The CB2 cannabinoid receptor regulates human sperm cell motility

The CB2 cannabinoid receptor regulates human sperm cell motility Ekaitz Agirregoitia, Ph.D.,a Arkaitz Carracedo, Ph.D.,b,c Nerea Subir an, J.D.,a Asier Valdivia, Ph.D.,a a a Naiara Agirregoitia, Ph.D., Laura Peralta, J.D., Guillermo Velasco, Ph.D.,c and Jon Irazusta, Ph.D.a a Department of Physiology, Faculty of Medicine and Dentistry, University of the Basque Country, Leioa, Biscay, Spain; b Cancer Biology Program, Department of Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts; and c Department of Biochemistry and Molecular Biology, School of Biology, Complutense University, Madrid, Spain

Objective: To analyze the expression and distribution of cannabinoid receptors in human sperm cells and evaluate the effects of activation of receptors by specific agonists and antagonists, with a special emphasis on the CB2 receptor. Design: We performed expression assays for CB1 and CB2 by reverse transcriptase PCR, Western blot, and immunofluorescence techniques in spermatozoa and performed motility analysis after incubation of semen samples with cannabinoid agonists and CB2 antagonist SR144528. Setting: Academic research laboratory. Patient(s): Semen from 50 normozoospermic, healthy human donors. Intervention(s): Spermatozoa isolated from semen by two consecutive swim-ups were used for all techniques. Main Outcome Measure(s): Reverse transcriptase PCR amplification gels, immunoblots, indirect immunofluorescence antibody assays, and percentage of motile sperm. Result(s): We have verified the presence of CB1 and CB2 receptors in human spermatozoa. The distribution of both of these receptors was distinct. Incubation with selective cannabinoid receptor agonists induced a significant reduction in the proportion of rapidly progressive motile spermatozoa, and whereas the CB1 agonist increased the proportion of immobile sperm cells, the CB2 receptor agonist increased the slow/sluggish progressive sperm cell population. The effect of the CB2 agonist was antagonized by the CB2-specific antagonist. Conclusion(s): The functional CB2 cannabinoid receptor is present in human spermatozoa and regulates the sperm motility in a more distinct manner than CB1. (Fertil Steril 2010;93:1378–87. 2010 by American Society for Reproductive Medicine.) Key Words: Cannabinoids, receptor activation, human sperm motility

Endocannabinoids are fatty acid derivates that exert their effects by binding to membrane receptors. To date, two cannabinoid-specific Gi/o protein–coupled receptors have been cloned and characterized from mammalian tissues. They show distinctive distribution profiles (1): the CB1 cannabinoid receptor (2) is expressed in a wide variety of tissues, being particularly abundant in the brain, whereas the CB2 receptor (3) is mainly expressed in the immune system. In the male reproductive system, the CB1 receptor is widely distributed in different organs, such as the prostate gland (4) and testis (5), and in Leydig cells (6). In contrast, the CB2 cannabinoid receptor has been reported to be found in the prostate epithelium (7), testis (8), and Sertoli cells (9). The presence Received December 2, 2008; revised January 20, 2009; accepted January 22, 2009; published online March 27, 2009. Supported by a grant from the Spanish Ministry of Education and Science (BFU2006-07779/BFI). E.A. has nothing to disclose. A.C. has nothing to disclose. N.S. holds a fellowship from the University of the Basque Country (Research and Innovation Deanship). A.V. has nothing to disclose. N.A. has nothing to disclose. L.P. has nothing to disclose. G.V. has nothing to disclose. J.I. has nothing to disclose. Reprint requests: Ekaitz Agirregoitia, Department of Physiology, Faculty of Medicine and Dentistry, University of the Basque Country, P.O. Box 699, E-48080, Bilbao, Biscay, Spain (TEL: þ34 94 601 5671; FAX: þ34 94 601 5662; E-mail: [email protected]).

1378

of cannabinoid receptors has been demonstrated in sperm and was first reported sea urchins (10), which was followed by the discovery in sperm of vertebrates such as humans (11, 12), boars (13), mice, rats, and frogs (6, 14). The main psychoactive component of marijuana, delta9tetrahydrocannabinol (THC), produces a marked decrease in the levels of plasma PRL and LH in rats (15) and in testosterone production by the Leydig cells of the testis (16). More recently, it has been reported that anandamide (AEA), an endogenous cannabinoid ligand, also decreases serum LH, PRL, and testosterone levels in rats (17, 18). Results obtained from sea urchins showed that cannabinoids can reduce the fertilizing capacity of sperm (19, 20) by inhibiting the acrosome reaction (21). It has thus been proposed that cannabinoid receptors in sea urchin sperm could have a role in the blockade of the acrosome reaction (22). Anandamide is known to be present in seminal plasma (11) and has been implicated in the inhibition of sperm motility and the acrosome reaction via CB1 activation (12–14). In fact, boar sperm cells have recently been reported to contain the biochemical machinery to bind and degrade AEA (13). More recently, it has been postulated that in mice, modulation of the endocannabinoid signaling occurs in the caput

Fertility and Sterility Vol. 93, No. 5, March 15, 2010 Copyright ª2010 American Society for Reproductive Medicine, Published by Elsevier Inc.

