The cattle major histocompatibility complex (MHC) class-I possesses HLA-like promoters

Gene, 160 (1995) 249-252 © 1995 ElsevierScienceB.V. All rights reserved. 0378-1119/95/$09.50

249

GENE 08769

The cattle major histocompatibility complex (MHC) class-I possesses HLA-like promoters (Bovine leukocyte antigen; enhancer; interferon response sequence; regulation; transcription)

Jerome S. Harms, Wumin Li and Gary A. Splitter Department of Animal Health and Biomedical Sciences, Universityof Wisconsin-Madison, Madison, WI 53706, USA

Receivedby'(}. Bernardi: 12 September1994;Revised/Accepted:24 November/1 December1994;Receivedat publishers: 13 January 1995

SUMMARY To study the genetic regulation of the cattle major histocompatibility complex (MHC) class-I, a cattle M H C class-I promoter DNA fragment was isolated and characterized for the first time. Semi-degenerate PCR was performed on cattle genomic DNA and the resulting product was isolated, subcloned and sequenced. Sequence comparison of the HLA-A, -B and -C promoters to the cloned product, designated BL3-6prmtr, revealed the cattle M H C class-I promoter to have close homology to human M H C class-I promoters. To address the ability of the cattle M H C class-I promoter to initiate transcription, BL3-6prmtr was subcloned into a luciferase reporter vector and transiently transfected into cattle and human B-lymphoblastoid cell lines. A strong transcription initiation ability of BL3-6prmtr was observed, including the ability of the enhancerA and interferon response sequence (IRS) to upregulate transcription initiation.

INTRODUCTION In addition to the TATA- and CAAT-box sequences necessary for RNA polymerase II positioning, the M H C class-I promoter contains an upstream enhancer region (enhancerA) that partially overlaps the interferon response sequence (IRS). This enhancerA/IRS region is necessary for effecting M H C class-I transcription modulation (Kimura et al., 1986). Additionally, there is a highly Correspondence to: Dr. J.S. Harms, Department of Animal Health and Biomedical Sciences, University of Wisconsin-Madison, 1655 Linden Drive, Madison, WI 53706, USA. Tel. (1-608) 262-0359; Fax (1-608) 262-7420; e-mail:[email protected]

hbbreviations: bp, base pair(s); BL3-6prmtr, promoter for the cattle MHC class-I; BLAST,basic local alignment search tool (Altschul et al, 1990); BoLA, gene encoding bovine leukocyte antigen; cDNA, DNA complementary to RNA; dNTP, deoxyribonucleosidetriphosphate; HSSP, high-scoring segment pair; HLA, gene encoding human leukocyte antigen; IFN, interferon; IRS, interferon response sequence;kb, kilobase(s) or 1000bp; MHC, major histocompatibilitycomplex; nt, nucleotide(s); oligo, oligodeoxyribonucleotide;p, plasmid; PCR, polymerase chain reaction; re-, recombinant; TNF, tumor necrosis factor; tsp, transcription start point(s); u, unit(s). SSDI 0378-1119(95)00051-8

conserved, but poorly understood sequence, known as enhancerB, thought to have enhancer activity in the H-2K gene (Israel et al., 1989). Cattle M H C class-I, known as the BoLA complex, consists of at least two tightly linked surface expressed loci (Toye et al., 1990; Bensaid et al., 1991; Ellis et al., 1992; Joosten et al., 1992). In contrast to the human, mouse, or even pig M H C class-I system, genetic information on the BoLA complex has been limited to studies of cattle M H C class-I cDNA sequences; little is known of the genetic control of cattle M H C class-I expression. Due to the importance of M H C class-I and the need to understand its regulation of expression, our objective was to isolate a functional cattle M H C class-I promoter,

EXPERIMENTALAND DISCUSSION

(a) Semi-degenerate PCR of a cattle MHC class-I promoter The polymerase chain reaction (PCR), using genomic DNA isolated from the cattle B-lymphoblastoid cell line

250 BL3 (Harms and Splitter, 1992), was used to isolate a cattle M H C class-I promoter. Although no BoLA promoter sequence was available, two full-length, apparently functional, M H C class-I e D N A clones had been isolated from a BL3 e D N A library (Ennis et al., 1988). A leader peptide nt sequence of one of these clones, BL3-6, was chosen as the specific 3'-end primer for the PCR while a sequence from the HLA-A2 (Koller and Orr, 1985) promoter was chosen for the degenerate 5' end primer. Using this semi-degenerate primer pair, a 332-bp fragment was isolated, subcloned and sequenced. The sequence revealed the fragment to have elements in c o m m o n with M H C class-I promoters of other species. We have designated this cattle M H C class-I promoter clone as BL3-6prmtr (Fig. 1). The 5'-end oligo primer, derived from the HLA-A2 promoter, was selected to be upstream from all necessary tsp regulatory sequences in hopes that the PCR-derived cattle M H C class-I promoter would contain these important motifs. As shown in Fig. 1, BL3-6prmtr does contain the necessary enhancerA/IRS region, CAAT box, TATA box and tsp. The translated region sequence (shown in capital letters) is identical to that of BL3-6 (Ennis et al., 1988). EnhancerA/IRS BoLA-A HLA-AI HLA-B27 HLA-CW2

gggt**

~a~gggctgt

gtctggggct

..cccc I .... *'g ....

