 2008; Wei et al., 2010a, 2013). In addition to the 6K2 protein, several other viral proteins including P3, CI, VPg, NIa-Pro and NIb and numerous host proteins are recruited to assemble the VRCs that are colocalized with these 6K2-induced vesicles (Beauchemin et al., 2007; Cotton et al., 2009; Dufresne et al., 2008; Huang et al., 2010; Li et al., 2016;

Corresponding author at: London Research and Development Centre, Agriculture and Agri-Food Canada, London, Ontario N5V 4T3, Canada. E-mail address: [email protected] (A. Wang). Current affiliation: Department of Botany, the University of British Columbia, 3200–6270 University Blvd. Vancouver, BC, V6T 1Z4, Canada.

http://dx.doi.org/10.1016/j.virol.2017.07.016 Received 14 June 2017; Received in revised form 11 July 2017; Accepted 13 July 2017 0042-6822/ Crown Copyright © 2017 Published by Elsevier Inc. All rights reserved.

Virology 510 (2017) 147–155

X. Cui et al.

To test if knock-out of PIPO affects TuMV replication, we carried out a protoplast transfection assay. N. benthamiana mesophyll protoplasts were isolated and transfected with TuMV-GFP, TuMVGFP(ΔPIPO) or TuMV-GFP(ΔGDD). qRT-PCR was performed to quantify TuMV genomic RNA 48 h post transfection (hpt). We found that knock-out of PIPO did not significantly compromise TuMV genomic RNA accumulation (Fig. 1C). These data suggest that P3NPIPO is required for TuMV cell-to-cell movement but not for viral replication. Therefore, P3N-PIPO seems to be a dedicated movement protein.

Thivierge et al., 2008; Wang, 2015; Wang and Krishnaswamy, 2012). However, P3 remains to be one of the least characterized potyviral proteins (Revers and García, 2015). Previous studies have suggested that the potyviral P3 has two hydrophobic domains, one located in the N-terminal region and the other in the C-terminal end (Cui et al., 2010; Eiamtanasate et al., 2007), and interacts with CI, NIb and NIa (Guo et al., 2001; Langenberg and Zhang, 1997; Lin et al., 2009; Merits et al., 1999; Rodriguez-Cerezo et al., 1993; Zilian and Maiss, 2011). In virally infected plant cells, TEV P3 is targeted to the ER membrane and forms inclusions that are associated with the Golgi apparatus, traffic along the actin filaments and colocalize with VRCs (Cui et al., 2010). Although its exact role is yet to be characterized, P3 has been implicated in viral replication, systemic infection, viral pathogenesis and symptom development (Choi et al., 2005; Chu et al., 1997; Eiamtanasate et al., 2007; Klein et al., 1994; Merits et al., 1999; Rodriguez-Cerezo et al., 1993; Suehiro et al., 2004) In this study, we studied the functionality of the P3 coding region of TuMV. We distinguished the functional role of P3N-PIPO from P3 by demonstrating that P3N-PIPO is a dedicated cell-to-cell movement protein. We further showed that like TEV P3, TuMV P3 also forms punctate inclusions that are associated with VRCs. We discovered that the C-terminal region of P3 (P3C) is responsible for targeting P3 to VRCs, and is essential for viral replication.

2.2. Deletion of the C-terminal region of P3 of TuMV abolishes viral intercellular movement The potyviral P3 protein is composed of an N- terminal region (P3N) (that is also the N-terminal part of P3N-PIPO and contains a transmembrane domain), a central region whose coding sequence overlaps with PIPO, and a C-terminal segment (P3C) (Fig. 1A) (Cui et al., 2010. The C-terminal region does not overlap with PIPO and contains a hydrophobic domain (Cui et al., 2010; Eiamtanasate et al., 2007). To address the functional role of this region, we generated a TuMV mutant named TuMV-GFP(ΔP3C) in which the C-terminal region of P3 in TuMV-GFP from nt 727–1041 was deleted (Fig. 2A). The coding sequences for the first 19 aa and the last 8 aa in the Cterminal region of P3 (downstream of PIPO) were retained in TuMVGFP(ΔP3C) to minimize the possible effect on the transcriptional slippage and the cleavage efficiency at the P3 and 6K1 junction. TuMV-GFP(ΔP3C) was agroinfiltrated into N. benthamiana leaves. The wild-type parental virus TuMV-GFP was used as a positive control, and the replication-deficient mutant TuMV-GFP(ΔGDD) as a negative control. At 10 dpa, N. benthamiana plants inoculated by TuMV-GFP showed typical mosaic and leaf curling symptoms in upper new leaves, while the corresponding leaves in those inoculated by TuMVGFP(ΔGDD) and TuMV-GFP(ΔP3C) did not display any symptoms (Fig. 2B). Under UV light, green fluorescence was only observed in the upper new leaves of the plants inoculated with TuMV-GFP (Fig. 2B). Consistently, qRT-PCR analysis of the upper new leaves of N. benthamiana plants inoculated with TuMV-GFP and the two mutants confirmed the presence of TuMV genomic RNA only in the plants inoculated with TuMV-GFP (Fig. 2C). To test if cell-to-cell movement is compromised in TuMVGFP(ΔP3C), we generated a modified TuMV infectious clone TuMVGFP//mCherry that can distinguish primary and secondary infections. A gene cassette expressing the fluorescent protein mCherry fused with HDEL, an ER-retention signal was inserted adjacent to the cassette of TuMV-GFP and TuMV-GFP(ΔP3C) to generate plasmids TuMV-GFP// mCherry and TuMV-GFP(ΔP3C)//mCherry, respectively (Fig. 2A). When these clones are delivered into plant leaf cells, primary infection foci emit red and green fluorescence while secondarily infected cells, if any, would emit only green fluorescence. The agrobacterium cells containing plasmids TuMV-GFP//mCherry and TuMV-GFP(ΔP3C)// mCherry were diluted to OD600 0.001 with infiltration buffer and infiltrated into N. benthamiana leaves. At 4 dpi, confocal microscopy detected the co-presence of GFP and mCherry signals in isolated foci containing one or two cells in the leaves agroinfiltrated with TuMVGFP(ΔP3C)//mCherry (Fig. 2D). In contrast, those leaves agroinfiltrated with TuMV-GFP//mCherry displayed GFP fluorescence clusters of epidermal cells where only one or a couple of cells coexpressed mCherry (Fig. 2D). This result suggests that the TuMV P3C deletion mutant is restricted in primarily infected cells and is defective in cellto-cell movement.