0015-0282/10/$36.00 doi:10.1016/j.fertnstert.2009.01.153

epididymis, because sperm precociously acquire motility in this area in the absence of CB1 (23). Analyses of cannabinoid function reported to date have focused on the implication of the CB1 receptor in sperm cell function. However, although some authors did not discard the presence of CB2 receptors in sperm cells (24), a clear characterization of this receptor on sperm has not yet been performed. Therefore, the current study was aimed at characterizing in depth, using a variety of experimental methods, the differential expression, distribution, and function of the two cannabinoid receptors in human sperm cells, with special emphasis on the role of CB2 in spermatozoa motility. MATERIALS AND METHODS Reagents ACEA was obtained from Tocris Bioscience (Ellisville, MI). JWH-015 and all other reagents were purchased from SigmaAldrich (St. Louis, MO). Sperm Preparation Human semen was obtained by masturbation after 2 to 3 days of abstinence. All of the donors (aged 25–40 years) were healthy and normozoospermic according to World Health Organization standards (25) and had no previous history of cannabinoid drug consumption. Ethical approval was obtained from the Ethics Committee of the University of the Basque Country and from the Clinical Research Ethical Committee of the local Cruces Hospital (Biscay, Gurutzeta, Spain). Informed consent was obtained from all donors. Samples were ejaculated into sterile containers and allowed to liquefy at 37 C for 30 minutes before processing. Semen volume, as well as sperm concentration and motility, were measured for each sample. A swim-up technique was applied twice to semen samples to remove all nonmotile cells, such as round cells. We used multiple tubes with small volumes of fresh semen (250 mL) and 600 mL of Tyrode’s medium, described by Flesch et al. (26) (100 mM NaCl, 21.7 mM lactate, 20 mM HEPES, 15 mM NaHCO3, 5 mM glucose, 3.1 mM KCl, 2.0 mM CaCl2, 1.0 mM pyruvate, 0.4 mM MgSO4, 0.3 mM NaH2PO4, and 100 mg/mL kanamycin, pH 7.4), per tube. This medium contained 7 mg/mL of bovine serum albumin (BSA). After 60 minutes incubation at 37 C, most of the upper Tyrode layer was removed from each tube. The resulting sample was placed in a 15-mL centrifuge tube and centrifuged at 800 g for 10 minutes. We performed the second swim-up with this pellet in the same way. Finally, the pellet was washed and resuspended in fresh BSA-free Tyrode’s medium for the estimation of sperm concentration and motility. Only sperm cells collected by means of this swim-up technique were used in subsequent procedures. All samples were checked visually by microscope to verify the absence of round cells. Reverse Transcription-PCR Analysis The RNA from swim-up spermatozoa, cerebral cortex, and Jurkat cells were isolated with the RNeasy Protect kit Fertility and Sterility

(Qiagen, Hilden, Germany), including a deoxyribonuclease (DNase) digestion step using an RNase-free DNase kit (Qiagen) to exclude possible contamination by genomic DNA. The quality of total RNA preparations of spermatozoal RNA was verified by 2% agarose gel electrophoresis. Complementary DNA was obtained with Transcriptor reverse transcriptase (RT; Roche, Basel, Switzerland), and primers used for PCR were as follows: Human CB1 receptor 50 - CGTGGGCAGCCTGTTCCTCA -30 50 - CATGCGGGCTTGGTCTGG -30 (408 bp product) (27) Human CB2 receptor 50 - CGCCGGAAGCCCTCATACC -30 50 - CCTCATTCGGGCCATTCCTG -30 (522 bp product) (27). Human ACTB (b-actin) 50 - TCCCTGGAGAAGAGCTACGA -30 50 - ATCTGCTGGAAGGTGGACAG -30 (362 bp product; exon spanning) (28) used as an internal control. Polymerase chain reactions were performed using the following parameters: 95 C for 5 minutes, 40 cycles at 95 C for 30 seconds, 58 C for 30 seconds, and 72 C for 1 minute, followed by a final extension step at 72 C for 5 minutes. The mixture was electrophoretically separated on a 2% agarose gel. The primers for CB1 receptors and CB2 receptors were located on the same exon of each respective gene (i.e., they do not span introns). Thus, we verified the possible carryover of genomic DNA during the extraction process by performing PCR in the absence of reverse transcriptase. If genomic DNA were present, it would be amplified in subsequent PCR. Primers for CD4 (forward, 50 - CAGGGAAAGAAAGTGGTGC T -30 ; reverse, 50 - TTCTGGTCCTCCA CTTCACA -30 ; 275 bp; exon spanning) and acrosin (forward, 50 - AACTCTGCGACAGAGGGAAA -30 ; reverse, 50 - CACACATTGGTTGGCTGAAC -30 ; 272 bp; exon spanning) were used to exclude the presence of leukocyte contamination and to verify the presence of sperm complementary DNA, respectively (29). The melting temperature was 60 C for both primer pairs. The RT-PCR products were analyzed by 2% agarose gel electrophoresis. Preparation of Sperm Membranes Sperm membranes were prepared as previously described (30), with a slightly modified lysis buffer (phosphate-buffered saline [PBS] and 1% [v/v] Triton-X100, containing protease inhibitor cocktail). Human cerebral cortex and Jurkat cell membranes were prepared as previously described (31). A sample of the human brain cortex was kindly donated by Leyre Urig€ uen (Euskal Herriko Unibertsitatea, Leioa, Basque Country, Spain) and Jurkat cells were kindly donated by Juan Carlos Lacal (Instituto de Investigaciones Biomedicas, Madrid, Spain). SDS/PAGE and Immunoblotting Membrane pellets were suspended in lysis buffer, then protein extracts were diluted in Laemmli sample buffer 1379

