- Email: [email protected]
The Carboxy-Terminal Domain Is Essential for Stability and Not for Virion Incorporation of HIV-1 Vpr into Virus Particles
VIROLOGY
214, 647–652 (1995)
SHORT COMMUNICATION The Carboxy-Terminal Domain Is Essential for Stability and Not for Virion Incorporation of HIV-1 Vpr into Virus Particles S. MAHALINGAM,*,† MAMATA PATEL,*,† R. G. COLLMAN,‡ and A. SRINIVASAN*,†,1 *Department of Microbiology and Immunology, Jefferson Cancer Institute; †Institute of Biotechnology and Advanced Molecular Medicine, Thomas Jefferson University, 1020 Locust Street, Philadelphia, Pennsylvania 19107; and ‡Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104 Received August 22, 1995; accepted October 17, 1995 Vpr is one of the auxiliary gene products encoded by HIV-1 genome. Vpr is a 14-kDa protein and exhibits several interesting characteristics including incorporation into virus particles, oligomerization, localization in the nucleus, and positive regulation of virus replication in primary cells. In an effort to define the structure–function relationship of Vpr, the role of the Cterminus of Vpr was investigated. Site-specific mutagenesis involving deletion, insertion, and substitution of residues at the C-terminus was utilized to generate variants of Vpr. Mutations introduced at the C-terminus affected properties of Vpr in different ways: (i) Vpr containing amino acids 1–72 showed the virion incorporation phenotype, indicating that the C-terminus is not essential for this function, (ii) the C-terminus contributes to the stability of Vpr, and (iii) substitution mutagenesis involving the basic residues showed stability similar to that of wild type, indicating the lack of involvement of these residues in this biochemical property of Vpr. The data generated in this study and our early mutagenic analyses on Vpr suggest that domains noncontiguous in primary sequence contribute to the stability of Vpr through overall conformation of the protein. q 1995 Academic Press, Inc.
HIV and other members of the lentivirus family of retroviruses encode several nonstructural genes collectively known as auxiliary or accessory genes (10, 22, 35). These include vif, vpr, tat, rev, vpu, and nef. Of all the accessory gene products synthesized in infected cells, Vpr has the property of getting incorporated into HIV-1 particles during virus morphogenesis as do both Vpr and Vpx of HIV-2, which get incorporated into HIV-2 particles (8, 41). Vpr is highly conserved among HIV-1 and HIV-2/ SIV and it was speculated that the conserved nature of the gene may have important functional implications for the life cycle of HIV-1 (10, 12, 30). It was reported that an intact vpr is essential for the development of the AIDSlike disease in rhesus macaques infected with SIV (17). However, in a recent study, Gibbs and co-workers (13) showed that rhesus macaques inoculated with SIVmac containing alterations in vpr and vpx progressed to AIDS in a manner similar to macaques infected with the wildtype virus. Based on these data, it was suggested that Vpr provided only a slight facilitating advantage for wildtype SIVmac replication in vivo. Further, utilizing neonatal macaques, Baba and co-workers (1) noted pathogenicity despite deletion of vpr and nef genes in SIV. While these studies indicate the nonessential nature of Vpr for the
induction of disease by SIV in rhesus macaques, there is no information available regarding the role of Vpr in early infection and/or progression of HIV-1-associated diseases. Besides its association with the virus particle, Vpr exhibits several interesting characteristics. These include nuclear localization (23, 27, 42), oligomerization (4, 32, 43), ability to turn cells into differentiation pathway (20), ability to arrest cells in cell cycle progression (33), and affinity for cellular proteins (42). At the biological level, Vpr is known to have a minimal effect in primary lymphoid cells and established cell lines, and it is needed for the productive HIV-1 infection of macrophages (2, 3, 11, 31, 38). In support of this, Heinzinger and co-workers (14) showed that Vpr participates in the transport of preintegration complexes from the cytoplasm to the nucleus. It has been reported that a nonfunctional Vpr is associated with the successful establishment of cells chronically infected with HIV-1 either alone (33) or in combination with Nef (29). Vpr had also been shown to modulate the expression of HIV-1 (7, 21). HIV-1 Vpr contains 96 amino acids and is conserved among all HIV-1 isolates (30, 36). Work from our laboratory involving secondary structure analysis and site-specific mutagenesis of the predicted amino acid residues suggested that Vpr contains six putative domains. These include N-terminal domain (residues 1–16), helical domain I (residues 17–34), loop re-
1 To whom correspondence and reprint requests should be addressed. Fax: (215) 923-7144.
0042-6822/95 $12.00
647
/ m4655$7633
11-21-95 04:37:03
vira
Copyright q 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
AP-Virology
648
SHORT COMMUNICATION
FIG. 1. Schematic representation of mutant Vpr. Overlap extension polymerase chain reaction (PCR) (15) was used to introduce the site-specific mutations into vpr derived from the macrophage-tropic molecular clone of HIV-1 89.6 (9). The primers used for the generation of Vpr mutants were Vpr85 (0) 5* CCCCCTCGAGCTATTGAATAATGCCTAT 3*; Vpr76 (0) 5* CCCCCTCGAGCTAACACCCAATTCTGAA 3*; VprR87S (0) 5* CCCCCCTCGAGCTAGGATTTACTGGCTCCATTTCTTGTTCTGCTGTGTTGAAT 3*; VprK95A (0) 5* CCCCCCTCGAGCTAGGATGCACTGGCTCAATTTCTTG 3*; VprCB (/) 5* ATAGGCATTATTCAACAGAGCAGCACAAGCAATGGAGCC 3*; VprCB (0) 5* CTGTTGAATAATGCCTATACTGCTATGACTACACCCAAT 3* Vpr80Ins (/) 5* CGACATAGCAGAAGGCCCATAGGCATTATTCAACAC 3*; Vpr80Ins (0) 5* GGGCCTTCTGCTATGTCGACACCC 3*. The numbers indicate the predicted amino acid residues of Vpr.