2. Result 2.1. The P3N-PIPO of TuMV is a dedicated movement protein It is well established that the potyviral P3 cistron encodes two viral proteins P3 and PIPO, and the latter is expressed as a fusion with the N-terminus of P3 (P3N-PIPO) resulting from transcriptional slippage by viral RNA-dependent RNA polymerase during viral genome replication (Olspert et al., 2015; Rodamilans et al., 2015; Vijayapalani et al., 2012). Previosuly, P3N-PIPO has been shown to be requied for cell-to-cell movement for potyviruses TEV and SMV (Wen and Hajimorad, 2010; Wei et al., 2010a). To distigush the functional role of P3 and P3N-PIPO, we first attempted to determine if P3N-PIPO is also involved in viral replication or not. A TuMV mutant TuMV-GFP(ΔPIPO) was generated by substitution of the nt C at the position 513 with a T in the P3 coding region of the full-length cDNA clone TuMV-GFP (Fig. 1A). This substitution does not affect the amino acid (aa) sequence of P3. In P3N-PIPO, a stop codon was introduced at the 5′ end of the PIPO sequence to knock out PIPO. A replication-defective mutant TuMV-GFP(ΔGDD) was also created by deletion of the coding sequence for the core motif GDD of the viral RNA-dependent RNA polymerase NIb (Fig. 1A). The wild-type infectious clone TuMV-GFP and the two mutants TuMVGFP(ΔPIPO) and TuMV-GFP(ΔGDD) were agroinfiltrated into Nicotiana benthamiana leaf cells. The agrobacterial cells were diluted to OD600 0.001 with infiltration buffer to increase the occurrence of initial infection in isolated single cells to allow cell-to-cell movement assessment. Confocal microscopy revealed that the PIPO knock-out mutant TuMV-GFP(ΔPIPO) was contained in a single cell and lost the ability to move to the neighboring cells 4 days post agroinfiltration (dpa) (Fig. 1B). In contrast, the leaves agroinfiltrated with the wildtype clone TuMV-GFP showed a cluster of cells of virus infection (Fig. 1B). As expected, some weak green fluorescence was found in isolated single cells of N. benthamiana leaves agroinfiltrated with the replication-defective mutant TuMV-GFP(ΔGDD) (Fig. 1B). The GFP fluorescence derived from the replication-defective GDD mutant came from translation of the non-replicative transcript of the TuMV cDNA (tagged by GFP) under the control of 35S promoter. RT-PCR results confirmed that no TuMV was detectable in the upper non-infiltrated leaves of plants inoculated with TuMV-GFP(ΔPIPO) or TuMVGFP(ΔGDD) over a 4-week period.

2.3. The C-terminal region of P3 is essential for TuMV replication To examine if P3C is required for viral replication, we performed a protoplast transfection assay. We isolated N. benthamiana mesophyll 148

Virology 510 (2017) 147–155

X. Cui et al.

Fig. 1. P3N-PIPO is required for viral cell-to-cell movement but not for viral replication. A. Schematic representation of the wild-type virus TuMV-GFP and a brief description of viral mutants TuMV-GFP(ΔPIPO) and TuMV-GFP(ΔGDD). The circle represents the genome-linked viral protein, VPg. Two short horizontal lines represent 5′ and 3′ untranslational regions, respectively. The large box represents the long open reading frame (ORF). The mature proteins resulting from the proteolytic processing the large polyprotein are indicated as smaller boxes. Some details of P3 (1065 nt in length) and NIb (1059 nt in length) cistrons are shown underneath. PIPO (nt 489–670) generated in -1 reading frame as a result of viral RNA polymerase slippage on the P3 cistron is indicated. The poly(A) tail is shown as (A)n. B. Confocal microscopic analysis of viral intercellular movement of TuMV-GFP, TuMV-GFP(ΔPIPO) and TuMV-GFP(ΔGDD). Images were taken 4 days post agroinfiltration. Independent experiments were performed three times. Typical imaging was shown. Scale bar = 100 µm. C. Realtime qRT-PCR detection of the viral accumulation level in N. benthamiana protoplasts transfected with TuMV-GFP, TuMV-GFP(ΔPIPO) and TuMV-GFP(ΔGDD). Protoplasts were harvested at 48 h post transfection. Viral RNA was quantified by real-time qRT-PCR analysis of the CP RNA level using the N. benthmiana ACTIN gene transcripts as the internal control. TuMV-GFP genomic RNA level was normalized to 1. Statistical differences from three biological replicates, determined by unpaired two-tailed Student's test, are indicated by brackets and asterisks as follows: NS, no significant difference; ***, P < 0.001.