containing b-mercaptoethanol (5% v/v) and boiled for 5 minutes. Proteins (human sperm, approximately 106 cells per lane; gray matter of the human prefrontal cerebral cortex, 30 mg; Jurkat cells, 30 mg) were loaded into 12% resolving gels and separated by one-dimensional SDS/PAGE. Proteins were then transferred to polyvinylidene fluoride (PVDF) membranes using the Mini Trans-Blot electrophoretic transfer system (Bio-Rad Laboratories, Hercules, CA). Blotted membranes were treated and revealed as previously reported (30). Polyclonal rabbit anti-CB1 receptor antiserum from the first 99 amino acid residues from human CB1 (1:250; Affinity BioReagents, Golden, CO) and anti-CB2 receptor antiserum from the human CB2 receptor amino acids 20–33 (1:200; Cayman Chemicals, Ann Arbor, MI) were used overnight at 4 C. The membrane was incubated for 2 hours at room temperature with a horseradish peroxidase-conjugated goat anti-rabbit IgG secondary antibody (Affinity BioReagents, Golden, CO) diluted 1:2,500. Membranes incubated without the primary antiserum were used as negative controls. Immunofluorescence In order to immunocytochemically localize the two receptors, sperm were isolated using swim-up as described previously, suspended in PBS, and smeared onto a slide coated with poly-L-lysine. Duplicate slides were prepared for each sample and were fixed with 3% paraformaldehyde for 10 minutes followed by incubation in cold methanol (–20 C) for 10 minutes. The slides were thenwashed three times in PBS and incubated for 20 minutes in PBS/10% (v/v) bovine fetal serum. For indirect immunofluorescence staining, slides were incubated with anti-CB1 or anti-CB2 receptor antisera at a dilution of 1:400 overnight at 4 C. Slides were then washed in PBS three times, incubated with Alexa Fluor 488 goat anti-rabbit IgG secondary antibody (Molecular Probes; Eugene, OR) for 2 hours at 37 C in the dark, washed in PBS three times, assembled with Fluoromount G (EMS, Hatfield, United Kingdom) and finally examined by confocal microscopy. Two negative controls were performed, [1] using a rabbit immunoglobulin fraction instead of the specific primary antiserum to eliminate the possibility that any staining was due to nonspecific binding of rabbit IgG before secondary antibody addition and [2] omitting the primary antibody before secondary antibody addition. Incubation Medium Spermatozoa were separated by swim-up, washed, and resuspended to approximately 30  106 cell/mL. They were then incubated at different times at 37 C with different doses of CB1 selective agonist (ACEA) and CB2 selective agonist (2-methyl-1-propyl-1H-indol-3-yl)-1-naphtalenyl-methanone (JWH-015) (duplicate incubations for each condition). The basal solution and vehicle control in all cases was Tyrode’s medium without BSA, because it is known to bind endocannabinoids, thus impairing biochemical and functional assays 1380

Agirregoitia et al.

CB2 receptor in human sperm

(13). The ACEA stock solution was prepared in ethanol and JWH-015 was prepared in DMSO. Control incubations contained the same amount of ethanol or DMSO. All media were made on the day of use and maintained at an osmolarity of 300 mOsm kg1 at pH 7.4 and 37 C. We evaluated the effects of activation of each cannabinoid receptor by these specific agonists at concentrations of 105 M, 106 M and 107 M used in previous studies (12). In order to ascertain the specificity of the action of the CB2 agonist, we assayed antagonism with equimolecular doses of SR144528 prepared in DMSO (added at the same time than agonist). Finally, parallel control experiments were performed to evaluate if this antagonist, alone, induces some effect on sperm motility. Motility Analysis Motility analysis was conducted by computer-assisted sperm analysis (CASA) (Sperm Class Analyzer, S.C.A., Microptic, Barcelona, Spain) at 0, 0.5, 1, and 2 hours following drug addition to the medium. Setting parameters and the definition of measured sperm motion parameters for CASA were established by the manufacturer: number of frames to analyze: 25; number of frames/s: 25; straightness threshold: 80%; cell size range (low): 2; cell size range (high): 60; volume R 3.0 mL; sperm concentration/mL R 20  106; forward motility R 60%. To measure both sperm concentration and motility, aliquots of semen samples (7.5 mL) were placed into a prewarmed (37 C) Makler counting chamber (Sefi Medical Instruments, Haifa, Israel). A minimum of 100 sperm from at least two different drops of each sample was analyzed from each specimen. Percent motile sperm was defined by the World Health Organization (25): ‘‘A’’ grade sperm (rapidly progressive with velocity R25 mm/s at 37 C), ‘‘B’’ grade (slow/sluggish progressive with velocity R5 mm/s but < 25 mm/s), ‘‘C’’ grade (nonprogressive motility with velocity < 5 mm/s) and ‘‘D’’ grade (immobile). Statistics Results shown represent mean  SEM. Statistical analysis was performed by ANOVA with a post hoc analysis by the protected least significant difference test (SPSS v14.0; SPSS Inc., Chicago, IL). RESULTS No somatic contamination of sperm samples was observed under microscopy following the double swim-up performed to remove all nonmotile cells (data not shown). As shown in Figure 1A, a wide range of RNA was isolated from pure preparations of spermatozoa. The absence of detectable 18S and 28S bands in the spermatozoal preparation, compared with the cerebral cortex and Jurkat cell controls, is indicative of the absence of large amounts of such RNA species in the sperm samples (32). Moreover, the absence of CD4 in the spermatozoal preparation indicates the absence of leukocyte Vol. 93, No. 5, March 15, 2010

FIGURE 1 (A) Electrophoretic analysis of RNA preparations from spermatozoa (Sp), cerebral cortex (Cx) and Jurkat cells (Jr), showing the absence of detectable 18S and 28S bands in spermatozoal sample. (B) Electrophoretic analysis of RT-PCR products for CD4 and acrosin in human sperm samples, showing the absence of CD4 and the presence of acrosin (272-bp band).

Agirregoitia. CB2 receptor in human sperm. Fertil Steril 2010.

contamination, whereas the presence of acrosin verifies the presence of sperm complementary DNA (Fig. 1B).

Human Sperm Cells Maintain Cannabinoid Receptor mRNA We detected the presence of CB1 and CB2 receptor transcripts in human spermatozoa using RT-PCR. The expected 408-bp fragment for CB1 receptor was detected in samples of gray matter of human prefrontal cerebral cortex (positive control) and in sperm but not in Jurkat cells (negative control; Fig. 2). The 522-bp fragment corresponding to the CB2 receptor was detected in Jurkat cells (positive control) and in sperm, but not in samples of gray matter of human prefrontal cerebral cortex (negative control; Fig. 2). The housekeeping gene ACTB was detected in all tissues (Fig. 2). The absence of amplicons in the retrotranscriptase negative controls confirms the absence of genomic DNA in each tissue (Fig. 2).