gion (residues 35–45), helical domain II (residues 46– 74), conserved dipeptide motif (residues 75–76), and Cterminal basic amino acid-rich domain (residues 77–96) (26). Importantly, mutagenesis studies of helical domain I showed that this domain is essential for stability, nuclear localization, and virion incorporation of Vpr (24, 25, 27). Further, it was also reported that conserved glycine and cysteine residues are not essential for virion incorporation of Vpr (26). However, mutation of the cysteine residue showed an effect on the stability of the protein (26). Regarding the structure–function relationship of Vpr, there is very little known about the C-terminal domain. Paxton and co-workers (32) reported that deletion of 12 amino acids from the C-terminus resulted in the elimination of Vpr incorporation into virus particles. On the other hand, Ratner and co-workers reported that deletion of 17 amino acids from the C-terminus reduced the level of Vpr incorporation into virus particles (37). In our effort to define the functional domains of Vpr, we have targeted the C-terminal amino acid residues for analysis in this study. Combinations of deletions, insertions, and substitution mutagenesis were utilized to address this. Our results indicate that the C-terminus of Vpr contributes to the stability and is not essential for its incorporation into the virus particle. To generate vpr mutants, we have used pCDVpr, an expression plasmid, in which Vpr coding sequences were cloned between T7 promoter and bovine growth hormone poly(A) signal sequences. Three groups of Vpr mutants were generated to evaluate the role of the Cterminus of Vpr. The first group comprises C-terminal deletion mutants and the schematic diagram of the mutants is shown in Fig. 1. The deletion constructs were generated by utilizing the appropriate primers containing translation termination signal sequences. The constructs contain deletions of amino acids progressively from the C-terminus of Vpr. For these studies, we also utilized an altered Vpr which is present in HXB2 proviral DNA. HXB2 Vpr has 72 amino acids followed by a frameshift leading to an addition of 6 residues unrelated to Vpr coding se-
/ m4655$7633
11-21-95 04:37:03
vira
quences (QNWVST) and a termination codon (30). Studies carried out with this proviral DNA clone reported the detection of a lack of incorporation of appropriate-sized Vpr in transfected cells (18). The second group of Vpr mutants contains an insertion of 2 amino acids in Vpr coding sequences. Arg and Pro residues were inserted between residues 80 and 81 of Vpr and the introduction of proline was expected to disrupt the higher order protein structure in this region. The third group consisted of substitution mutants of Vpr. As pointed out earlier, the C-terminus of Vpr is rich in basic residues. To evaluate the role of basic residues specifically, several substitution mutants were generated. Mutant VprCB contains substitutions at residues 77, 80, 87, 88, 90, and 95. In addition, we also used two substitution mutants in which the basic residues R87 and K95 were exchanged with serine and alanine, respectively. These mutants were verified by DNA sequence analysis (34). In order to assess the expression of Vpr mutants, we initially characterized these clones in an in vitro transcription/translation system. In vitro-translated Vpr was immunoprecipitated with polyclonal Vpr antiserum. As expected, the wild-type Vpr showed a band of 14 kDa and the C-terminal deletion mutants correspondingly revealed a reduction in size of Vpr (Fig. 2). To monitor the expression of Vpr in cells, we employed the vaccinia virus–T7 RNA polymerase-based expression system as described. vTF7-3-infected HeLa cells were transfected with wild-type or mutant Vpr expression plasmids by the lipofectin method. Radioimmunoprecipitation analysis of the extracts from cells transfected with wild-type Vpr showed a protein of 14 kDa while the mock and pCDVprD-transfected cells (data not shown) failed to show the corresponding protein (Fig. 3). As expected, deletion constructs Vpr85 and Vpr76 directed the synthesis of Vpr which was reduced in size. The protein encoded by Vpr derived from HXB2 ran similar to Vpr76 in SDS–PAGE. To address the role of the C-terminus residues in incorporation of Vpr into virus-like particles directed by HIV-
AP-Virology
SHORT COMMUNICATION
649
FIG. 2. Expression of HIV-1 Vpr mutants in vitro. Wild-type and mutant Vpr expression plasmids were used for coupled in vitro transcription/ translation according to the manufacturer’s instructions (Promega). Immunoprecipitation of the in vitro-translated proteins was performed with Vpr antiserum as described previously (25). Immunoprecipitates were analyzed by SDS–12% PAGE. The designation of the Vpr plasmids is indicated at the top.
1 Gag, we transfected vTF7-3-infected HeLa cells with the Gag expression plasmid (pCDGag) in combination with wild-type or mutant Vpr expression plasmids. Immunoprecipitation of Vpr and Gag was performed in cell culture supernatant using anti-Vpr antiserum and HIV-1 antiserum. Expression of Vpr alone did not result in the release of Vpr into the culture media. Coexpression of Gag and Vpr resulted in the export of Vpr into the culture medium in association with virus-like particles. Cotransfection of mutant Vpr with Gag showed that C-terminal deletion mutants retained the ability to get incorporated into the virus particles (Fig. 4). Though wild-type and Vpr85 registered an intense signal, mutants Vpr76 and VprHXB2 showed a weaker signal of Vpr in virus particles than the wild-type. These results indicate that the C-
FIG. 3. Expression of C-terminal Vpr mutants in HeLa cells. Recombinant vaccinia virus (vTF7-3)-infected HeLa cells were transfected with wild-type and mutant Vpr expression plasmids (12). Transfected cells were labeled with 35S-protein labeling mix for 2 hr and the cell-associated Vpr proteins were immunoprecipitated with anti-Vpr antiserum as described previously (25). Immunoprecipitates were analyzed by SDS– 12% PAGE. The designation of the Vpr plasmids is indicated at the top.
/ m4655$7633
11-21-95 04:37:03
vira
FIG. 4. Incorporation of Vpr into virus-like particles directed by Gag. Cotransfection of pCDGag with wild-type or mutant Vpr expression plasmids was carried out using vTF7-3-infected HeLa cells as described previously (12, 25). Transfected cells were labeled with 35Sprotein labeling mix for 5 hr, the culture medium was cleared by centrifugation and concentrated using Centricon 30 concentrators, and viruslike particles were resuspended with RIPA buffer. Immunoprecipitation was carried out using anti-HIV and anti-Vpr antiserum and analyzed by SDS–12% PAGE. The electrophoretic positions of Gag and Vpr are shown at the right and molecular mass markers are shown at the left in kilodaltons.
terminus of Vpr is not essential for the incorporation of Vpr into the virus particles. The presence of a reduced level of Vpr in virus particles in Vpr76- and VprHXB2-transfected cells prompted us to analyze the stability of C-terminal-truncated Vpr in cells. Vpr plasmids encoding wild-type or mutant vpr were transfected into vTF7-3-infected HeLa cells and pulse labeled for 30 min. After different chase periods, cell lysates were immunoprecipitated with anti-Vpr antibody and subjected to SDS–12% PAGE. Wild-type Vpr was stable in cells for the chase period of 24 hr used in this study. However, the Vpr expressed by deletion mutants showed altered stability in comparison to the wildtype (Figs. 5A and 5B). Deletion of 11 amino acids from the C-terminus (Vpr85) resulted in the reduced stability of Vpr (approximately 60%) in comparison to wild type. Interestingly, Vpr directed by mutants Vpr76 and VprHXB2 showed an altered stability with 10–30% of Vpr in comparison to wild-type at the end of the 24-hr chase period (Fig. 5B). Also, Vpr directed by both Vpr76 and VprHXB2 showed about 50% reduction by 3 hr. These results suggest that the C-terminus may contribute to the stability of Vpr. As pointed out earlier, the C-terminus of
AP-Virology
650
SHORT COMMUNICATION
FIG. 5. Stability of C-terminal-truncated Vpr proteins. (A) Wild-type and mutant Vpr expression plasmids were transfected into the vTF7-3-infected HeLa cells. Transfected cells were pulse-labeled for 30 min with 200 mCi of 35S-protein labeling mix and chased for different periods. Cells were then lysed and the cell-associated Vpr protein was immunoprecipitated with anti-Vpr antiserum and analyzed by SDS–12% PAGE. Chase periods are indicated at the top. (B) Stability of Vpr mutants by densitometric scanning analysis.