TuMV, P3 colocalized with the punctate inclusions of 6K2, and no typical colocalization of P3ΔC and 6K2 was observed (Fig. 4C). To further examine if this distribution pattern holds true in the presence of viral replication, we used a recombinant TuMV infectious clone TuMV6KmCherry (Wei et al., 2013) where an extra 6K2 tagged by mCherry replaced GFP in the infectious clone TuMV-GFP and constructed a P3C deletion clone TuMV-6KmCherry(ΔP3C) where the P3C coding region of TuMV-6KmCherry was deleted. These two clones were agroinfiltrated into N. benthamiana leaves together with either P3 or P3ΔC where the C-terminal region was deleted. Indeed, the chloroplastbound 6K2 inclusions derived from the recombinant virus TuMV6KmCherry were decorated by the P3 protein (Fig. 4D, upper panels). This decoration was not observed for 6K2 inclusions when P3ΔC was expressed in the leaf cells infected by TuMV-6KmCherry (Fig. 4D, lower panel). Interestingly, P3 but not P3ΔC was also associated with chloroplast-bound 6K2-containing structures in leaf cells agroinfiltrated with TuMV-6KmCherry(ΔP3C) (Fig. 4E). Taken together these data suggest that P3C directs targeting of P3 to the 6K2 vesicle.

protoplasts and transfected them with TuMV-GFP, TuMV-GFP(ΔP3C) and TuMV-GFP(ΔGDD). Total RNAs were extracted from the transfected protoplasts at 24 and 36 hpt, and viral (+) and (−) RNAs were quantified by qRT-PCR. The P3C deletion mutant showed slightly higher levels of (+) and (−) viral RNAs than the replication-defective mutant TuMV-GFP(ΔGDD) at both time points (Fig. 3) with a significant difference (P < 0.05) only found between the (+) viral RNA levels of the P3C deletion and GDD deletion mutants at 24 hpt (Fig. 3A). However, at 36 hpt, the wild type virus TuMV-GFP accumulated significantly (P < 0.01) higher levels of viral (+) or (−) RNAs than either the P3C deletion mutant or the GDD deletion mutant, and there was no significant difference between the level of viral (+) or (−) RNAs of the P3C deletion mutant and that of the GDD deletion mutant (Fig. 3). These results indicate that the P3C deletion mutant is incapable of efficient replication and replication-defective. Therefore, P3C is required for viral viability. 2.4. The C-terminal region of P3 is indispensable for colocalization of P3 with 6 K2

2.5. P3 facilitates the formation of chloroplast-bound 6K2 vesicles Our previous study showed that the P3 protein of TEV is an ER membrane-associated protein and forms punctate inclusions that colocalize with the 6K-containing replication vesicles (Cui et al., 2010). To understand the underlying mechanism by which the P3C deletion mutant loses viral replication ability, we conducted a transient expression assay to compare the distribution patterns of P3ΔC and P3 of TuMV in N. benthamiana leaf cells. We found that similar to TEV P3, most of TuMV P3 formed punctate inclusions (Fig. 4B, upper panel). In contrast, most of P3ΔC was evenly diffused throughout the cytoplasm (Fig. 4B, lower panel). When coexpressed with 6K2 of

Since P3 targets 6K2 vesicles where viral replication takes place, we further conducted a time-course experiment to investigate if the formation of 6K2 vesicles is affected by P3 and P3ΔC. As the 6K2contaning replication vesicles are largely present in the perinuclear area (Cotton et al., 2009), we performed agroinfiltration to introduce TuMV-6KmCherry and TuMV-6KmCherry(ΔP3C) into N. benthamiana leaves together with DRB4-CFP, a nuclear marker (Cheng et al., 2015; Zhu et al., 2013). The inoculated leaf regions were examined by confocal microscopy at different time points. In the cells agroinfiltrated 149

Virology 510 (2017) 147–155

X. Cui et al.

Fig. 2. Deletion of the C-terminal region of P3 abolishes viral long-distance and cell-to-cell movement. A. Schematic representation of the wild-type virus TuMV-GFP and a modified virus TuMV-GFP//mCherry (which contains an independent gene expression cassette for coexpression of an mCherry recombinant protein fused with an ER retention signal), and a brief description of viral mutants TuMV-GFP(ΔP3C) and TuMV-GFP(ΔP3C)//mCherry. B. Symptoms of N. benthamiana plants agroinfiltrated with TuMV-GFP, TuMV-GFP(ΔP3C) and TuMV-GFP(ΔGDD). Photos were taken at 10 days post agroinfiltration under the normal light (the upper panel) or UV illumination (the lower panel). C. Real-time qRT-PCR detection of the viral accumulation level in the upper new leaves of N. benthamiana agroinfiltrated with TuMV-GFP, TuMV-GFP(ΔP3C) and TuMV-GFP(ΔGDD) at 10 days post agroinfiltration. TuMV-GFP genomic RNA level was normalized to 1. D. Confocal microscopic analysis of viral intercellular movement of TuMV-GFP//mCherry and TuMV-GFP(ΔP3C)//mCherry. Images were taken 4 days post agroinfiltration. Independent experiments were performed three times. Scale bar = 50 µm.