Human Sperm Cells Express CB1 and CB2 Receptor Proteins Figure 3 shows representative Western blots using plasma membranes from human sperm, gray matter of human prefrontal cerebral cortex, and Jurkat cells. The anti-CB1 receptor polyclonal antiserum labeled a band at 58 kDa in sperm protein extracts and in the cortex, but not in Jurkat cells (Fig. 3A). The anti-CB2 receptor polyclonal antiserum recognized a band at 44 kDa in sperm and in Jurkat cells, but not in the gray matter of the prefrontal cerebral cortex (Fig. 3B). When anti-CB1 or anti-CB2 receptor antisera were omitted before secondary antibody addition, no bands appeared (data not shown).

Localization of CB1 and CB2 Receptors in Human Sperm Immunofluorescence analysis revealed that the CB1 receptor was present in the plasma membrane at the front part of the sperm head (over the acrosomal region), in the middle region,

FIGURE 2 Ethidium bromide-stained 2% agarose electrophoresis gel of the RT-PCR products for CB1 and CB2 cannabinoid receptors and b-actin (ACTB) in human sperm, gray matter from the human prefrontal cerebral cortex and Jurkat cells. CB1: amplified fragment using primers specific for the human CB1 cannabinoid receptor (408-bp band). CB2: amplified fragment using primers specific for the human CB2 cannabinoid receptor (522-bp band). ACTB was used as an internal control (362bp band). –RT indicates the negative control obtained in the absence of reverse transcriptase. n ¼ 5; a representative RT-PCR experiment is shown.

Agirregoitia. CB2 receptor in human sperm. Fertil Steril 2010.

Fertility and Sterility

1381

binding was not observed in the presence of rabbit immunoglobulin fraction (Fig. 4G).

FIGURE 3 (A) Western blotting analysis of CB1 receptor in human sperm (Sp), gray matter from the human prefrontal cerebral cortex (Cx) and Jurkat cells (Jr). (B) Western blotting of protein extracts from Sp, Cx and Jr, using a rabbit antiserum against the CB2 receptor. Molecular weights (kDa) are indicated on the left. Western blots representative of those obtained with five normozoospermic donors are shown.

Agirregoitia. CB2 receptor in human sperm. Fertil Steril 2010.

and along the tail (Fig. 4A). In approximately 15% of cells, prolonged staining of the postacrosomal region in the head was observed (Fig. 4B). In contrast, CB2 cannabinoid receptor immunostaining was found mainly in the plasma membrane at the sperm head in the postacrosomal region, in the middle region, and less intensely in the tail (Fig. 4C). In 20% of cells, we observed staining in the front part of the head (Fig. 4D). When the anti-CB1 and anti-CB2 receptor antisera were omitted before secondary antibody addition, specific fluorescence was not evident (Fig. 4E). Unspecific

Effects of Cannabinoid Agonists and Antagonists on Sperm Motility The CB1 receptor agonist ACEA decreased the percentage of A grade spermatozoa in a dose-dependent (Fig. 5A) and time-dependent (Fig. 5C) manner, whereas the percentage of D grade cells increased (Fig. 5 A and C). The differences were significant for A and D grades at 2 hours and at a concentration of 105 M ACEA (Fig. 5 A and C). The percentage of C and B grade cells was unaffected during the incubation time (Fig. 5C) and at different ACEA doses at 2 hours (Fig. 5A). Challenge with the CB2 receptor agonist JWH-015 decreased the percentage of A grade cells in a dose-dependent (Fig. 5B) and time-dependent (Fig. 5D) manner, compared with vehicle-treated cells, whereas B grade motility analysis showed a dose-dependent (Fig. 5B) and time-dependent (Fig. 5D) increase on JWH-015 treatment. The differences were significant for A and B grades at 2 hours and at a concentration of 105 M JWH-015 (Fig. 5B and D). In this case, the percentage of C and D grade cells remained unaffected during the incubation time (Fig. 5D) and at different JWH-015 doses at 2 hours (Fig. 5B). To further analyze the CB2-selective effect of JWH-015 at 2 hours, we coincubated this compound with the same concentration of the CB2 antagonist SR144528. The effect of JWH-015 on the percentage of A and B grade sperm motility cells was blunted by coincubation with SR144528, the effect

FIGURE 4 Immunofluorescence analysis of cannabinoid receptors in human sperm cells. The distribution of CB1 (A and B) and CB2 (C and D) cannabinoid receptors is shown. A negative control (E) consisting of omission of the primary antiserum and its phase contrast image (F) is shown. Also illustrated is an additional negative control (G) consisting of incubation with rabbit immunoglobulin fraction instead of the primary antiserum and its phase contrast image (H); n ¼ 3. Representative photomicrographs are shown. The scale bar represents 10 mm.

Agirregoitia. CB2 receptor in human sperm. Fertil Steril 2010.

1382

Agirregoitia et al.