Vpr contains a cluster of basic amino acids (8/20). The basic amino acid residues have been implicated in conferring stability to the protein. We have generated mutant Vpr containing substitutions involving basic amino acids; Vpr directed by the substitution mutants showed expression and stability similar to the wild type (data not shown). The present study examined the role of C-terminal residues of Vpr in stability and virion incorporation functions of Vpr. The characteristic feature of this region of Vpr is the presence of basic amino acid residues. Comparison of HIV-1 Vpr and Vpr and Vpx of HIV-2 shows residues conserved only in the amino terminus and central region and does not show homology at the C-terminus (30, 36). The secondary structure prediction by Chou and Fasman (6) and Garnier and co-workers (5) indicates a b-sheet structure for the C-terminus of Vpr. Strikingly, the C-terminus of Vpr resembles a portion of ribosomal protein which has the potential to bind nucleic acids (40). The role of the C-terminus in Vpr function was evaluated by utilizing several mutagenesis approaches including deletion, insertion, and substitution. The mutant Vpr constructs directed the expression of proteins of identical sizes both in vitro and in vivo. Utilizing cotransfection of Gag and Vpr encoding plasmids, it was also possible to assess the virion incorporation property of Vpr (23, 24). The data generated with substitution mutations suggest
/ m4655$7633
11-21-95 04:37:03
vira
that the basic amino acids replaced individually with alanine or serine did not affect the virion incorporation function of Vpr (24; unpublished data). The insertion mutant which contains 2 additional amino acids between residues 80 and 81 of Vpr also showed incorporation similar to that of wild-type Vpr. The Vpr constructs containing deletions at the C-terminus provide interesting data with respect to virion incorporation of Vpr. Deletions of 11 and 20 amino acid residues from the C-terminus resulted in a protein that retained the virion incorporation property of Vpr. Also the virion incorporation phenotype was observed for Vpr derived from a molecular clone designated HXB2. The Vpr of this proviral clone contains a frameshift mutation that adds 6 amino acids unrelated to Vpr after residue 72 followed by a termination codon at 79 (18). The amino acids which replace the native residues of Vpr between 73 and 78 (QNWVST) differ from wild-type Vpr (30). Analysis of the virion incorporation function of Vpr with the deletion constructs further showed a reduced level of Vpr present in the virus particles. The reduction in the level of Vpr present in virus particles may have resulted from the reduced synthesis of Vpr in cells, loss of epitopes present in the C-terminus region, lower rate of incorporation, and/or altered rate of Vpr degradation. In vitro synthesis of Vpr by a coupled transcription/translation system showed equal amount of Vpr
AP-Virology
SHORT COMMUNICATION
expression with deletion constructs. A similar situation was also noted in cells transfected with expression plasmids. Since we have used polyclonal Vpr antiserum, the interpretation as to the loss of epitopes for antibodies due to deletion is doubtful. It is possible that the Cterminus may provide an accessory role in leading to a high affinity interaction between Vpr and Gag (16, 19, 23, 32). Alternatively, the deletion of residues at the Cterminus may affect the stability of the protein, thereby reducing the level of Vpr available for incorporation into virus particles. Such an effect indeed is evident from the experimental data generated here. The basis of the decreased stability of Vpr is not clear. Since the C-terminus is rich in basic amino acids that have been implicated in the stability of ribosomal proteins and associated complexes, the effect of basic amino acids singly and in combination on Vpr stability was assessed (40). Replacement of basic amino acid residues both singly and in combination with serine and alanine resulted in a Vpr with stability similar to that of wild-type. These data suggest that basic amino acids do not play a role in the stability of Vpr in cells. It is possible that the decreased stability observed with the C-terminal deletion mutants of Vpr may be related to the overall conformation of the protein. Previous studies from our laboratory provided evidence that the amino-terminal helical domain I and the conserved unique cysteine residue contribute to the stability of Vpr (25, 26). The results generated with C-terminus truncation mutants further show that the stability of Vpr is modulated by domains which are not contiguous at the primary sequence level. It is interesting to speculate that perhaps these different domains are brought together in the overall conformation of Vpr. A change in any one of the domains ultimately affects the structure, leading to the decreased stability of Vpr. It is to be noted that despite the reduced stability, C-terminus-truncated Vpr still retained the ability to get incorporated into the virus particles. The discordance in terms of the domains required for virion incorporation and stability further add to our knowledge of the structure–function relationship of Vpr. The unique virion association nature of viral proteins has been exploited to develop antiviral therapeutic molecules specific for the viruses. Matsuda and co-workers (28) reported such an approach for HIV-1 utilizing Vpx of HIV-2 and recently Wu and co-workers (39) reported the construction of a chimeric Vpr protein targeting the virus particles in which Vpr coding sequences were fused to staphylococcal nuclease. The results generated in this study will be useful for the construction of Vpr-based chimeric proteins. ACKNOWLEDGMENTS This work was supported by Funds AI 29306 and AI 35502 from the National Institutes of Health and a grant from the Commonwealth of Pennsylvania to the Biotechnology Foundation, Inc.