inoculated with TuMV-6KmCherry at 72 hpi (Fig. 5). This was not observed in the cells inoculated with TuMV-6KmCherry(ΔP3C). Taken together, these data suggest that both TuMV-6KmCherry and TuMV6KmCherry(ΔP3C) can induce the formation of perinuclear 6K2containing replication vehicles at the early time points of inoculation.

with either TuMV-6KmCherry or TuMV-6KmCherry(ΔP3C), chloroplast-associated 6K2 aggregates were evident in the perinuclear region at 36 hpi (Fig. 5). These 6K2 aggregates were gradually expand into large irregularly-shaped aggregations from 36 to 60 hpi. Some destructive morphological changes of the nucleus were observed in the cells 150

Virology 510 (2017) 147–155

X. Cui et al.

Fig. 3. The C-terminal region of P3 is required for robust viral replication. Real-time qRT-PCR was performed to determine the viral accumulation level in N. benthamiana protoplasts transfected with TuMV-GFP, TuMV-GFP(ΔP3C) and TuMV-GFP(ΔGDD). Protoplasts were harvested at 24 and 36 h post transfection. Viral RNA was quantified by real-time qRT-PCR analysis of the CP (+) or (−) RNA level using the N. benthamiana ACTIN gene transcripts as the internal control. TuMV-GFP (+) or (−) genomic RNA level at 24 h post transfection was normalized to 1. Statistical differences from three biological replicates, determined by unpaired two-tailed Student's test, are indicated by brackets and asterisks as follows: NS, no significant difference; *, 0.01 < P < 0.05; **, P < 0.01.

(Fig. 3). Our time-course experiments revealed that like the wild-type virus TuMV-6KmCherry, TuMV-6KmCherry(ΔP3C) could induce the formation of perinuclear 6K2-containing chloroplast-bound structures at the early time points of inoculation (Fig. 5). However, infection by TuMV-6KmCherry rather than TuMV-6KmCherry(ΔP3C) led to nuclear lesions at 72 hpi (Fig. 5). Taken together, these data support the notion that P3 is an essential component of the VRC. Then, what precise functional roles does P3 play? It is possible that P3 as one of the two viral membrane proteins may participate in the fine tune-up of the membrane-associated VRC for robust viral replication. It is also possible that P3 may function through its interactions with other viral proteins such as CI, NIb and NIa (Guo et al., 2001; Lin et al., 2009; Merits et al., 1999; Zilian and Maiss, 2011) or host factors (Lin et al., 2011). These possibilities warrant further investigations towards elucidation of the exact roles of P3 in the viral infection cycle. These studies will not only advance our understanding of the viral replication mechanism but also assist in the development of novel antiviral strategies.

3. Discussion The potyviral P3 cistron encodes two viral proteins, P3N-PIPO and P3, and P3N-PIPO results from -1 frameshift due to transcriptional slippage by viral RNA polymerase (Chung et al., 2008; Olspert et al., 2015; Rodamilans et al., 2015; Vijayapalani et al., 2012). Previous studies have shown that knock-out of PIPO in SMV compromises viral cell-to-cell movement (Wen and Hajimorad, 2010), and the P3N-PIPO of TEV and TuMV modulates the plasmodesmal localization of CI and the interaction complex of CI and P3N-PIPO facilitates viral intercellular movement (Wei et al., 2010b). The host factor pCaP1 that interacts with P3N-PIPO is also required for TuMV cell-to-cell movement (Vijayapalani et al., 2012). These results clearly suggest that P3NPIPO plays a pivotal role in potyviral intercellular spread in infected plants. However, it remains unclear if P3N-PIPO is also involved in viral RNA replication. In this study, we found that when a stop codon was introduced into the P3 cistron downstream of the highly conserved GAAAAA sequence to prevent translation of PIPO, TuMV infection was contained in the primarily infected cells (Fig. 1B), providing further genetic evidence that P3N-PIPO is required for TuMV cell-to-cell movement. In our protoplast replication assay, the wild-type virus and the PIPO mutant showed no significant difference regarding viral genome replication capacity (Fig. 1C). Therefore, knockout of PIPO did not affect viral replication. These data strongly suggest that P3N-PIPO is a dedicated movement protein. The potyviral P3 protein contains two hydrophobic domains located at the N- and C-termini (Cui et al., 2010; Eiamtanasate et al., 2007). In our previous study, we found that the P3 of TEV is an ER protein and forms punctate inclusions (Cui et al., 2010). We also discovered that the C-terminal membrane domain of TEV P3 rather than the Nterminal hydrophobic domain is essential for P3 targeting (Cui et al., 2010). Consistently, the C-terminal region of P3 has been suggested to be involved in both viability and pathogenicity of potyviruses (Sáenz et al., 2000; Suehiro et al., 2004). In this study, we found that TuMV P3 shared the similar expression pattern with TEV P3 and colocalized with the 6K2-induced vesicles in infected cells (Fig. 4). When the C-terminal region of P3 was deleted, the resulting mutant P3ΔC lost the ability to form punctate inclusions and be associated with the 6K2-induced VRC, and thus was no longer a component of the VRC (Fig. 4). Accordingly, the two TuMV P3 mutants TuMV-GFP(ΔP3C) and TuMV6KmCherry(ΔP3C) failed to fulfill robust viral genome replication