CB2 receptor in human sperm

Vol. 93, No. 5, March 15, 2010

FIGURE 5 Effects of agonists of the CB1 receptor (ACEA) and CB2 receptor agonists (JWH-015) on human sperm motility. (A) Dose-response to ACEA, measuring the percentage of A, B, C and D grade sperm after incubation for 2 hours (n ¼ 5; aP < 0.05 vs. control; bP < 0.01 vs. control; cP < 0.05 vs. ACEA-treated [107 M] cells; dP < 0.05 vs. all other compared treatments for this grade). (B) Response to varying doses of JWH-015 in terms of the percentage of A, B, C and D grade sperm after incubation for 2 hours (n ¼ 5; aP < 0.05 vs. control; bP < 0.01 vs. control; cP < 0.05 vs. all other compared treatments for this grade). (C) Time-course of percentage of A, B, C and D grade sperm after addition of ACEA 10-5 M (n ¼ 5, aP < 0.05 vs. hour 0; bP < 0.01 vs. hour 0; cP < 0.05 vs.0.5 hours). (D) Time-course of percentage of A, B, C and D grade sperm after JWH-015 (105 M) addition (n ¼ 5; aP < 0.05 vs. hour 0; bP < 0.01 vs. hour 0). bd

Sperm motility %

60

40

ac

20

0

C

Control ACEA 10-7M ACEA 10-6M ACEA 10-5M

A

B

C

ACEA 10-5M A C B D

60 Sperm motility %

A

40 a 20

b b

0

D

ac

0

Motility grade (WHO)

0.5

1

2

Time (hours)

D

B 60

b 40

Control JWH-015 10-7M JWH-015 10-6M JWH-015 10-5M

a b 20

0

A

B

C

D

Motility grade (WHO)

60

Sperm motility %

Sperm motility %

c

JWH-015 10-5M A C B D a

40 a

a b

20

0

0

0.5

1

2

Time (hours)

Agirregoitia. CB2 receptor in human sperm. Fertil Steril 2010.

being significant at 105 M (Fig. 6). Incubation with the CB2 antagonist SR144528 alone did not further alter the motility of sperm in the samples (Fig. 6). DISCUSSION CB1 and CB2 cannabinoid receptor expression has been reported in a wide variety of tissues. Recently, the expression and function of the CB1 receptor in human and boar spermatozoa has been reported (12, 13). However, much less is known about the role of the CB2 receptor in these cells. The present study demonstrates for the first time that functional CB2 receptors are present in human spermatozoa and that their activation modulates sperm cell motility. CB1 mRNA has been detected previously in ejaculated human sperm (12). Here, we report the presence of both CB1 Fertility and Sterility

and CB2 mRNA in mature sperm cells, indicating that cannabinoid receptor proteins are synthesized by spermatogenic cells in the testis, rather than being acquired during transit via the epididymis, as are certain other plasma membrane proteins that are required for fertilization (22, 33). This idea is reinforced because CB1 protein has been detected during all stages of sperm development, from spermatogonia to mature spermatozoa, in the mouse testis (6). Moreover, the presence of CB receptor proteins cannot be attributed to release from prostasomes (34, 35), because CB receptors have not been reported in these membranous storage vesicles (36). The function of this mRNA in mature spermatozoa is currently unknown. It has been reported that mature mammalian sperm are not transcriptionally active, because of their highly condensed chromatin and the scarcity of cytoplasm capable of supporting translation (37). Therefore, it has 1383

FIGURE 6 Effects of CB2 receptor agonism (JWH-015) and antagonism (SR144528) on human sperm motility. (A) Doseresponse to JWH-015, JWH-015 þ SR144528 or SR144528 alone, in terms of the percentage of A grade sperm after incubation for 2 hours (n ¼ 5; aP < 0.05 vs. all other compared treatments for this concentration). (B) Doseresponse to JWH-015, JWH-015 þ SR144528 or SR144528 alone, in terms of the percentage of B grade sperm after incubation for 2 hours (n ¼ 5; aP < 0.05 vs. all other compared treatments for this concentration). (C) Timecourse of modulation of the percentage of A grade sperm after addition of JWH-015, JWH-015 þ SR144528 or SR144528 (105 M; n ¼ 5; aP < 0.05 vs. hour 0). (D) Time-course of alteration of the percentage of B grade sperm after addition of JWH-015, JWH-015 þ SR144528 or SR144528 (105 M; n ¼ 5, aP < 0.05 vs. hour 0).

A

Control JWH-015 JWH-015 + SR144528 SR144528

A grade %

A grade %

50.00

C

40.00

Control JWH-015 JWH-015 + SR144528 SR144528

60.00

40.00

a a a

30.00

a

a 20.00

10-7

10-6

20.00

10-5

0

Concentration (M)

D 50.00

B

B grade %

40.00

Control JWH-015 JWH-015 + SR144528 SR144528

a

30.00

2

a

30.00

20.00

20.00 10.00

1

Control JWH-015 JWH-015 + SR144528 SR144528

40.00

B grade %

50.00

0.5

Time (hours)

10.00

10-7

10-6

10-5

Concentration (M)

0

0.5

1

2

Time (hours)

Agirregoitia. CB2 receptor in human sperm. Fertil Steril 2010.

been postulated that sperm cells may retain some mRNA expressed during spermatogenesis (38) to be subsequently translated during the early stages of zygote formation (39). In line with this idea, previous studies have shown that some mRNAs are selectively kept in mature sperm cells, whereas others are always absent (28, 40). Thus, it is possible that CB1 and CB2 receptor mRNAs are selectively maintained in mature sperm cells to be subsequently translated into protein at fertilization. Western blot analysis revealed the presence of CB1 and CB2 protein in human spermatozoa. In regard to CB1, the band of approximately 58 kDa, which also appeared in the sample of gray matter from the human prefrontal cerebral cortex, coincides in size with previous reports (12, 31, 41). Alternatively, the band of approximately 44 kDa, observed in human sperm using an anti-CB2 antibody, also appeared in Jurkat cells, was used as a positive control, and approxi1384

Agirregoitia et al.

