- Email: [email protected]
NF-Y regulates the human acetylcholinesterase promoter activity during calcium ionophore A23187-induced cell apoptosis
Biochimica et Biophysica Acta 1770 (2007) 1475 – 1482 www.elsevier.com/locate/bbagen
The CCAAT-binding factor CBF/NF-Y regulates the human acetylcholinesterase promoter activity during calcium ionophore A23187-induced cell apoptosis Hui Zhu a,b,1 , Wei Gao a,b,1 , Yu-fang Shi b , Xue-Jun Zhang a,⁎ a
b
Laboratory of Molecular Cell Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 320 YueYang Road, Shanghai 200031, China Department of Molecular Genetics, Microbiology and immunology, University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, NJ 08854, USA Received 10 February 2007; received in revised form 4 July 2007; accepted 6 July 2007 Available online 20 July 2007
Abstract We previously reported that the expression of acetylcholinesterase during A23187-induced apoptosis of HeLa cells is regulated by Ca2+ mobilization through the modulation of mRNA stability and acetylcholinesterase promoter activity. Transactivation of the human acetylcholinesterase promoter by A23187 was partially mediated by the distal CCAAT motif within the − 1270 to −1248 fragment of the human acetylcholinesterase promoter, which was bound by the CCAAT binding factor (CBF/NF-Y). In the present study, we investigated the molecular mechanisms by which CBF/NF-Y regulates A23187-induced activation of the human acetylcholinesterase promoter. The results indicate that CBF/NF-Y binding to the distal CCAAT motif suppresses the promoter activity. Electrophoretic mobility shift assays (EMSAs) demonstrated that binding of CBF/NF-Y to the distal CCAAT motif decreased after A23187 treatment. Our results suggest that acetylcholinesterase promoter activation during A23187-induced HeLa cell apoptosis may result partly from the dissociation of CBF/NF-Y from the distal CCAAT motif in the acetylcholinesterase promoter, reversing this suppression. © 2007 Elsevier B.V. All rights reserved. Keywords: Acetylcholinesterase; CBF/NF-Y; Promoter activity; The distal CCAAT motif
1. Introduction Acetylcholinesterase (AChE) is a type B carboxylesterase that rapidly hydrolyzes the neurotransmitter acetylcholine at cholinergic synapses and neuromuscular junctions [1]. AChE is also involved in many non-cholinergic functions such as cell adhesion, cell proliferation, neurite outgrowth, and tumorigenesis [2]. The molecular mechanisms regulating ACHE gene expression have mostly been studied in muscle cells [3–5], neurons, and hematopoietic cells, which have been extensively Abbreviations: AChE, Acetylcholinesterase acetylcholine acetyl hydrolase; CBF/NF-Y, the CCAAT-binding Factor; EMSAs, electrophoretic mobility shift assays; RNAi, RNA interference; PMSF, phenylmethylsulfonyl fluoride ⁎ Corresponding author. Tel.: +86 21 54921402; fax: +86 21 54921403. E-mail address: [email protected] (X.-J. Zhang). 1 These authors contributed equally to this work. 0304-4165/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.bbagen.2007.07.007
reviewed [2]. The transcriptional activity of the ACHE gene has been proposed to play roles in regulating the AChE expression [4,6–9]. Transcription of human AChE mRNA can be driven by a 2.2-kb sequence upstream from the initiator AUG in the ACHE gene, and the promoter sequence of the ACHE gene has been functionally characterized [8,9]. The 2.2-kb human AChE promoter sequence includes multiple potential binding sites for universal and tissue-specific transcription factors such as clustered MyoD elements, E-box, SP1, EGR1, AP-2, and the development-related GAGA motif [9]. The promoter also contains two CCAAT motifs with the distal CCAAT motif located within the − 1270 to − 1248 fragment and the other located within the − 592 to − 571 fragment. We recently showed that the synapse type AChE expression can be induced during apoptosis in various cell types, including those derived from non-muscle, non-nervous, and non-hematopoietic
1476
H. Zhu et al. / Biochimica et Biophysica Acta 1770 (2007) 1475–1482