4. Materials and methods 4.1. Construction and P3 mutant The recombinant TuMV infectious clones TuMV-GFP and TuMV6KmCherry which contains a full-length TuMV cDNA were as described previously (Deng et al., 2015; Wei et al., 2013). The TuMV genome sequence accession number is EF028235.1. An mCherryHDEL expression cassette was amplified from pVPH-GFP//mCherry (Cui and Wang, 2016) and inserted into TuMV-GFP via several intermediate cloning steps to construct TuMV-GFP//mCherry. To delete the P3C coding sequence (nt 727-1041) in the recombinant viruses, a cDNA fragment from the KpnI restriction site to P3-726 and another fragment from P3-1042 to the MluI restriction site were amplified from TuMV-GFP using primers 3147 KpnI Forward (5′GGGGTACCAAATGGGTCACGG -3′) and TuMV-P3-726 Reverse (5′TTGATGAACCACCGCCTTTTCTTCCATACTACTACGTAATCTATTAC3′) and primers TuMV-P3-1042 Forward (5′- GTAATAGATTACGTAGTAGTATGGAAGAAAAGGCGGTGGTTCATCAA -3′) and 9783 MluI Reverse (5′- CGACGCGTAGAACTTGCGTATC -3′), respectively. The resulting amplicons were fused by PCR amplification using Phusion DNA polymerase. The fused cDNA was restricted with KpnI 151

Virology 510 (2017) 147–155

X. Cui et al.

152

Virology 510 (2017) 147–155

X. Cui et al.

Fig. 4. The C-terminal region of P3 is indispensable for P3 to form punctate inclusions and colocalize with 6K2 replication vesicles. A. Schematic representation of the recombinant virus TuMV-6KmCherry which contains an additional copy of 6K2 tagged by mCherry at the P1/HC-Pro junction, and a brief description of the mutant TuMV-6KmCherry(ΔP3C). B. Deletion of the C-terminal region of P3 inhibits the formation of typical punctate structures and changes the subcellular distribution pattern. Transient expression of P3-CFP and P3ΔC-CFP (a Cterminal deletion mutant of P3) in N. benthamiana leaves agroinfiltrated with corresponding expression vectors. Confocal images were taken 48 h post agroinfiltration. C. Deletion of the C-terminal region of P3 prevents the colocalization of P3 with 6K2-induced inclusions. Transient co-expression of P3-CFP or P3ΔC-CFP (a C-terminal deletion mutant of P3) with 6K2YFP in N. benthamiana leaves agroinfiltrated with corresponding expression vectors. Confocal images were taken 48 h post agroinfiltration. D and E. Deletion of the C-terminal region of P3 inhibits the colocalization of P3 with 6K2-induced, chloroplast-bound replication vesicles derived from the recombinant virus TuMV-6KmCherry or its mutant TuMV6KmCherry(ΔP3C). P3-CFP or P3ΔC-CFP (a C-terminal deletion mutant of P3) was transiently expressed in N. benthamiana leaves agroinfiltrated with TuMV-6KmCherry or TuMV-6KmCherry(ΔP3C). Confocal images were taken 72 h post agroinfiltration. Chl, chlorophyll autofluorescence. For confocal images in B, scale bar = 20 µm; for confocal images in C, D and E, scale bar = 8 µm.

4.3. qRT-PCR

and MluI, cloned into the pCRBlunt vector (Invitrogen) and further into the corresponding restriction sites of TuMV-GFP, TuMV-GFP// mCherry and TuMV-6KmCherry to generate TuMV-GFP(ΔP3C), TuMV-GFP(ΔP3C)//mCherry and TuMV-6KmCherry(ΔP3C). The replication-deficient mutant TuMV-GFP(ΔGDD) was described in (Deng et al., 2015). P3-CFP, P3ΔC and 6K2-CFP were constructed essentially as described (Zhang et al., 2015). To construct TuMV-GFP(ΔPIPO), the KpnI and MluI fragment containing P3 was subcloned into the pCRBlunt vector (Invitrogen) and the Stratagene QuikChange II XL Multi Site-Directed Mutagenesis Kit and the primer pairs (Forward: 5′TACAAATCTTGGATGAAGCATGGAA -3′; Reverse: 5′- TTCCATGCTTCATCCAAGATTTGTA -3′) were used to create the C to T mutation at nt 513 of P3 in this subclone. Then, the KpnI and MluI fragment containing the C to T mutation was cloned back into the corresponding sites of TuMV-GFP to generate TuMV-GFP(ΔPIPO). All resulting plasmids were verified by DNA sequencing.