CB2 receptor in human sperm

mately corresponds to its theoretical molecular mass (42). Maccarrone et al. (13) showed a weak signal for CB2 cannabinoid receptors in Western blot and that approximately 15% of specific binding of [3H]CP55.940 to boar sperm was blocked by the CB2 cannabinoid receptor selective antagonist SR144528. Therefore, our data extend these results and corroborate the existence of the CB2 receptor in human sperm. Immunofluorescence analysis of human spermatozoa also revealed the presence of CB1 and CB2 receptors on the plasma membrane. CB1 staining over the acrosomal region and midpiece of sperm cells corroborated the findings of previous studies (12), although we also detected immunoreactivity in the tail; this receptor was detected in the postacrosomal region, as reported for boar sperm (13), in only a few cells. Alternatively, CB2 receptor immunoreactivity was mainly localized in the postacrosomal region, midpiece, and the tail of sperm cells. The unique distribution patterns of CB1 Vol. 93, No. 5, March 15, 2010

and CB2 receptor immunoreactivity suggest that these receptors may participate in distinct physiological processes. It is noteworthy that the localization of cannabinoid receptors was not homogeneous throughout the sample, as has been described for a wide array of receptors and proteins (40, 43, 44). These different staining patterns detected in the same samples would indicate that the membranes of these cells may be in a different functional state, because during the activation of the sperm cell, which can take place spontaneously (13), the sperm plasma membrane undergoes reorganization to achieve the ability to fertilize the oocyte (45). Spermatozoa mature during epididymal transit because of a series of morphological, biochemical, and physiological changes. Once human spermatozoa, in seminal plasma, are deposited in the vagina, they must swim through the cervical mucus, traverse the uterus, enter the oviduct, and finally bind to the oocyte if they have been ‘‘capacitated’’ during transport through the female reproductive tract (46). The different physical and chemical composition of microenvironments that spermatozoa encountered, will condition the sperm motility patterns (47). Regarding the cannabinoids, it has been suggested the possible existence of an AEA-gradient within the female reproductive tracts regulated by the differential expression of enzymes involved in the release and removal of AEA in mouse oviducts (48). Consequently, variable concentrations of different endocannabinoids encountered in the male and female reproductive tracts could in principle modulate sperm cell motility in a differential manner. Thus, the increase in the proportion of immotile sperm produced by the selective CB1 receptor agonist ACEA in a time- and dose-dependent manner corroborates the inhibitory role assigned to the CB1 receptor in previous works (12, 14, 22). In contrast, incubation of sperm cells with a selective CB2 receptor agonist JWH-015, did not increase the proportion of D grade, immotile sperm, but instead shifted a proportion of cells from A grade to B grade motility. This effect of the CB2 agonist was reversed by the CB2 receptor specific antagonist SR144528, demonstrating the specificity of this effect. This differential modulation of sperm cell motility by CB1 and CB2 receptors confers additional degrees of freedom on the endocannabinoid signaling system, thus allowing greater fine tuning. Because an endogenous agonist will simultaneously activate both CB1 and CB2 receptors, leading to up- and down-regulation of the motility of subpopulations of sperm cells, the resulting physiological effects of the presence of agonist can be highly variable, in a dose-dependent manner. In fact, it has already been reported that decapacitation molecules (49) are adsorbed onto the sperm head plasma membrane during transit through the male and female reproductive tracts to stabilize the spermatozoa, preventing it from capacitation and concomitant hyperactive motility (46). Thus, the completion of capacitation in an inappropriate place could result in poor sperm transport (50) and could mark the beginning of cell-membrane destabilization (51). Alternatively, only spermatozoa that have good progressive motility are able to enter the mucus (52), suggesting that Fertility and Sterility

the control of motility must be well regulated to maintain spermatozoa in the needed state at the needed moment. Consequently, the concentration of endocannabinoids through the male and female tracts, the level of expression of cannabinoid receptors in spermatozoa and the affinity of these substances for the CB1 and/or CB2 receptors may participate critically in the control of sperm motility, and each receptor subtype may regulate sperm cell behavior in vivo in a distinct manner. As a corollary, it may be important to caution that the consumption of exogenous cannabinoids, such as THC, could likewise disrupt the fine-tuned physiological processes associated with sperm cell motility (53, 54). The results of the present study together with previous studies (11, 22, 54) demonstrate that the role of cannabinoids in the regulation of male reproductive physiology is more complex than thought until now, because these compounds have a direct effect on the hypothalamus-pituitary-gonad axis (18) and on human sperm. Importantly, the presence of the CB2 receptor in these cells suggests a more relevant role of cannabinoids in regulating sperm physiology, in both male and female reproductive tracts. The distinct effects of CB1 and CB2 receptor activation on the motility of spermatozoa together with the distinct expression patterns suggest that each receptor type has specific functions, because the highly polarized structure and function of spermatozoa requires the compartmentalization of particular metabolic and signaling pathways to specific regions (55, 56). Moreover, the present results raise the intriguing possibility that the endocannabinoid system, through the synthesis and degradation of different ligands, may tightly control sperm motility at different steps of the reproductive process. It will be interesting to determine whether deregulation of this signaling system occurs in pathologies involving sperm cell motility. In conclusion, we report for first time the presence of functional CB2 cannabinoid receptors in human sperm membranes and we show that CB1 and CB2 receptors participate in distinct manners in regulating sperm motility. These findings suggest that the cannabinoid system may be a useful biochemical tool for the diagnosis and treatment of male infertility and increase the potential therapeutic applications of nonpsychotropic cannabinoid compounds. Acknowledgments: We thank Ricardo Andrade (University of the Basque Country) for help for confocal microscopy analysis and Jaime Zubero (University of the Basque Country) for his important technical assistance. SR 144528 was kindly donated by Sanofi-Aventis (Montpellier, France).

REFERENCES 1. Howlett AC, Barth F, Bonner TI, Cabral G, Casellas P, Devane WA, et al. International Union of Pharmacology. XXVII. Classification of cannabinoid receptors. Pharmacol Rev 2002;54:161–202. 2. Matsuda LA, Lolait SJ, Brownstein MJ, Young AC, Bonner TI. Structure of a cannabinoid receptor and functional expression of the cloned cDNA. Nature 1990;346:561–4. 3. Munro S, Thomas KL, Abu-Shaar M. Molecular characterization of a peripheral receptor for cannabinoids. Nature 1993;365:61–5. 4. Ruiz-Llorente L, Sanchez MG, Carmena MJ, Prieto JC, SanchezChapado M, Izquierdo A, et al. Expression of functionally active

1385

5.