/ m4655$7633
11-21-95 04:37:03
vira
651
REFERENCES 1. Baba, T. W., Jeory, Y. S., Penninck, D., Bronson, R., Greene, M. F., and Ruprecht, R. M., Science 267, 1820–1825 (1995). 2. Balliet, J. W., Kolson, D. L., Eiger, G., Kim, F. M., McGann, K. A., Srinivasan, A., and Collman, R., Virology 200, 623–631 (1994). 3. Balotta, C., Lusso, P., Crowley, R., Gallo, R. C., and Franchini, G., J. Virol. 67, 4409–4414 (1993). 4. Bogerd, H. P., Fridell, R. A., Blair, W. S., and Cullen, B. R., J. Virol. 67, 5030–5034 (1993). 5. Carnier, J., Osguthorpe, D. J., and Robson, B., J. Mol. Biol. 120, 97– 120 (1978). 6. Chou, P. Y., and Fasman, G. D., Annu. Rev. Biochem. 47, 251–276 (1978). 7. Cohen, E. A., Terwilliger, E. F., Jalinoos, Y., Proulx, J., Sodroski, J. G., and Haseltine, W. A., J. Acquired Immune Defic. Syndr. 3, 11–18 (1990). 8. Cohen, E. A., Dehni, G., Sodroski, J. G., and Haseltine, W. A., J. Virol. 64, 3097–3099 (1990). 9. Collman, R., Balliet, J. W., Gregory, S. A., Friedman, H., Kolson, D. L., Nathanson, N., and Srinivasan, A., J. Virol. 66, 7517–7521 (1992). 10. Cullen, B. R., Annu. Rev. Microbiol. 45, 219–250 (1991). 11. Dedera, D., Hu, W., Vander Heyden, N., and Ratner, L., J. Virol. 63, 3205–3208 (1989). 12. Fuerst, T. R., Earl, P. L., and Moss, B., Mol. Cell. Biol. 7, 2538–2544 (1987). 13. Gibbs, J. S., Lackner, A. A., Lang, S. M., Simon, M. A., Sehgal, P. K., Daniel, M. D., and Desrosiers, R. C., J. Virol. 69, 2378– 2383 (1995). 14. Heinzinger, N. K., Bukrinsky, M. I., Haggerty, S. A., Ragland, A. M., Kewalramani, V., Lee, M. A., Gendelman, H. E., Ratner, L., Stevensson, M., and Emerman, M., Proc. Natl. Acad. Sci. USA 91, 7311–7315 (1994). 15. Ho, S. N., Hunt, H. D., Hortonb, R. M., Pullen, J. K., and Pease, L. R., Gene 77, 51–59 (1989). 16. Kondo, E., Mammano, F., Cohen, E. A., and Gottlinger, H. G., J. Virol. 69, 2759–2764 (1995). 17. Lang, S. M., Weeger, M., Stahl-Hennig, C., Coulibaly, C., Hunsmann, G., Muller, J., Muller-Hermelink, H., Fuchs, D., Wachter, H., Daniel, M. M., Desrosiers, R. C., and Fleckenstein, B. J., Virology 67, 902–912 (1993). 18. Lavallee, C., and Cohen, E. A., J. AIDS 6, 529–530 (1993). 19. Lavallee, C., Yao, X. J., Ladha, A., Gottlinger, H., Haseltine, W., and Cohen, E., J. Virol. 68, 1926–1934 (1994). 20. Levy, D. N., Fernandes, L. S., Williams, W. V., and Weiner, D. B., Cell 72, 541–550 (1993). 21. Levy, D. N., Refaeli, Y., MacGregor, R. R., and Weiner, D. B., Proc. Natl. Acad. Sci. USA 91, 10873–10877 (1994). 22. Levy, J. A., Microbiol. Rev. 57, 183–289 (1993). 23. Lu, Y. L., Spearman, P., and Ratner, L., J. Virol. 67, 6542–6550 (1993). 24. Mahalingam, S., Khan, S. A., Jabbar, M. A., Monken, C. E., Collman, R. G., and Srinivasan, A., Virology 207, 297–302 (1995). 25. Mahalingam, S., Khan, S. A., Murali, R., Jabbar, M. A., Monken, C. E., Collman, R. G., and Srinivasan, A., Proc. Natl. Acad. Sci. USA 92, 3794–3798 (1995). 26. Mahalingam, S., Collman, R. G., Patel, M. P., Monken, C. E., and Srinivasan, A., Virology 210, 495–500 (1995). 27. Mahalingam, S., Collman, R. G., Patel, M. P., Monken, C. E., and Srinivasan, A., Virology 212, 331–339 (1995). 28. Matsuda, Z., Yu, X.-F., Yu, Q.-C., Lee, T.-H., and Essex, M., Proc. Natl. Acad. Sci. USA 90, 3544–3548 (1993). 29. Mustafa, F., and Robinson, H. L., J. Virol. 67, 6909–6915 (1993). 30. Myers, G., Korber, B., Berzofsky, J. A., Smith, R. F., and Pavlakis, G. N., ‘‘Human Retroviruses and AIDS.’’ Los Alamos National Laboratory, Los Alamos, NM, 1993.
AP-Virology
652
SHORT COMMUNICATION
31. Ogawa, K., Shibata, R., Kiyomasu, T., Higuchi, I., Kishida, Y., Ishimoto, A., and Adachi, A., J. Virol. 63, 4110–4114 (1989). 32. Paxton, W., Connor, R. I., and Landau, N. R., J. Virol. 67, 7229–7237 (1993). 33. Rogel, M. E., Wu, L. I., and Emerman, M., J. Virol. 69, 882–888 (1995). 34. Sambrook, J., Fritsch, E. F., and Maniatis, T., ‘‘Molecular Cloning: A Laboratory Manual.’’ Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. 35. Subramanian, R. A., and Cohen, E., J. Virol. 68, 6831–6835 (1994). 36. Tristem, M., Marshall, C., Karpas, A., and Hill, F., EMBO J. 11, 3405– 3412 (1992). 37. Wang, J. J., Lu, Y. L., and Ratner, L., J. Gen. Virol. 75, 2607–2614 (1994).
/ m4655$7633
11-21-95 04:37:03
vira
38. Westervelt, P., Trowbridge, D. P., Epstein, L. G., Blumberg, B. M., Li, Y., Hahn, B. H., Shaw, G. M., Price, R. W., and Ratner, L., J. Virol. 92, 2577–2582 (1992). 39. Wu, X., Liu, H., Xiao, H., Kim, J., Seshaiah, P., Natsoulis, G., Boeke, J. D., Hahn, B. H., and Kappes, J. C., J. Virol. 69, 3389–3398 (1995). 40. Yeh, L. C., and Lee, J. C., J. Mol. Biol. 246, 295–307 (1995). 41. Yuan, X., Malsuda, Z., Matsuda, M., Essex, M., and Lee, T. H., AIDS Res. Hum. Retroviruses 6, 1265–1271 (1990). 42. Zhao, L.-J., Mukherjee, S., and Narayan, O., J. Biol. Chem. 269, 15577–15582 (1994). 43. Zhao, L.-J., Wang, L., Mukherjee, S., and Narayan, O., J. Biol. Chem. 269, 32131–32137 (1994).