One μg RNA was pretreated by DNase I (Invitrogen) as a template for cDNA synthesis. For detection of viral (+)RNA accumulation, an oligo(dT) 12–18 primer was used following the Superscript III reverse transcriptase (Invitrogen) manufacturer's instruction. For detection of viral (-)RNA accumulation, TuCP-F (5′-GGCACTCAAGAAAGGCAAGG-3′) and NbActin-R (5′-ATCAGCAATGCCCGGGAACA-3′) were used. For real-time PCR, primer pairs TuCP-F (5′-GGCACTCAAGAAAGGCAAGG-3′) and TuCP-R (5′-CTCCGTCAGTTCGTAATCAGC-3′) were used for detection of viral genomic RNA, and the primers NbActin-F (5′-GGGATGTGAAGGAGAAGTTGGC-3′) and NbActin-R (5′-ATCAGCAATGCCCGGGAACA-3′) for the reference gene Actin in N. benthamiana were used for normalization. General procedures for qRT-PCR assays and analysis followed those described in previous publications (Cheng and Wang, 2017; Cui and Wang, 2017; Deng et al., 2015).

4.2. Protoplast isolation and transfection 4.4. Agroinfiltration in N. benthamiana Protoplasts were isolated from healthy N. benthamiana plants and transfected with 40 µg of various plasmids of interest using the PEG method essentially as previously described (Wei et al., 2013). For quantification of progeny viral RNA by qRT-PCR, protoplasts (8 × 105) were harvested at the time points indicated and total RNA was isolated using RNeasy Plant MiniKit (Qiagen) following the supplier's instruction.

All experiments were performed using N. benthamiana, an experimental host of TuMV. The seedlings were grown in growth chambers under 16/8 h light/dark cycles at 22 °C to 24 °C. The Agrobacterium tumefaciens strain GV3101 was transformed with relevant binary vectors by electroporation, then cultured overnight with the appro-

Fig. 5. Confocal microscopy of perinuclear 6K2-induced structures in N. benthamiana leaf cells co-agroinfiltrated with TuMV-6KmCherry + DRB4-CFP or TuMV-6KmCherry(ΔP3C) + DRB4-CFP. The 6K2-induced structures in the perinuclear region were monitored at 36, 48, 60 and 72 h post agroinfiltration. The experiment was carried out at least three times. Typical images were taken. 6KmCherry fluorescence, DRB4-CFP fluorescence and chlorophyll autofluorescence are colored in red, green and blue, respectively. Scale bar = 10 µm.