tissues, suggesting that AChE is a novel regulator of apoptosis [10]. We also reported that intracellular Ca2+ played a critical role in the regulation of AChE expression during apoptosis of HeLa cells induced by the calcium ionophore A23187 by modulating the mRNA stability and promoter activity of the ACHE gene [8]. A23187 increased the activity of the human AChE promoter, with inducibility partially due to the distal CCAAT motif within the −1270 to −1248 fragment of the AChE promoter [8]. We also demonstrated that the CCAAT binding factor (CBF/NF-Y) bound to this motif, suggesting that CBF/NF-Y may mediate AChE transcriptional activity during A23187-induced apoptosis [8]. However, the exact molecular mechanisms by which CBF/NF-Y regulates AChE promoter activity during apoptosis are not fully understood. CBF/NF-Y is one of the most ubiquitous transcription factors, found in a variety of eukaryotes and is highly conserved throughout evolution [11]. CBF/NF-Y is a complex minimally composed of three subunits: CBF-A/NF-YB, CBF-B/NF-YA, and CBF-C/NF-YC, all of which are required for DNA binding [12,13]. CBF/NF-Y is not only involved in high basal-level transcriptional activation, but also contributes to transcriptional regulation induced by various agents [13]. In the present study, we examined the basal levels of AChE promoter activity when the distal CCAAT motif within the − 1270 to − 1248 fragment of the AChE promoter was mutated by transfection of HeLa cells with luciferase constructs. We tested basal levels of AChE promoter activity when endogenous CBF-B/NF-YA subunit expression was knocked down by RNA interference (RNAi). Electrophoretic mobility shift assays (EMSAs) were also performed to identify A23187-dependent changes in the binding of CBF/NF-Y to the distal CCAAT motif. 2. Materials and methods 2.1. Cell culture and treatments HeLa cells were maintained in RPMI 1640 (GIBCO-BRL, Gaithersburg, MD) with 10% fetal bovine serum (GIBCO-BRL, Gaithersburg, MD). 293T human embryonic kidney epithelial cells were cultured in Dulbecco's modified Eagle's medium (GIBCO-BRL, Gaithersburg, MD) with 10% fetal bovine serum (GIBCO-BRL, Gaithersburg, MD). Apoptosis of HeLa cells was induced by 2 μM A23187 (Calbiochem, La Jolla, CA).
2.2. Flow cytometry analysis Both floating and adherent cells were harvested, and fixed in 70% ethanol followed by incubation in PBS containing RNase A (50 μg/ml) for 1 h at 37 °C. Cells were stained with propidium iodide (50 μg/ml) for 15 min at room temperature, and then analyzed by flow cytometry using a Becton-Dickinson FACSorter and Cell Quest software. Apoptotic cells were defined as those containing a lower DNA content than the diploid cells in the G1/G0 phase.
2.3. Immunocytochemistry Immunocytochemistry analysis protocol has been previously described [10]. AChE-TRITC antibody and cleaved caspase-3-FITC antibody were prepared by our own laboratory. Cell pellets were incubated with antibody overnight at 4 °C and stained with Hoechst 33258. Stained cells were analyzed with an Olympus fluorescence microscope.
2.4. Plasmid construction and mutagenesis The 2.2-kb DNA fragment of the human AChE promoter [9] was subcloned into the BglII and HindIII sites of the pGL3 basic vector (Promega, Madison, WI) with a downstream tagged firefly luciferase gene and named pAChE-Luc [8]. The construct containing a mutation in the distal CCAAT motif within the −1270 to − 1248 fragment of the AChE promoter was constructed as described previously [8] and named Distal CCAAT binding mutant. The mammalian expression vector pSUPER (OligoEngine) was used for expression of siRNA in HeLa cells. The gene-specific insert specifies a 19nucleotide sequence corresponding to (1: 5′-GCCGATGAAGAAGCAATGA3′; 2: 5′-CACAGGGTTTGCAGCAAAT-3′; 3: 5′-CTAGAGGCAGAAGGGAAAA-3′; 4: 5′-ACAGGAGCCAATACCAACA-3′) of CBF-B/NF-YA, which is separated by a 9-nucleotide non-complementary spacer (TTCAAGAGA) from the reverse complement of the same 19-nucleotide sequence. The sequences were inserted into the pSUPER backbone after digestion with BglII and HindIII. The constructs were referred to CBF-B siRNA1, CBF-B siRNA2, CBF-B siRNA3, and CBF-B siRNA4, respectively. The mismatch sequence of the target sequence (4: 5′-ACAGGAGCCAATACCAACA-3′) was 5′- GACCGAGACAACACATACA-3′, which was used to construct the negative control construct CBF-B siRNA4mis.