AP-Virology
214, 647–652 (1995)
SHORT COMMUNICATION The Carboxy-Terminal Domain Is Essential for Stability and Not for Virion Incorporation of HIV-1 Vpr into Virus Particles S. MAHALINGAM,*,† MAMATA PATEL,*,† R. G. COLLMAN,‡ and A. SRINIVASAN*,†,1 *Department of Microbiology and Immunology, Jefferson Cancer Institute; †Institute of Biotechnology and Advanced Molecular Medicine, Thomas Jefferson University, 1020 Locust Street, Philadelphia, Pennsylvania 19107; and ‡Department of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104 Received August 22, 1995; accepted October 17, 1995 Vpr is one of the auxiliary gene products encoded by HIV-1 genome. Vpr is a 14-kDa protein and exhibits several interesting characteristics including incorporation into virus particles, oligomerization, localization in the nucleus, and positive regulation of virus replication in primary cells. In an effort to define the structure–function relationship of Vpr, the role of the Cterminus of Vpr was investigated. Site-specific mutagenesis involving deletion, insertion, and substitution of residues at the C-terminus was utilized to generate variants of Vpr. Mutations introduced at the C-terminus affected properties of Vpr in different ways: (i) Vpr containing amino acids 1–72 showed the virion incorporation phenotype, indicating that the C-terminus is not essential for this function, (ii) the C-terminus contributes to the stability of Vpr, and (iii) substitution mutagenesis involving the basic residues showed stability similar to that of wild type, indicating the lack of involvement of these residues in this biochemical property of Vpr. The data generated in this study and our early mutagenic analyses on Vpr suggest that domains noncontiguous in primary sequence contribute to the stability of Vpr through overall conformation of the protein. q 1995 Academic Press, Inc.
HIV and other members of the lentivirus family of retroviruses encode several nonstructural genes collectively known as auxiliary or accessory genes (10, 22, 35). These include vif, vpr, tat, rev, vpu, and nef. Of all the accessory gene products synthesized in infected cells, Vpr has the property of getting incorporated into HIV-1 particles during virus morphogenesis as do both Vpr and Vpx of HIV-2, which get incorporated into HIV-2 particles (8, 41). Vpr is highly conserved among HIV-1 and HIV-2/ SIV and it was speculated that the conserved nature of the gene may have important functional implications for the life cycle of HIV-1 (10, 12, 30). It was reported that an intact vpr is essential for the development of the AIDSlike disease in rhesus macaques infected with SIV (17). However, in a recent study, Gibbs and co-workers (13) showed that rhesus macaques inoculated with SIVmac containing alterations in vpr and vpx progressed to AIDS in a manner similar to macaques infected with the wildtype virus. Based on these data, it was suggested that Vpr provided only a slight facilitating advantage for wildtype SIVmac replication in vivo. Further, utilizing neonatal macaques, Baba and co-workers (1) noted pathogenicity despite deletion of vpr and nef genes in SIV. While these studies indicate the nonessential nature of Vpr for the
induction of disease by SIV in rhesus macaques, there is no information available regarding the role of Vpr in early infection and/or progression of HIV-1-associated diseases. Besides its association with the virus particle, Vpr exhibits several interesting characteristics. These include nuclear localization (23, 27, 42), oligomerization (4, 32, 43), ability to turn cells into differentiation pathway (20), ability to arrest cells in cell cycle progression (33), and affinity for cellular proteins (42). At the biological level, Vpr is known to have a minimal effect in primary lymphoid cells and established cell lines, and it is needed for the productive HIV-1 infection of macrophages (2, 3, 11, 31, 38). In support of this, Heinzinger and co-workers (14) showed that Vpr participates in the transport of preintegration complexes from the cytoplasm to the nucleus. It has been reported that a nonfunctional Vpr is associated with the successful establishment of cells chronically infected with HIV-1 either alone (33) or in combination with Nef (29). Vpr had also been shown to modulate the expression of HIV-1 (7, 21). HIV-1 Vpr contains 96 amino acids and is conserved among all HIV-1 isolates (30, 36). Work from our laboratory involving secondary structure analysis and site-specific mutagenesis of the predicted amino acid residues suggested that Vpr contains six putative domains. These include N-terminal domain (residues 1–16), helical domain I (residues 17–34), loop re-
1 To whom correspondence and reprint requests should be addressed. Fax: (215) 923-7144.
0042-6822/95 $12.00
647
/ m4655$7633
11-21-95 04:37:03
vira
Copyright q 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
AP-Virology
648
SHORT COMMUNICATION
FIG. 1. Schematic representation of mutant Vpr. Overlap extension polymerase chain reaction (PCR) (15) was used to introduce the site-specific mutations into vpr derived from the macrophage-tropic molecular clone of HIV-1 89.6 (9). The primers used for the generation of Vpr mutants were Vpr85 (0) 5* CCCCCTCGAGCTATTGAATAATGCCTAT 3*; Vpr76 (0) 5* CCCCCTCGAGCTAACACCCAATTCTGAA 3*; VprR87S (0) 5* CCCCCCTCGAGCTAGGATTTACTGGCTCCATTTCTTGTTCTGCTGTGTTGAAT 3*; VprK95A (0) 5* CCCCCCTCGAGCTAGGATGCACTGGCTCAATTTCTTG 3*; VprCB (/) 5* ATAGGCATTATTCAACAGAGCAGCACAAGCAATGGAGCC 3*; VprCB (0) 5* CTGTTGAATAATGCCTATACTGCTATGACTACACCCAAT 3* Vpr80Ins (/) 5* CGACATAGCAGAAGGCCCATAGGCATTATTCAACAC 3*; Vpr80Ins (0) 5* GGGCCTTCTGCTATGTCGACACCC 3*. The numbers indicate the predicted amino acid residues of Vpr.