6. 7.

8.

9.

10.

11.

12.

13.

14.

15.

16. 17.

18.

19.

20.

21.

22.

23.

24.

cannabinoid receptor CB1 in the human prostate gland. Prostate 2003;54: 95–102. Galiegue S, Mary S, Marchand J, Dussossoy D, Carriere D, Carayon P, et al. Expression of central and peripheral cannabinoid receptors in human immune tissues and leukocyte subpopulations. Eur J Biochem 1995;232:54–61. Gye MC, Kang HH, Kang HJ. Expression of cannabinoid receptor 1 in mouse testes. Arch Androl 2005;51:247–55. Sarfaraz S, Afaq F, Adhami VM, Mukhtar H. Cannabinoid receptor as a novel target for the treatment of prostate cancer. Cancer Res 2005;65:1635–41. Brown SM, Wager-Miller J, Mackie K. Cloning and molecular characterization of the rat CB2 cannabinoid receptor. Biochim Biophys Acta 2002;1576:255–64. Maccarrone M, Cecconi S, Rossi G, Battista N, Pauselli R, FinazziAgro A. Anandamide activity and degradation are regulated by early postnatal aging and follicle-stimulating hormone in mouse Sertoli cells. Endocrinology 2003;144:20–8. Chang MC, Berkery D, Schuel R, Laychock SG, Zimmerman AM, Zimmerman S, et al. Evidence for a cannabinoid receptor in sea urchin sperm and its role in blockade of the acrosome reaction. Mol Reprod Dev 1993;36:507–16. Schuel H, Burkman LJ, Lippes J, Crickard K, Forester E, Piomelli D, et al. N-Acylethanolamines in human reproductive fluids. Chem Phys Lipids 2002;121:211–27. Rossato M, Ion Popa F, Ferigo M, Clari G, Foresta C. Human sperm express cannabinoid receptor Cb1, the activation of which inhibits motility, acrosome reaction, and mitochondrial function. J Clin Endocrinol Metab 2005;90:984–91. Maccarrone M, Barboni B, Paradisi A, Bernabo N, Gasperi V, Pistilli MG, et al. Characterization of the endocannabinoid system in boar spermatozoa and implications for sperm capacitation and acrosome reaction. J Cell Sci 2005;118:4393–404. Cobellis G, Cacciola G, Scarpa D, Meccariello R, Chianese R, Franzoni MF, et al. Endocannabinoid system in frog and rodent testis: type-1 cannabinoid receptor and fatty acid amide hydrolase activity in male germ cells. Biol Reprod 2006;75:82–9. de Miguel R, Romero J, Munoz RM, Garcia-Gil L, Gonzalez S, Villanua MA, et al. Effects of cannabinoids on prolactin and gonadotrophin secretion: involvement of changes in hypothalamic gamma-aminobutyric acid (GABA) inputs. Biochem Pharmacol 1998;56:1331–8. Harclerode J. Endocrine effects of marijuana in the male: preclinical studies. NIDA Res Monogr 1984;44:46–64. Wenger T, Toth BE, Juaneda C, Leonardelli J, Tramu G. The effects of cannabinoids on the regulation of reproduction. Life Sci 1999;65: 695–701. Wenger T, Ledent C, Csernus V, Gerendai I. The central cannabinoid receptor inactivation suppresses endocrine reproductive functions. Biochem Biophys Res Commun 2001;284:363–8. Schuel H, Chang MC, Berkery D, Schuel R, Zimmerman AM, Zimmerman S. Cannabinoids inhibit fertilization in sea urchins by reducing the fertilizing capacity of sperm. Pharmacol Biochem Behav 1991;40:609–15. Berdyshev EV. Inhibition of sea urchin fertilization by fatty acid ethanolamides and cannabinoids. Comp Biochem Physiol C Pharmacol Toxicol Endocrinol 1999;122:327–30. Schuel H, Goldstein E, Mechoulam R, Zimmerman AM, Zimmerman S. Anandamide (arachidonylethanolamide), a brain cannabinoid receptor agonist, reduces sperm fertilizing capacity in sea urchins by inhibiting the acrosome reaction. Proc Natl Acad Sci U S A 1994;91:7678–82. Schuel H, Burkman LJ. A tale of two cells: endocannabinoid-signaling regulates functions of neurons and sperm. Biol Reprod 2005;73: 1078–86. Ricci G, Cacciola G, Altucci L, Meccariello R, Pierantoni R, Fasano S, et al. Endocannabinoid control of sperm motility: the role of epididymus. Gen Comp Endocrinol 2007;153:320–2. Maccarrone M. CB(2) receptors in reproduction. Br J Pharmacol 2008;153:189–98.

1386

Agirregoitia et al.