2.5. Transient transfections and luciferase assays Using LipofectAMINE regent (Invitrogen, Carlsbad, CA), HeLa cells were co-transfected with the firefly luciferase reporter construct pAChE-Luc, the Distal CCAAT binding mutant, and the Renilla luciferase reporter plasmid pRLSV40 (Promega, Madison, WI) as an internal control. For co-transfection experiments with CBF-B siRNA vectors, total DNA was normalized to the corresponding pSUPER empty vectors. Luciferase assays were performed according to the Dual-Luciferase Reporter Assay System (Promega, Madison, WI), and activities were measured in a luminometerBGP (MGM). Firefly luciferase activity was normalized based on Renilla luciferase activity in each well. Transfection experiments were independently repeated 3 times.
2.6. Western blotting Cells were resuspended in a lysis buffer (50 mM Tris–HCl pH 8.0, 150 mM NaCl, 0.1% SDS, 10% Nonidet P-40, 0.5% sodium deoxycholate, 1 mM PMSF, 1 μg/ml Aprotinin, and 1.0 μM Pepstain A). After incubation on ice for 30 min, cell lysates were centrifuged at 12,000 rpm for 10 min at 4 °C, and the insoluble pellets were discarded. The protein concentration of the lysates was determined by the BCA protein assay (Pierce, Rockford, IL). Equal amounts of proteins were separated on 10% SDS-PAGE and transferred to a nitrocellulose membrane. Immunoblotting was carried out as described previously [10]. The CBF-B/NF-YA monoclonal antibody and the horseradish peroxidase-conjugated secondary antibody were from Santa Cruz Biotechnology (Santa Cruz, CA). The β-actin monoclonal antibody was from Sigma (St. Louis, MO). Polyclonal rabbit anti caspase-3 (Cell Signaling Technology) was used to test caspase-3 cleavage in HeLa cells apoptosis induced by A23187. The AChE monoclonal antibody was from BD Biosciences (San Jose, CA). The immunoreactive protein was visualized using a chemiluminescence detection kit (ECL, Santa Cruz Biotechnology).
2.7. Electrophoretic mobility shift assays (EMSAs) Nuclear extracts were prepared as described previously [8]. EMSAs were performed with 4 μg of nuclear extract proteins in binding buffer (10 mM Tris– HCl, 1 mM MgCl2, 0.5 mM EDTA, 50 mM NaCl, 0.5 mM DTT, 4% glycerol, pH 7.5) with 1 μg of poly (dI–dC). The binding reactions were incubated for 20 min at room temperature with 20,000 cpm (0.1–0.5 ng) of double-stranded oligonucleotides end-labeled with [γ-32P] ATP using T4 polynucleotide kinase (Invitrogen, Carlsbad, CA). A 100-fold excess of unlabeled double-stranded oligonucleotides were used as competitors where indicated. The sequence of the double-stranded oligonucleotide corresponding to the distal CCAAT site was 5′ACCCCCTAATTGGGGCGGTACCC-3′ and named Wt CCAAT Dist. The sequence of the mutant double-stranded oligonucleotide corresponding to the
H. Zhu et al. / Biochimica et Biophysica Acta 1770 (2007) 1475–1482 distal CCAAT site was 5′-ACCCCCTGATATCGGCGGTACCC-3′ and named Mut CCAAT Dist. The consensus binding sequence for CBF/NF-Y was 5′AGACCGTACGTGATTGGTTAATCT CTT-3′) (sc-2591; Santa Cruz) and named CBF wt. The mutant binding sequence for CBF/NF-Y was 5′AGACCGTACGAAATACGGGAATCTCTT-3′ (sc-2592; Santa Cruz) and named CBF mut. The sequence of the double-stranded oligonucleotide corresponding to the Oct-1 consensus biding site was 5′- TGTCGAATGCAAATCACTAGAA -3′ (sc-2506; Santa Cruz) and named Wt Oct-1. The sequence of the mutant double-stranded oligonucleotide corresponding to the Oct-1 consensus binding site was 5′-TGTCGAATGCAAGCCACTAGAA-3′ (sc-2515; Santa Cruz) and named Mut Oct-1. Antibody supershift assays were carried out in binding buffer, with a further addition of 2 μl of anti-CBF-A/NFYB (sc-13045X), anti-CBF-B/NF-YA (sc-10779 X), and anti-CBF-C/NF-YC (sc-13044X) antibodies (Santa Cruz, CA).