gion (residues 35–45), helical domain II (residues 46– 74), conserved dipeptide motif (residues 75–76), and Cterminal basic amino acid-rich domain (residues 77–96) (26). Importantly, mutagenesis studies of helical domain I showed that this domain is essential for stability, nuclear localization, and virion incorporation of Vpr (24, 25, 27). Further, it was also reported that conserved glycine and cysteine residues are not essential for virion incorporation of Vpr (26). However, mutation of the cysteine residue showed an effect on the stability of the protein (26). Regarding the structure–function relationship of Vpr, there is very little known about the C-terminal domain. Paxton and co-workers (32) reported that deletion of 12 amino acids from the C-terminus resulted in the elimination of Vpr incorporation into virus particles. On the other hand, Ratner and co-workers reported that deletion of 17 amino acids from the C-terminus reduced the level of Vpr incorporation into virus particles (37). In our effort to define the functional domains of Vpr, we have targeted the C-terminal amino acid residues for analysis in this study. Combinations of deletions, insertions, and substitution mutagenesis were utilized to address this. Our results indicate that the C-terminus of Vpr contributes to the stability and is not essential for its incorporation into the virus particle. To generate vpr mutants, we have used pCDVpr, an expression plasmid, in which Vpr coding sequences were cloned between T7 promoter and bovine growth hormone poly(A) signal sequences. Three groups of Vpr mutants were generated to evaluate the role of the Cterminus of Vpr. The first group comprises C-terminal deletion mutants and the schematic diagram of the mutants is shown in Fig. 1. The deletion constructs were generated by utilizing the appropriate primers containing translation termination signal sequences. The constructs contain deletions of amino acids progressively from the C-terminus of Vpr. For these studies, we also utilized an altered Vpr which is present in HXB2 proviral DNA. HXB2 Vpr has 72 amino acids followed by a frameshift leading to an addition of 6 residues unrelated to Vpr coding se-
/ m4655$7633
11-21-95 04:37:03
vira
quences (QNWVST) and a termination codon (30). Studies carried out with this proviral DNA clone reported the detection of a lack of incorporation of appropriate-sized Vpr in transfected cells (18). The second group of Vpr mutants contains an insertion of 2 amino acids in Vpr coding sequences. Arg and Pro residues were inserted between residues 80 and 81 of Vpr and the introduction of proline was expected to disrupt the higher order protein structure in this region. The third group consisted of substitution mutants of Vpr. As pointed out earlier, the C-terminus of Vpr is rich in basic residues. To evaluate the role of basic residues specifically, several substitution mutants were generated. Mutant VprCB contains substitutions at residues 77, 80, 87, 88, 90, and 95. In addition, we also used two substitution mutants in which the basic residues R87 and K95 were exchanged with serine and alanine, respectively. These mutants were verified by DNA sequence analysis (34). In order to assess the expression of Vpr mutants, we initially characterized these clones in an in vitro transcription/translation system. In vitro-translated Vpr was immunoprecipitated with polyclonal Vpr antiserum. As expected, the wild-type Vpr showed a band of 14 kDa and the C-terminal deletion mutants correspondingly revealed a reduction in size of Vpr (Fig. 2). To monitor the expression of Vpr in cells, we employed the vaccinia virus–T7 RNA polymerase-based expression system as described. vTF7-3-infected HeLa cells were transfected with wild-type or mutant Vpr expression plasmids by the lipofectin method. Radioimmunoprecipitation analysis of the extracts from cells transfected with wild-type Vpr showed a protein of 14 kDa while the mock and pCDVprD-transfected cells (data not shown) failed to show the corresponding protein (Fig. 3). As expected, deletion constructs Vpr85 and Vpr76 directed the synthesis of Vpr which was reduced in size. The protein encoded by Vpr derived from HXB2 ran similar to Vpr76 in SDS–PAGE. To address the role of the C-terminus residues in incorporation of Vpr into virus-like particles directed by HIV-
AP-Virology
SHORT COMMUNICATION
649
FIG. 2. Expression of HIV-1 Vpr mutants in vitro. Wild-type and mutant Vpr expression plasmids were used for coupled in vitro transcription/ translation according to the manufacturer’s instructions (Promega). Immunoprecipitation of the in vitro-translated proteins was performed with Vpr antiserum as described previously (25). Immunoprecipitates were analyzed by SDS–12% PAGE. The designation of the Vpr plasmids is indicated at the top.
1 Gag, we transfected vTF7-3-infected HeLa cells with the Gag expression plasmid (pCDGag) in combination with wild-type or mutant Vpr expression plasmids. Immunoprecipitation of Vpr and Gag was performed in cell culture supernatant using anti-Vpr antiserum and HIV-1 antiserum. Expression of Vpr alone did not result in the release of Vpr into the culture media. Coexpression of Gag and Vpr resulted in the export of Vpr into the culture medium in association with virus-like particles. Cotransfection of mutant Vpr with Gag showed that C-terminal deletion mutants retained the ability to get incorporated into the virus particles (Fig. 4). Though wild-type and Vpr85 registered an intense signal, mutants Vpr76 and VprHXB2 showed a weaker signal of Vpr in virus particles than the wild-type. These results indicate that the C-
FIG. 3. Expression of C-terminal Vpr mutants in HeLa cells. Recombinant vaccinia virus (vTF7-3)-infected HeLa cells were transfected with wild-type and mutant Vpr expression plasmids (12). Transfected cells were labeled with 35S-protein labeling mix for 2 hr and the cell-associated Vpr proteins were immunoprecipitated with anti-Vpr antiserum as described previously (25). Immunoprecipitates were analyzed by SDS– 12% PAGE. The designation of the Vpr plasmids is indicated at the top.
/ m4655$7633
11-21-95 04:37:03
vira
FIG. 4. Incorporation of Vpr into virus-like particles directed by Gag. Cotransfection of pCDGag with wild-type or mutant Vpr expression plasmids was carried out using vTF7-3-infected HeLa cells as described previously (12, 25). Transfected cells were labeled with 35Sprotein labeling mix for 5 hr, the culture medium was cleared by centrifugation and concentrated using Centricon 30 concentrators, and viruslike particles were resuspended with RIPA buffer. Immunoprecipitation was carried out using anti-HIV and anti-Vpr antiserum and analyzed by SDS–12% PAGE. The electrophoretic positions of Gag and Vpr are shown at the right and molecular mass markers are shown at the left in kilodaltons.
terminus of Vpr is not essential for the incorporation of Vpr into the virus particles. The presence of a reduced level of Vpr in virus particles in Vpr76- and VprHXB2-transfected cells prompted us to analyze the stability of C-terminal-truncated Vpr in cells. Vpr plasmids encoding wild-type or mutant vpr were transfected into vTF7-3-infected HeLa cells and pulse labeled for 30 min. After different chase periods, cell lysates were immunoprecipitated with anti-Vpr antibody and subjected to SDS–12% PAGE. Wild-type Vpr was stable in cells for the chase period of 24 hr used in this study. However, the Vpr expressed by deletion mutants showed altered stability in comparison to the wildtype (Figs. 5A and 5B). Deletion of 11 amino acids from the C-terminus (Vpr85) resulted in the reduced stability of Vpr (approximately 60%) in comparison to wild type. Interestingly, Vpr directed by mutants Vpr76 and VprHXB2 showed an altered stability with 10–30% of Vpr in comparison to wild-type at the end of the 24-hr chase period (Fig. 5B). Also, Vpr directed by both Vpr76 and VprHXB2 showed about 50% reduction by 3 hr. These results suggest that the C-terminus may contribute to the stability of Vpr. As pointed out earlier, the C-terminus of
AP-Virology
650
SHORT COMMUNICATION
FIG. 5. Stability of C-terminal-truncated Vpr proteins. (A) Wild-type and mutant Vpr expression plasmids were transfected into the vTF7-3-infected HeLa cells. Transfected cells were pulse-labeled for 30 min with 200 mCi of 35S-protein labeling mix and chased for different periods. Cells were then lysed and the cell-associated Vpr protein was immunoprecipitated with anti-Vpr antiserum and analyzed by SDS–12% PAGE. Chase periods are indicated at the top. (B) Stability of Vpr mutants by densitometric scanning analysis.