a...attg .g..a,.ct ..... cattg ...... c ..... c.ctg

.<:[<** .ctc**

ttccctgtct cccca*agtt ..... caa .... g.** .... ..... cactc ..a,g ..... ...t.cactc .... g.g...

tcactttctc tctc'aca**a ..*t ...... c . . ,t . c a a ...... ct .... c..ac*** .a.t..mt .... c..ac***

gggacgctct

atattgggca

.... gt.c.a .... g..g.a .... g..g.c

gcc ..... g. cag ..... g. gcg...a.g.

cctgtgtaga ac .... *..a...c.q *,..c.ac.q

. . . .

g

-181

gccctcctqc .t...t.~t. .t...t, .t. ,2...t..t .

12]

EnhancerB ~+ q q , 4 c , t c t r • d...

..

~ ...

t

gtgdt

,-

a.::..

,:

dccaatcdga g,,,

. . . . .

t

ggtgtc

lcggc' :7 . . . . .

1

. . . . .

. <'..

{jl eL<

cgcc~,

...gt

. . . . .

3

c . . t . ,

. . . .

c . . t . .

ttcccgg*~.%

. . . . . .

q.c

g . c . . . *

a.t..,<.

. . . . .

g.c,..*

. . . . . . c: . . . . . ....

A.C

.

t.qcc

.t

.,

. . . . .

TGGGGC

. . . . . . .

.T~..C

.... .~

CC

. . . . . .

C

. . . . . .

7

GC

. . . . . .

C

. . . . . .

~2.

. . . . .

C

. . . . . .

T.

ttctaqaaaa

g . . . . g

accgacccqc

~61

c . . . g . .

. . . . . .

.*

.....

g.. g..

cca*actctq

c g . . . g c

....

a . . g g g

.....

~.

c . . . . g c

....

a . . . g ~

....

a.

. c . . . g t c

....

a . . . g g

....

g.

:GCG

AGCCCTCCTC

C . . . c . . . A

C . . C . . . C . . . A

. . . . . . .

GAGACCCC

C . . . .

(i<'.

,,

t.C

C A ( . . . . . .

. . . . . . .

la.~._c .

acgcqagtcA

GATCCTGACT

C,]GGGGTCCT

.

. . . . .

. . . . .

t a a a g t c t c c

c ~ . t . t * . c

. . . . . . . .

C_tCct t t:::C~ g a c c c a g a g g

. . . . . . . . .

. . . .

~t..s

. . . g . . . < ~ . . . * . . a .

c . . t

t t . . 2

U ~ , . . . c o

~ a t . . c c t

. . . . . . .

.... .....

g , , , . , . . . ~

_a.t..cs

t

gat

C...c...A

,qTGCffGCTCT

. . . . . . . . . .

60

A . . . . . . .

. . . . . . . . . . . . . . . . . .

.....

A . . . . . . . . . . . .

88

Fig. 1. Sequence comparison of the cattle MHC class-I promoter, BL3-6prmtr (GenBank accession No. L19193), to MHC class-I promoter sequences of HLA-A, -B and -C. The cattle MHC class-I promoter sequence, BL3-6prmtr (BoLA-A), is given and compared to human HLA-A1, HLA-B27 and HLA-Cw2 sequences. Dots indicate identity and asterisks indicate deletions introduced to maximizehomology. The enhancerA/IRS and enhancerB are in boldface and boxed. The CAAT box, TATA box and tsp along with the ATG start codon are in boldface and lined. Methods: Cattle genomic DNA, isolated from the B-lymphoblastoid cell line BL3 (Harms and Splitter, 1992), was amplified using primer pairs designed from published sequences of HLA-A2 (Koller and Orr, 1985) for the 5' end (5'AGGCGTTGGCTCTCAGGGTCTCA) and BL3-6(Ennis et al., 1988) for the 3' end (5'-CGGGTCTCAGTCAGGATCAGGA).The PCR fragment was subcloned and sequenced.