1477
3. Results 3.1. Activation of the AChE promoter activity during A23187-induced HeLa cell apoptosis A23187 is a Ca2+ ionophore that equilibrates Ca2+ gradients across membranes and can cause a rapid rise in intracellular Ca2+ levels. A23187 increased levels of apoptosis in HeLa cells over the course of 72 h, as assessed by the appearance of the subdiploid peak on DNA content analysis (Fig. 1A). Cleavage of caspase-3 is another hallmark of apoptosis. A23187 treatment led to increased caspase-3 cleavage over a 72-h period (Fig. 1B).
Fig. 1. Increases in human AChE promoter activity during A23187-induced HeLa cell apoptosis. (A) A23187 induced apoptosis in HeLa cells. Flow cytometry analysis of DNA content. (B) A23187-induced caspase-3 activation in HeLa cells. Western blot analysis of extract of HeLa cells treated with DMSO (control) or A23187 (2 μM) for indicated time. (C) AChE and cleaved caspase-3 were both positive in condensed nuclei cells (arrow head) while negative in living cells (arrow). Immunocytochemistry analysis of HeLa cells treated with A23187 or DMSO. (D) AChE protein expression level increased according to the lengths of treatment. Western bolt analysis of extract of HeLa cells treated with DMSO (control) or A23187 (2 μM) for indicated time. (E) A23187-dependent increases in human AChE promoter activity. HeLa cells were co-transfected with pAChE-Luc and pRL-SV40. After 24 h, transfected cells were incubated with dimethyl sulfoxide (un-induced control) or induced by A23187 (2 μM) for the indicated lengths of time. AChE promoter activity was analyzed by normalizing firefly luciferase activity to Renilla luciferase activity in each well.
1478
H. Zhu et al. / Biochimica et Biophysica Acta 1770 (2007) 1475–1482
Furthermore, apoptotic cells with condensed nuclei were positive for both AChE and cleaved caspase-3 staining while living cells were negative for both (Fig. 1C). AChE protein expression level increased according to the lengths of treatment (Fig. 1D). We also performed transient transfections of the firefly luciferase reporter construct driven by the human AChE promoter, pAChE-Luc and the Renilla luciferase reporter plasmid, pRL-SV40 as an internal control in HeLa cells and treated with or without A23187 (2 μM) for various lengths of time. There was a significant time-dependent increase in luciferase activity in treated cells compared to the control untreated cells (Fig. 1E). After 72 h, a more than three-fold induction of AChE promoter activity was observed. 3.2. Mutational analysis of the distal CCAAT motif within the AChE promoter We have previously shown that transactivation of the human AChE promoter by A23187 was partially mediated by the distal CCAAT motif within the − 1270 to − 1248 fragment of the human AChE promoter [8]. In the present study, we examined the basal levels of AChE promoter activity when the distal CCAAT motif was mutated. Fig. 2A shows by EMSA that one major complex forms when the distal CCAAT site probe (Wt CCAAT Dist) was incubated with nuclear extracts from HeLa cells. A 100-fold excess of CBF wt consensus oligonucleotide significantly inhibited binding (Fig. 2A, lane 3), whereas the