Vpr contains a cluster of basic amino acids (8/20). The basic amino acid residues have been implicated in conferring stability to the protein. We have generated mutant Vpr containing substitutions involving basic amino acids; Vpr directed by the substitution mutants showed expression and stability similar to the wild type (data not shown). The present study examined the role of C-terminal residues of Vpr in stability and virion incorporation functions of Vpr. The characteristic feature of this region of Vpr is the presence of basic amino acid residues. Comparison of HIV-1 Vpr and Vpr and Vpx of HIV-2 shows residues conserved only in the amino terminus and central region and does not show homology at the C-terminus (30, 36). The secondary structure prediction by Chou and Fasman (6) and Garnier and co-workers (5) indicates a b-sheet structure for the C-terminus of Vpr. Strikingly, the C-terminus of Vpr resembles a portion of ribosomal protein which has the potential to bind nucleic acids (40). The role of the C-terminus in Vpr function was evaluated by utilizing several mutagenesis approaches including deletion, insertion, and substitution. The mutant Vpr constructs directed the expression of proteins of identical sizes both in vitro and in vivo. Utilizing cotransfection of Gag and Vpr encoding plasmids, it was also possible to assess the virion incorporation property of Vpr (23, 24). The data generated with substitution mutations suggest
/ m4655$7633
11-21-95 04:37:03
vira
that the basic amino acids replaced individually with alanine or serine did not affect the virion incorporation function of Vpr (24; unpublished data). The insertion mutant which contains 2 additional amino acids between residues 80 and 81 of Vpr also showed incorporation similar to that of wild-type Vpr. The Vpr constructs containing deletions at the C-terminus provide interesting data with respect to virion incorporation of Vpr. Deletions of 11 and 20 amino acid residues from the C-terminus resulted in a protein that retained the virion incorporation property of Vpr. Also the virion incorporation phenotype was observed for Vpr derived from a molecular clone designated HXB2. The Vpr of this proviral clone contains a frameshift mutation that adds 6 amino acids unrelated to Vpr after residue 72 followed by a termination codon at 79 (18). The amino acids which replace the native residues of Vpr between 73 and 78 (QNWVST) differ from wild-type Vpr (30). Analysis of the virion incorporation function of Vpr with the deletion constructs further showed a reduced level of Vpr present in the virus particles. The reduction in the level of Vpr present in virus particles may have resulted from the reduced synthesis of Vpr in cells, loss of epitopes present in the C-terminus region, lower rate of incorporation, and/or altered rate of Vpr degradation. In vitro synthesis of Vpr by a coupled transcription/translation system showed equal amount of Vpr
AP-Virology
SHORT COMMUNICATION
expression with deletion constructs. A similar situation was also noted in cells transfected with expression plasmids. Since we have used polyclonal Vpr antiserum, the interpretation as to the loss of epitopes for antibodies due to deletion is doubtful. It is possible that the Cterminus may provide an accessory role in leading to a high affinity interaction between Vpr and Gag (16, 19, 23, 32). Alternatively, the deletion of residues at the Cterminus may affect the stability of the protein, thereby reducing the level of Vpr available for incorporation into virus particles. Such an effect indeed is evident from the experimental data generated here. The basis of the decreased stability of Vpr is not clear. Since the C-terminus is rich in basic amino acids that have been implicated in the stability of ribosomal proteins and associated complexes, the effect of basic amino acids singly and in combination on Vpr stability was assessed (40). Replacement of basic amino acid residues both singly and in combination with serine and alanine resulted in a Vpr with stability similar to that of wild-type. These data suggest that basic amino acids do not play a role in the stability of Vpr in cells. It is possible that the decreased stability observed with the C-terminal deletion mutants of Vpr may be related to the overall conformation of the protein. Previous studies from our laboratory provided evidence that the amino-terminal helical domain I and the conserved unique cysteine residue contribute to the stability of Vpr (25, 26). The results generated with C-terminus truncation mutants further show that the stability of Vpr is modulated by domains which are not contiguous at the primary sequence level. It is interesting to speculate that perhaps these different domains are brought together in the overall conformation of Vpr. A change in any one of the domains ultimately affects the structure, leading to the decreased stability of Vpr. It is to be noted that despite the reduced stability, C-terminus-truncated Vpr still retained the ability to get incorporated into the virus particles. The discordance in terms of the domains required for virion incorporation and stability further add to our knowledge of the structure–function relationship of Vpr. The unique virion association nature of viral proteins has been exploited to develop antiviral therapeutic molecules specific for the viruses. Matsuda and co-workers (28) reported such an approach for HIV-1 utilizing Vpx of HIV-2 and recently Wu and co-workers (39) reported the construction of a chimeric Vpr protein targeting the virus particles in which Vpr coding sequences were fused to staphylococcal nuclease. The results generated in this study will be useful for the construction of Vpr-based chimeric proteins. ACKNOWLEDGMENTS This work was supported by Funds AI 29306 and AI 35502 from the National Institutes of Health and a grant from the Commonwealth of Pennsylvania to the Biotechnology Foundation, Inc.