(b) Cattle MHC class-I promoter sequence analysis and comparison to HLA After isolating and sequencing the cattle M H C class-I promoter, BL3-6prmtr, we searched the D N A sequence databases using the algorithm BLAST (Altschul et al., 1990). The 5'-end HLA-A2 oligo P C R primer sequence of BL3-6prmtr was not included in the BLAST analysis as this sequence may not be specific for the cattle M H C class-I promoter. The human HLA-A1 gene aligned closest to BL3-6prmtr with all but 5-bp from the 5' end of the sequence used by the BLAST program giving a highscoring segment pair (HSSP) value of 656 (data not shown). Using data derived from BLAST, sequences of the human HLA-A1 (Girdlestone, 1990), HLA-B27 (Weiss et al., 1985) and HLA-Cw2 (Guessow et al., 1987), were retrieved from the GenBank and compared to our cattle M H C class-I promoter sequence, BL3-6prmm Fig. 1 shows the spatial arrangement of the primary M H C class-I transcriptional sequence motifs of the four genes. Homology of the regulatable enhancerA/IRS sequence (nt - 2 2 0 to - 150) of BL3-6prmtr to that of HLA-A1 was fairly good at 71% (50/70) as opposed to HLA-B27 or HLA-Cw2 at 64% (45/70) each. This is in contrast to a similar overall promoter sequence (nt - 2 2 7 to + 1) 70% homology of BL3-6prmtr to HLA-A21, - B 2 7 and - Cw2.

(c) Functional analysis of the cattle MHC class-I promoter To determine transcription initiation ability, BL3-6prmtr was subcloned into a luciferase reporter vector, then transfected into B-lymphoblastoid cell lines consisting of the parental cow cell line, BL3, and the human line, 721.221 (Shimizu and DeMars, 1989). Results, shown in Fig. 2, indicate the ability of BL3-6prmtr to intitiate transcription in both cell lines. We further tested the functionality of the enhancerA and IRS region. HLA M H C class-I promoter studies have shown that trans-acting factors produced after I F N - y treatment act on the IRS region, while trans-acting factors produced after tumor necrosis factor-alpha (TNF-a) treatment act on the enhancerA region (Israel et al., 1989). Both effect an increase in M H C class-I transcription initiation. As shown in Fig. 2, addition of re-IFN- 7 or re-TNF
(d) BL3-6prmtr may be representative of BoLA-A promoters The sequence for the M H C class-I c D N A clone BL3-6 was used for designing the specific primer for the semi-

251

BL3.1

721.221

12000

7000

10000

6000 5000

8000

3

(e) Conclusions

3

(1) The cattle MHC class-I promoter BL3-6prmtr has greatest homology to and contains the same transcriptional motifs as sequences of HLA MHC class-I promoters. (2) BL3-6prmtr can initiate luciferase production using reporter vectors transfected into both cattle and human cell lines. Furthermore, cytokine treatment of transfected cells can upregulate BL3-6prmtr transcription initiation. (3) BL3-6prmtr is probably representative of the BoLAA locus promoters.

4000

.1

6000 3000 J 4000

2000

2000

1000 3

0

0 ~

]

no promoter BL3

MHC class-I loci. Therefore, BL3-6prmtr should be representative of BoLA-A promoters.

6prmCrw/o

•

lymphokine treatment

[]

+re-lFN y

[]

+re-TNF e~

[]

+T cell blast supernatant

Fig. 2. Luciferase assay of transfected cattle and human B-lymphoblastoid cell lines. Luciferase reporter constructs using either no promoter (pGL Basic) or the cattle MHC class-I promoter/enhancer (pGL 6) to drive luciferase expression, were transfected into the cattle and human B lymphoblastoid cell lines BL3.1 and 721.221, respectively. Cell lines were transiently transfected using LipofectAMINE liposome reagent (Life Technologies, Gaithersburg, MD, USA) following the manufacturer's recommended protocol. For cytokine effect studies, 500 u/ml of re-IFN-7, 0.1 ng/ml of re-TNF-~ (Becton Dickinson, Bedford, MA, USA), or 10% supernatant from concanavalin-A-activated cattle T cells were added in the medium. Cell extracts were prepared 16 h later and analyzed using a luciferase assay system (Promega, Madison, WI, USA) measured on a luminometer (Analytical Luminescence Laboratory, San Diego, CA, USA). Measurements are in mean relative light units (RLU) derived from three transient transfections per experiment with less than 10% coefficient of variation.