CBF/NF-Y consensus mutant (CBF mut) could not (Fig. 2A, lane 4). The formation of DNA–protein complexes was also clearly inhibited by anti-CBF antibodies, namely anti-CBF-B/ NF-YA (Fig. 2A, lane 5), CBF-A/NF-YB (Fig. 2A, lane 6), and CBF-C/NF-YC (Fig. 2A, lane 7). An excess of unlabeled probe specific for the distal CCAAT site almost abolished CBF/NF-Y binding, whereas an excess of unlabeled probe that incorporated mutations in the distal CCAAT binding site did not (Fig. 2B, lanes 2–7). Notably, the DNA binding band of CBF/NF-Y from nuclear extracts of HeLa cells treated with A23187 for 48 h was weaker than the one from untreated HeLa cells (Fig. 2B, lanes 2 and 5). The CBF/NF-Y binding bands disappeared when using labeled Mut CCAAT Dist probes, indicating that the mutation of the distal CCAAT sequence destroyed the ability of CBF/NFNY to bind to the distal CCAAT motif (Fig. 2B, lane 8). A lowmobility band was observed when using labeled Mut CCAAT Dist probes (Fig. 2B, lane 8). One possible reason was that mutations in the distal CCAAT motif destroyed the binding activity of CBF/NF-Y, leading to changes in the binding activity of uncharacterized proteins to sequences near the distal CCAAT sequence. Fig. 3 shows that mutation of the distal CCAAT motif increased the basal AChE promoter activity by approximately 10-fold. Since the destruction of CBF/NF-Y binding activity caused an increase in AChE promoter activity, this suggests that CBF/NF-Y binding to the distal CCAAT motif leads to suppression of AChE promoter activity.
Fig. 2. Mutation in the distal CCAAT sequence destroys the binding activity of CBF/NF-NY to the distal CCAAT motif. (A) Competition assays using CBF consensus oligonucleotides and antibodies as competitors. 32P-labeled Wt CCAAT Dist was incubated with nuclear extracts from HeLa cells in the presence of CBF wt (lane 3), CBF mut (lane 4), anti-CBF-B/NF-YA (lane 5), anti-CBF-A/NF-YB (lane 6), and anti-CBF-C/NF-YC (lane 7). (B) 32P-labeled Wt CCAAT Dist was incubated with nuclear extracts from HeLa cells prepared from untreated cells (lanes 2–4) and A23187-treated cells (lanes 5–7). Competition assays were also conducted using oligonucleotides as competitors: Wt CCAAT Dist (lanes 3 and 6) and Mut CCAAT Dist (lanes 4 and 7). 32P-labeled Mut CCAAT Dist was incubated with nuclear extracts from HeLa cells prepared from untreated cells (lane 8).
H. Zhu et al. / Biochimica et Biophysica Acta 1770 (2007) 1475–1482
1479
recting the synthesis of four different 19–base pair doublestranded CBF-B/NF-YA target sequences and compared the ability of these constructs to inhibit the endogenous expression of CBF-B/NF-YA after transient expression in 293T cells. As Fig. 4A shows, CBF-B siRNA4 was the most effective at
Fig. 3. Mutation of the distal CCAAT motif increases basal AChE promoter activity and reduces its inducibility by A23187. HeLa cells were cotransfected with pAChE-Luc or the Distal CCAAT binding mutant plus pRL-SV40. (A) Transfectants were incubated with DMSO or induced by A23187 (2 μM) for 24 h and 48 h. AChE promoter activity was analyzed by normalizing firefly luciferase activity to Renilla luciferase activity in each well. ⁎⁎p b 0.01 = significant difference from cells cotransfected with pAChE-Luc and Distal CCAAT binding mutant. (B) AChE promoter activity was represented as the fold induction relative to un-induced controls. ⁎p b 0.05 = significant difference from cells cotransfected with pAChE-Luc and Distal CCAAT binding mutant.