/ m4655$7633
11-21-95 04:37:03
vira
651
REFERENCES 1. Baba, T. W., Jeory, Y. S., Penninck, D., Bronson, R., Greene, M. F., and Ruprecht, R. M., Science 267, 1820–1825 (1995). 2. Balliet, J. W., Kolson, D. L., Eiger, G., Kim, F. M., McGann, K. A., Srinivasan, A., and Collman, R., Virology 200, 623–631 (1994). 3. Balotta, C., Lusso, P., Crowley, R., Gallo, R. C., and Franchini, G., J. Virol. 67, 4409–4414 (1993). 4. Bogerd, H. P., Fridell, R. A., Blair, W. S., and Cullen, B. R., J. Virol. 67, 5030–5034 (1993). 5. Carnier, J., Osguthorpe, D. J., and Robson, B., J. Mol. Biol. 120, 97– 120 (1978). 6. Chou, P. Y., and Fasman, G. D., Annu. Rev. Biochem. 47, 251–276 (1978). 7. Cohen, E. A., Terwilliger, E. F., Jalinoos, Y., Proulx, J., Sodroski, J. G., and Haseltine, W. A., J. Acquired Immune Defic. Syndr. 3, 11–18 (1990). 8. Cohen, E. A., Dehni, G., Sodroski, J. G., and Haseltine, W. A., J. Virol. 64, 3097–3099 (1990). 9. Collman, R., Balliet, J. W., Gregory, S. A., Friedman, H., Kolson, D. L., Nathanson, N., and Srinivasan, A., J. Virol. 66, 7517–7521 (1992). 10. Cullen, B. R., Annu. Rev. Microbiol. 45, 219–250 (1991). 11. Dedera, D., Hu, W., Vander Heyden, N., and Ratner, L., J. Virol. 63, 3205–3208 (1989). 12. Fuerst, T. R., Earl, P. L., and Moss, B., Mol. Cell. Biol. 7, 2538–2544 (1987). 13. Gibbs, J. S., Lackner, A. A., Lang, S. M., Simon, M. A., Sehgal, P. K., Daniel, M. D., and Desrosiers, R. C., J. Virol. 69, 2378– 2383 (1995). 14. Heinzinger, N. K., Bukrinsky, M. I., Haggerty, S. A., Ragland, A. M., Kewalramani, V., Lee, M. A., Gendelman, H. E., Ratner, L., Stevensson, M., and Emerman, M., Proc. Natl. Acad. Sci. USA 91, 7311–7315 (1994). 15. Ho, S. N., Hunt, H. D., Hortonb, R. M., Pullen, J. K., and Pease, L. R., Gene 77, 51–59 (1989). 16. Kondo, E., Mammano, F., Cohen, E. A., and Gottlinger, H. G., J. Virol. 69, 2759–2764 (1995). 17. Lang, S. M., Weeger, M., Stahl-Hennig, C., Coulibaly, C., Hunsmann, G., Muller, J., Muller-Hermelink, H., Fuchs, D., Wachter, H., Daniel, M. M., Desrosiers, R. C., and Fleckenstein, B. J., Virology 67, 902–912 (1993). 18. Lavallee, C., and Cohen, E. A., J. AIDS 6, 529–530 (1993). 19. Lavallee, C., Yao, X. J., Ladha, A., Gottlinger, H., Haseltine, W., and Cohen, E., J. Virol. 68, 1926–1934 (1994). 20. Levy, D. N., Fernandes, L. S., Williams, W. V., and Weiner, D. B., Cell 72, 541–550 (1993). 21. Levy, D. N., Refaeli, Y., MacGregor, R. R., and Weiner, D. B., Proc. Natl. Acad. Sci. USA 91, 10873–10877 (1994). 22. Levy, J. A., Microbiol. Rev. 57, 183–289 (1993). 23. Lu, Y. L., Spearman, P., and Ratner, L., J. Virol. 67, 6542–6550 (1993). 24. Mahalingam, S., Khan, S. A., Jabbar, M. A., Monken, C. E., Collman, R. G., and Srinivasan, A., Virology 207, 297–302 (1995). 25. Mahalingam, S., Khan, S. A., Murali, R., Jabbar, M. A., Monken, C. E., Collman, R. G., and Srinivasan, A., Proc. Natl. Acad. Sci. USA 92, 3794–3798 (1995). 26. Mahalingam, S., Collman, R. G., Patel, M. P., Monken, C. E., and Srinivasan, A., Virology 210, 495–500 (1995). 27. Mahalingam, S., Collman, R. G., Patel, M. P., Monken, C. E., and Srinivasan, A., Virology 212, 331–339 (1995). 28. Matsuda, Z., Yu, X.-F., Yu, Q.-C., Lee, T.-H., and Essex, M., Proc. Natl. Acad. Sci. USA 90, 3544–3548 (1993). 29. Mustafa, F., and Robinson, H. L., J. Virol. 67, 6909–6915 (1993). 30. Myers, G., Korber, B., Berzofsky, J. A., Smith, R. F., and Pavlakis, G. N., ‘‘Human Retroviruses and AIDS.’’ Los Alamos National Laboratory, Los Alamos, NM, 1993.
AP-Virology
652
SHORT COMMUNICATION
31. Ogawa, K., Shibata, R., Kiyomasu, T., Higuchi, I., Kishida, Y., Ishimoto, A., and Adachi, A., J. Virol. 63, 4110–4114 (1989). 32. Paxton, W., Connor, R. I., and Landau, N. R., J. Virol. 67, 7229–7237 (1993). 33. Rogel, M. E., Wu, L. I., and Emerman, M., J. Virol. 69, 882–888 (1995). 34. Sambrook, J., Fritsch, E. F., and Maniatis, T., ‘‘Molecular Cloning: A Laboratory Manual.’’ Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. 35. Subramanian, R. A., and Cohen, E., J. Virol. 68, 6831–6835 (1994). 36. Tristem, M., Marshall, C., Karpas, A., and Hill, F., EMBO J. 11, 3405– 3412 (1992). 37. Wang, J. J., Lu, Y. L., and Ratner, L., J. Gen. Virol. 75, 2607–2614 (1994).
/ m4655$7633
11-21-95 04:37:03
vira
38. Westervelt, P., Trowbridge, D. P., Epstein, L. G., Blumberg, B. M., Li, Y., Hahn, B. H., Shaw, G. M., Price, R. W., and Ratner, L., J. Virol. 92, 2577–2582 (1992). 39. Wu, X., Liu, H., Xiao, H., Kim, J., Seshaiah, P., Natsoulis, G., Boeke, J. D., Hahn, B. H., and Kappes, J. C., J. Virol. 69, 3389–3398 (1995). 40. Yeh, L. C., and Lee, J. C., J. Mol. Biol. 246, 295–307 (1995). 41. Yuan, X., Malsuda, Z., Matsuda, M., Essex, M., and Lee, T. H., AIDS Res. Hum. Retroviruses 6, 1265–1271 (1990). 42. Zhao, L.-J., Mukherjee, S., and Narayan, O., J. Biol. Chem. 269, 15577–15582 (1994). 43. Zhao, L.-J., Wang, L., Mukherjee, S., and Narayan, O., J. Biol. Chem. 269, 32131–32137 (1994).
AP-Virology