degenerate PCR and, since others have recently suggested that BL3-6 is representative of the BoLA-A locus (Bensaid et al., 1991; Garber et al., 1994), we propose that BL3-6prmtr is a representative promoter for the BoLA-A locus. Promoter sequence comparisons between HLA MHC class-I loci have shown homology within genes of that particular locus (Messer et al., 1992). For example, the enhancerA/IRS sequences of HLA-A1, -A2, -A3 and -A24 are 98-100% homologous, and the enhancerA/IRS sequences of HLA-B27, -B35 and -B57 are 96-100% homologous. However, the homology of the enhancerA/IRS of HLA-AI to HLA-B27 or -Cw2 is only 70%. Furthermore, we have isolated a MHC class-I enhancerA/IRS sequence from BL3 that is only 73% homologous to the enhancerA/IRS of BL3-6prmtr (Harms and Splitter, 1994), indicating that, like HLA, BoLA has different MHC class-I promoters for different

ACKNOWLEDGEMENTS

This work was supported by USDA 88-CRSR-37265-3730 and 90-37265-5703.

grants

REFERENCES Altschul, S.F., Gish, W., Miller, W., Myers, E.W. and Lipman, D.J.: Basic local alignment search tool. J. Mol. Biol. 215 (1990) 403-410. Bensaid, A., Kaushal, A., Baldwin, C.L., Clevers, H., Young, J.R., Kemp, S.J., MacHugh, N.D., Toye, P.G. and Teale, A.J.: Identification of expressed bovine MHC class-I MHC genes at two loci and demonstration of physical linkage. Immunogenetics 33 (1991) 247-254. Ellis, S.A., Braem, K.A. and Morrison, W.I.: Transmembrane and cytoplasmic domain sequences demonstrate at least two expressed bovine MHC class-I loci. Immunogenetics 37 (1992) 49-56. Ennis, P.D., Jackson, A.P. and Parham, P.: Molecular cloning of bovine class I MHC cDNA. J. Immunol. 141 (1988) 642-651. Garber, T.L., Hughes, A.L., Watkins, D.I. and Templeton, J.W.: Evidence for at least three transcribed BoLA class I loci. Immunogenetics 39 (1994) 257 265. Girdlestone, J.: Nucleotide sequence of an HLA-A1 gene. Nucleic Acids Res. 18 (1990) 6701. Guessow, D., Rein, R.S., Meijer, I., de Hoog, W., Seemann, G.H., Hochstenbach, F.M. and Ploegh, H.L.: Isolation, expression, and the primary structure of HLA-Cwl and HLA-Cw2 genes: evolutionary aspects. Immunogenetics 25 (1987) 313 322. Harms, J.S. and Splitter, G.A.: Impairment of MHC class-I transcription in a mutant bovine B cell line. Immunogenetics 35 (1992) 1-8. Harms, J.S. and Splitter, G.A.: The enhancerA/IRS region of a cattle MHC class-I promoter. Immunogenetics 39 (1994) 372. Israel, A., LeBail, O., Hatat, D., Piette, J., Kieran, M., Logeat, F., Wallach, D., Fellows, M. and Kourilsky, P.: TNF stimulates expression of mouse MHC class-I genes by inducing an NFnB-like enhancer binding activity which displaces constitutive factors. EMBO J. 8 (1989) 3793-3800. Joosten, I., Teale, AJ., Van Der Poel, A. and Hensen, E.J.: Biochemical evidence of the expression of two major histocompatibility complex MHC class-I genes on bovine peripheral blood mononuclear cells. Anim. Genet. 23 (1992) 113 123.

252 Kimura, A., Israel, A., LeBail, O. and Kourilsky, P.: Detailed analysis of the mouse H-2k b promoter: enhancer-like sequences and their role in the regulation of MHC class-I gene expression. Cell 44 (1986) 261-272. Koller, B.H. and Orr, H.T.: Cloning and complete sequence of an HLA-A2 gene: analysis of two HLA-A alleles at the nucleotide level. J. Immunol. 134 (1985) 2727-2733. Messer, G., Zemour, J., Orr, H.T., Parham, P., Weiss, E.H. and Girdlestone, J.: HLA-J, a second inactivated MHC class-I HLA gene related to HLA-G and HLA-A. J. lmmunol. 148 (1992) 4043-4053. Shimizu, Y. and DeMars, R.: Production of human cells expressing

individual transferred HLA-A, -B, -C genes using an HLA-A, -B, -C null human cell line. J. Immunol. 142 (1989) 3320 3328. Toye, P.G., Machugh, N.D., Bensaid, A.M., Alberti, S., Teale, A.J. and Morrison, W.I.: Transfection into mouse L cells of genes encoding two serologically and functionally distinct bovine class I MHC molecules from a MHC-homozygous animal: evidence for a second class I locus in cattle. Immunology 70 (1990) 20-26. Weiss, E.H., Kuon, W., Doerner, C., Lang, M. and Riethmueller, G.: Organization, sequence and expression of the HLA-B27 gene: a molecular approach to analyze HLA and disease associations. Immunobiology 170 (1985) 367-380.