153

Virology 510 (2017) 147–155

X. Cui et al.

Eiamtanasate, S., Juricek, M., Yap, Y.K., 2007. C-terminal hydrophobic region leads PRSV P3 protein to endoplasmic reticulum. Virus Genes 35, 611–617. Guo, D., Rajamaki, M.L., Saarma, M., Valkonen, J.P., 2001. Towards a protein interaction map of potyviruses: protein interaction matrixes of two potyviruses based on the yeast two-hybrid system. J. Gen. Virol. 82, 935–939. Hagiwara-Komoda, Y., Choi, S.H., Sato, M., Atsumi, G., Abe, J., Fukuda, J., Honjo, M.N., Nagano, A.J., Komoda, K., Nakahara, K.S., Uyeda, I., Naito, S., 2016. Truncated yet functional viral protein produced via RNA polymerase slippage implies underestimated coding capacity of RNA viruses. Sci. Rep. 6, 21411. Huang, T.S., Wei, T., Laliberte, J.F., Wang, A., 2010. A host RNA helicase-like protein, AtRH8, interacts with the potyviral genome-linked protein, VPg, associates with the virus accumulation complex, and is essential for infection. Plant Physiol. 152, 255–266. Klein, P.G., Klein, R.R., Rodriguez-Cerezo, E., Hunt, A.G., Shaw, J.G., 1994. Mutational analysis of the tobacco vein mottling virus genome. Virology 204, 759–769. Langenberg, W.G., Zhang, L., 1997. Immunocytology shows the presence of tobacco etch virus P3 protein in nuclear inclusions. J. Struct. Biol. 118, 243–247. Li, Y., Xiong, R., Bernards, M.A., Wang, A., 2016. Recruitment of Arabidopsis RNA helicase AtRH9 to the viral replication complex by viral replicase to promote Turnip mosaic virus replication. Sci. Rep. 6, 30297. Lin, L., Luo, Z., Yan, F., Lu, Y., Zheng, H., Chen, J., 2011. Interaction between potyvirus P3 and ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) of host plants. Virus Genes 43, 90–92. Lin, L., Shi, Y., Luo, Z., Lu, Y., Zheng, H., Yan, F., Chen, J., Chen, J., Adams, M.J., Wu, Y., 2009. Protein-protein interactions in two potyviruses using the yeast two-hybrid system. Virus Res. 142, 36–40. Merits, A., Guo, D., Jarvekulg, L., Saarma, M., 1999. Biochemical and genetic evidence for interactions between potato A potyvirus-encoded proteins P1 and P3 and proteins of the putative replication complex. Virology 263, 15–22. Mingot, A., Valli, A., Rodamilans, B., San Leónc, D., Baulcombe, D.C., García, J.A., López-Moya, J.J., 2016. The P1N-PISPO trans-frame gene of Sweet potato feathery mottle potyvirus is produced during virus infection and functions as an RNA silencing suppressor. J. Virol. 90, 3543–3557. Olspert, A., Chung, B.Y., Atkins, J.F., Carr, J.P., Firth, A.E., 2015. Transcriptional slippage in the positive-sense RNA virus family Potyviridae. EMBO Rep. 16, 995–1004. Restrepo-Hartwig, M.A., Carrington, J.C., 1994. The tobacco etch potyvirus 6-kilodalton protein is membrane associated and involved in viral replication. J. Virol. 68, 2388–2397. Revers, F., García, J.A., 2015. Molecular biology of potyviruses. In: Karl, M., Thomas, C.M. (Eds.), Advances in Virus Research 92. Academic Press, 101–199. Rodamilans, B., Valli, A., Mingot, A., San León, D., Baulcombe, D., López-Moya, J.J., García, J.A., 2015. RNA polymerase slippage as a mechanism for the production of frameshift gene products in plant viruses of the Potyviridae family. J. Virol. 89, 6965–6967. Rodriguez-Cerezo, E., Ammar, E.D., Pirone, T.P., Shaw, J.G., 1993. Association of the non-structural P3 viral protein with cylindrical inclusions in potyvirus-infected cells. J. Gen. Virol. 74, 1945–1949. Sáenz, P., Cervera, M.T., Dallot, S., Quiot, L., Quiot, J.B., Riechmann, J.L., García, J.A., 2000. Identification of a pathogenicity determinant of Plum pox virus in the sequence encoding the C-terminal region of protein P3+6K1. J. Gen. Virol. 81, 557–566. Schaad, M.C., Jensen, P.E., Carrington, J.C., 1997. Formation of plant RNA virus replication complexes on membranes: role of an endoplasmic reticulum-targeted viral protein. EMBO J. 16, 4049–4059. Sparkes, I.A., Runions, J., Kearns, A., Hawes, C., 2006. Rapid, transient expression of fluorescent fusion proteins in tobacco plants and generation of stably transformed plants. Nat. Protoc. 1, 2019–2025. Suehiro, N., Natsuaki, T., Watanabe, T., Okuda, S., 2004. An important determinant of the ability of Turnip mosaic virus to infect Brassica spp. and/or Raphanus sativus is in its P3 protein. J. Gen. Virol. 85, 2087–2098. Thivierge, K., Cotton, S., Dufresne, P.J., Mathieu, I., Beauchemin, C., Ide, C., Fortin, M.G., Laliberte, J.F., 2008. Eukaryotic elongation factor 1A interacts with Turnip mosaic virus RNA-dependent RNA polymerase and VPg-Pro in virus-induced vesicles. Virology 377, 216–225. Untiveros, M., Olspert, A., Artola, K., Firth, A.E., Kreuze, J.F., Valkonen, J.P.T., 2016. A novel sweet potato potyvirus open reading frame (ORF) is expressed via polymerase slippage and suppresses RNA silencing. Mol. Plant Pathol. 17, 1111–1123. Vijayapalani, P., Maeshima, M., Nagasaki-Takekuchi, N., Miller, W.A., 2012. Interaction of the trans-frame potyvirus protein P3N-PIPO with host protein PCaP1 facilitates potyvirus movement. PLoS Pathog. 8, e1002639. Wang, A., 2015. Dissecting the molecular network of virus-plant interactions: the complex roles of host factors. Ann. Rev. Phytopathol. 53, 45–66. Wang, A., Krishnaswamy, S., 2012. Eukaryotic translation initiation factor 4E-mediated recessive resistance to plant viruses and its utility in crop improvement. Mol. Plant Pathol. 13, 795–803. Wei, T., Wang, A., 2008. Biogenesis of cytoplasmic membranous vesicles for plant potyvirus replication occurs at endoplasmic reticulum exit sites in a COPI- and COPII-dependent manner. J. Virol. 82, 12252–12264. Wei, T., Huang, T.S., McNeil, J., Laliberté, J.F., Hong, J., Nelson, R.S., Wang, A., 2010a. Sequential recruitment of the endoplasmic reticulum and chloroplasts for plant potyvirus replication. J. Virol. 84, 799–809. Wei, T., Zhang, C., Hong, J., Xiong, R., Kasschau, K.D., Zhou, X., Carrington, J.C., Wang, A., 2010b. Formation of complexes at plasmodesmata for potyvirus intercellular movement is mediated by the viral protein P3N-PIPO. PLoS Pathog. 6, e1000962. Wei, T., Zhang, C., Hou, X., Sanfaçon, H., Wang, A., 2013. The SNARE protein Syp71 is