CB2 receptor in human sperm

25. World Health Organization. Collection and examination of human semen, WHO laboratory manual for the examination of human semen and sperm-cervical mucus interaction. 4th ed. Cambridge: Cambridge University Press, 1999:4–33. 26. Flesch FM, Colenbrander B, van Golde LM, Gadella BM. Capacitation induces tyrosine phosphorylation of proteins in the boar sperm plasma membrane. Biochem Biophys Res Commun 1999;262:787–92. 27. Carracedo A, Gironella M, Lorente M, Garcia S, Guzman M, Velasco G, et al. Cannabinoids induce apoptosis of pancreatic tumor cells via endoplasmic reticulum stress-related genes. Cancer Res 2006;66:6748–55. 28. Ravina CG, Seda M, Pinto FM, Orea A, Fernandez-Sanchez M, Pintado CO, et al. A role for tachykinins in the regulation of human sperm motility. Hum Reprod 2007;22:1617–25. 29. Zuccarello D, Garolla A, Ferlin A, Menegazzo M, De Toni L, Carraro M, et al. Androgen receptor is expressed in both X- and Y-carrier human spermatozoa. Fertil Steril 2009;91:193–200. 30. Luconi M, Bonaccorsi L, Maggi M, Pecchioli P, Krausz C, Forti G, et al. Identification and characterization of functional nongenomic progesterone receptors on human sperm membrane. J Clin Endocrinol Metab 1998;83:877–85. 31. De Jesus ML, Salles J, Meana JJ, Callado LF. Characterization of CB1 cannabinoid receptor immunoreactivity in postmortem human brain homogenates. Neuroscience 2006;140:635–43. 32. Ostermeier GC, Dix DJ, Miller D, Khatri P, Krawetz SA. Spermatozoal RNA profiles of normal fertile men. Lancet 2002;360:772–7. 33. Focarelli R, Giuffrida A, Capparelli S, Scibona M, Fabris FM, Francavilla F, et al. Specific localization in the equatorial region of gp20, a 20 kDa sialylglycoprotein of the capacitated human spermatozoon acquired during epididymal transit which is necessary to penetrate zona-free hamster eggs. Mol Hum Reprod 1998;4:119–25. 34. Arienti G, Carlini E, Verdacchi R, Cosmi EV, Palmerini CA. Prostasome to sperm transfer of CD13/aminopeptidase N (EC 3.4.11.2). Biochim Biophys Acta 1997;1336:533–8. 35. Arienti G, Polci A, Carlini E, Palmerini CA. Transfer of CD26/dipeptidyl peptidase IV (E.C. 3.5.4.4) from prostasomes to sperm. FEBS Lett 1997;410:343–6. 36. Utleg AG, Yi EC, Xie T, Shannon P, White JT, Goodlett DR, et al. Proteomic analysis of human prostasomes. Prostate 2003;56:150–61. 37. Miller D, Ostermeier GC. Towards a better understanding of RNA carriage by ejaculate spermatozoa. Hum Reprod Update 2006;12:757–67. 38. Miller D, Ostermeier GC, Krawetz SA. The controversy, potential and roles of spermatozoal RNA. Trends Mol Med 2005;11:156–63. 39. Ostermeier GC, Miller D, Huntriss JD, Diamond MP, Krawetz SA. Reproductive biology: delivering spermatozoan RNA to the oocyte. Nature 2004;429:154. 40. Agirregoitia E, Valdivia A, Carracedo A, Casis L, Gil J, Subiran N, et al. Expression and localization of delta-, kappa-, and mu-opioid receptors in human spermatozoa and implications for sperm motility. J Clin Endocrinol Metab 2006;91:4969–75. 41. Xu W, Filppula SA, Mercier R, Yaddanapudi S, Pavlopoulos S, Cai J, et al. Purification and mass spectroscopic analysis of human CB1 cannabinoid receptor functionally expressed using the baculovirus system. J Pept Res 2005;66:138–50. 42. Filppula S, Yaddanapudi S, Mercier R, Xu W, Pavlopoulos S, Makriyannis A. Purification and mass spectroscopic analysis of human CB2 cannabinoid receptor expressed in the baculovirus system. J Pept Res 2004;64:225–36. 43. Meizel S. The sperm, a neuron with a tail: ‘neuronal’ receptors in mammalian sperm. Biol Rev Camb Philos Soc 2004;79:713–32. 44. Subiran N, Agirregoitia E, Valdivia A, Ochoa C, Casis L, Irazusta J. Expression of enkephalin-degrading enzymes in human semen and implications for sperm motility. Fertil Steril 2007;89:1571–7. 45. Flesch FM, Gadella BM. Dynamics of the mammalian sperm plasma membrane in the process of fertilization. Biochim Biophys Acta 2000;1469:197–235. 46. Yanagimachi R. Mammalian fertilization. In: Knobil E, Neill JD, eds. The physiology of reproduction. 2nd ed. New York: Raven Press Ltd, 1994:189–317.

Vol. 93, No. 5, March 15, 2010

47. Mortimer ST. A critical review of the physiological importance and analysis of sperm movement in mammals. Hum Reprod Update 1997;3:403–39. 48. Wang H, Xie H, Guo Y, Zhang H, Takahashi T, Kingsley PJ, et al. Fatty acid amide hydrolase deficiency limits early pregnancy events. J Clin Invest 2006;116:2122–31. 49. Cross NL. Human seminal plasma prevents sperm from becoming acrosomally responsive to the agonist, progesterone: cholesterol is the major inhibitor. Biol Reprod 1996;54:138–45. 50. Shalgi R, Smith TT, Yanagimachi R. A quantitative comparison of the passage of capacitated and uncapacitated hamster spermatozoa through the uterotubal junction. Biol Reprod 1992;46:419–24. 51. Harrison RA. Capacitation mechanisms, and the role of capacitation as seen in eutherian mammals. Reprod Fertil Dev 1996;8:581–94.

Fertility and Sterility

52. Mortimer ST. CASA–practical aspects. J Androl 2000;21:515–24. 53. Schuel H. Tuning the oviduct to the anandamide tone. J Clin Invest 2006;116:2087–90. 54. Wang H, Dey SK, Maccarrone M. Jekyll and hyde: two faces of cannabinoid signaling in male and female fertility. Endocr Rev 2006;27: 427–48. 55. Aquila S, Sisci D, Gentile M, Middea E, Catalano S, Carpino A, et al. Estrogen receptor (ER)alpha and ER beta are both expressed in human ejaculated spermatozoa: evidence of their direct interaction with phosphatidylinositol-3-OH kinase/Akt pathway. J Clin Endocrinol Metab 2004;89:1443–51. 56. Turner RM. Moving to the beat: a review of mammalian sperm motility regulation. Reprod Fertil Dev 2006;18:25–38.

1387