priate antibiotics at 28 °C and washed with the infiltration medium (Sparkes et al., 2006). The agrobacterial cells were diluted to an optical density (OD600) at 0.6 for routine infection experiments, 0.1–0.2 for subcellular localization assays, and 0.001 for intercellular movement analyses. The agrobacterial cells were infiltrated into the leaf of 3–4week-old N. benthamiana plants with 1-ml syringes. For coexpression, 1:1 mixture of the two GV3101 bacteria containing the plasmids of interest was used for infiltration. 4.5. Confocal microscopy Epidermal cells of N. benthamiana were examined with a Leica TCS SP2 inverted confocal microscope (Leica) as previously described (Wei et al., 2013; Cheng et al., 2017). The images and time-lapse scanning were taken using the Leica LCS and the Leica TCS SP2 imaging system software. Postacquisition images were processed by Adobe Photoshop software. Acknowledgements We wish to thank Jamie McNeil for technical support and Alex Molnar for assistance in artwork preparation. We are grateful to Xiaofei Cheng for helpful discussion and assistance in confocal microscopy work and to Zhaoji Dai for construction of plasmid TuMV-GFP// mCherry. XC and GW were the recipients of a scholarship from Jiangsu Academy of Agricultural Sciences. XW was awarded a scholarship from China Scholarship Council. This project was financially supported by grants from National Natural Science Foundation of China (31101411) and Natural Science Foundation of Jiangsu Province (BK20161374) to XC, and grants from Agriculture and Agri-Food Canada (AAFC) and the Natural Sciences and Engineering Research Council of Canada (NSERC) to AW. References Beauchemin, C., Boutet, N., Laliberte, J.F., 2007. Visualization of the interaction between the precursors of VPg, the viral protein linked to the genome of turnip mosaic virus, and the translation eukaryotic initiation factor iso 4E in planta. J. Virol. 81, 775–782. Cheng, X., Deng, P., Cui, H., Wang, A., 2015. Visualizing double-stranded RNA distribution and dynamics in living cells by dsRNA binding-dependent fluorescence complementation. Virology 485, 439–451. Cheng, X., Wang, A., 2017. The potyviral silencing suppressor protein VPg mediates degradation of SGS3 via ubiquitination and autophagy pathways. J. Virol. 91, (e01478-16). Cheng, X., Xiong, R., Li, Y., Li, F., Zhou, X., Wang, A., 2017. Sumoylation of the Turnip mosaic virus RNA polymerase promotes viral infection by counteracting the host NPR1-mediated immune response. Plant Cell 29, 508–525. Choi, I.R., Horken, K.M., Stenger, D.C., French, R., 2005. An internal RNA element in the P3 cistron of Wheat streak mosaic virus revealed by synonymous mutations that affect both movement and replication. J. Gen. Virol. 86, 2605–2614. Chu, M., Lopez-Moya, J.J., Llave-Correas, C., Pirone, T.P., 1997. Two separate regions in the genome of the tobacco etch virus contain determinants of the wilting response of Tabasco pepper. Mol. Plant Microbe Interact. 10, 472–480. Chung, B.Y., Miller, W.A., Atkins, J.F., Firth, A.E., 2008. An overlapping essential gene in the Potyviridae. Proc. Natl. Acad. Sci. USA 105, 5897–5902. Cotton, S., Grangeon, R., Thivierge, K., Mathieu, I., Ide, C., Wei, T., Wang, A., Laliberte, J.F., 2009. Turnip mosaic virus RNA replication complex vesicles are mobile, align with microfilaments, and are each derived from a single viral genome. J. Virol. 83, 10460–10471. Cui, H., Wang, A., 2017. An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene. Plant Biotechnol. J. 15, 344–356. Cui, H., Wang, A., 2016. The Plum pox virus 6K1 protein is required for viral replication and targets the viral replication complex at the early infection stage. J. Virol. 90, 5119–5131. Cui, X., Wei, T., Chowda-Reddy, R.V., Sun, G., Wang, A., 2010. The Tobacco etch virus P3 protein forms mobile inclusions via the early secretory pathway and traffics along actin microfilaments. Virology 397, 56–63. Deng, P., Wu, Z., Wang, A., 2015. The multifunctional protein CI of potyviruses plays interlinked and distinct roles in viral genome replication and intercellular movement. Virol. J. 12, 141. Dufresne, P.J., Ubalijoro, E., Fortin, M.G., Laliberte, J.F., 2008. Arabidopsis thaliana class II poly(A)-binding proteins are required for efficient multiplication of turnip mosaic virus. J. Gen. Virol. 89, 2339–2348.

154

Virology 510 (2017) 147–155

X. Cui et al.

bZIP60 in plants is complementary to the only UPR pathway in yeast and essential for viral infection. PLoS Genet. 11, e1005164. Zilian, E., Maiss, E., 2011. Detection of plum pox potyviral protein-protein interactions in planta using an optimized mRFP-based bimolecular fluorescence complementation system. J. Gen. Virol. 92, 2711–2723. Zhu, S., Jeong, R.D., Lim, G.H., Yu, K., Wang, C., Chandra-Shekara, A.C., Navarre, D., Klessig, D.F., Kachroo, A., Kachroo, P., 2013. Double-stranded RNA-binding protein 4 is required for resistance signaling against viral and bacterial pathogens. Cell Rep. 4, 1168–1184.

essential for turnip mosaic virus infection by mediating fusion of virus-induced vesicles with chloroplasts. PLoS Pathog. 9, e1003378. Wen, R.H., Hajimorad, M.R., 2010. Mutational analysis of the putative pipo of soybean mosaic virus suggests disruption of PIPO protein impedes movement. Virology 400, 1–7. Wylie, S.J., Adams, M., Chalam, C., Kreuze, J., López-Moya, J.J., Ohshima, K., Praveen, S., Rabenstein, F., Stenger, D., Wang, A., Zerbini, F.M., ICTV Report Consortium, 2017. ICTV virus taxonomy profile: Potyviridae. J. Gen. Virol. 98, 352–354. Zhang, L., Chen, H., Brandizzi, F., Verchot, J., Wang, A., 2015. The UPR branch IRE1-

155