3.3. AChE promoter activity is enhanced by knockdown of CBF-B/NF-YA All three CBF/NF-Y subunits (CBF-A/NF-YB, CBF-B/NFYA, and CBF-C/NF-YC) are needed for DNA binding and the CBF–DNA complex contains one molecule of each [14]. CBF-A and CBF-C interact with each other to form a stable heterodimer. CBF-B only interacts with the CBF-A/CBF-C heterodimer to form a heterotrimer that then binds to DNA [13]. Only the heterotrimeric CBF forms a CBF–DNA complex, and differential expression of CBF-B/NF-YA can result in variable CBF/NF-Y activity [13]. To further test the suppressive effect of CBF/NF-Y binding to the distal CCAAT motif on AChE promoter activity, we examined the regulation of the AChE promoter activity when the endogenous CBF-B/NF-YA protein was knocked down by RNAi. We designed four constructs (CBF-B siRNA1–4) di-
Fig. 4. Knockdown of endogenous CBF-B/NF-YA expression results in an increase in basal levels of human AChE promoter activity and a decrease in the A23187-induced AChE promoter activity. (A) Endogenous CBF-B/NF-YA expression was knocked down by siRNA. 293T cells were co-transfected with pSUPER or constructs expressing CBF-B/NF-YA siRNA CBF-B siRNA1-4. After 48 h, CBF-B/NF-YA protein levels were analyzed by western blot. (B) Each well of HeLa cells was co-transfected with 0.3 μg pAChE-Luc, 0.03 μg pRL-SV40, along with different amounts of CBF-B siRNA4 or CBF-B siRNA4mis. Each well was also co-transfected with the corresponding empty vectors to keep the amount of transfected DNA constant. After 24 h, firefly luciferase activity was normalized against Renilla luciferase activity in each well. (C) Each well of HeLa cells was co-transfected with 0.3 μg pAChE-Luc, 0.03 μg pRL-SV40 and 0.6 μg empty vector plasmid or CBF-B siRNA4. After 24 h, HeLa cells were treated with 2 μM A23187 or DMSO. After 24 h, firefly luciferase activity was normalized against Renilla luciferase activity in each well.
1480
H. Zhu et al. / Biochimica et Biophysica Acta 1770 (2007) 1475–1482
knocking down CBF-B/NF-YA protein expression. Transfection of siRNA targeting the CBF-B/NF-YA gene resulted in a distinct reduction in endogenous CBF-B/NF-YA protein expression. Next, we showed that after knockdown of CBF-B/NF-YA expression, basal AChE promoter activity increased in a dose-dependent fashion based on the amount transfected (Fig. 4B) whereas transfection of CBF-B siRNA4mis was unable to enhance AChE promoter activity. Furthermore, in CBF-B/NF-YA siRNA transfected cells, the A23187-induced increase in the AChE promoter activity is blocked (Fig. 4C), further indicating that CBF/NF-Y is involved in the regulation of AChE promoter activity during A23187 induced apoptosis and binding of CBF/NF-Y to the distal CCAAT motif within the AChE promoter caused a decrease in AChE promoter activity. 3.4. CBF/NF-Y binding to the CCAAT motif is decreased in nuclear extracts from HeLa cells treated with A23187 To elucidate how CBF/NF-Y regulates AChE promoter activity during A23187-induced apoptosis, we next examined A23187-dependent changes in the interaction of CBF/NF-Y with the distal CCAAT motif within the AChE promoter. Nuclear extracts were prepared from HeLa cells treated or untreated with A23187 and EMSAs were performed with the Wt CCAAT Dist sequence as the labeled probe. Two major complexes (I and II) were observed in the presence of extract (Fig. 5A). Complex I may be a nonspecific binding complex since it was largely eliminated by pre-incubation with increasing amounts of poly (dI–dC) (Fig. 5A, lanes 12–14). Complex II was specific for Wt CCAAT Dist and referred to CBF/NF-Y because an excess of unlabeled Wt CCAAT Dist probes abolished complex II whereas an excess of unlabeled Mut CCAAT Dist probes did not (Fig. 5A, lanes 6–11). Fig. 5A also shows that the DNA binding activity of CBF/NF-Y from nuclear extracts of cells treated with A23187 significantly decreased as the length of incubation with A23187 increased (Fig. 5A, lanes 2–5). The DNA binding activity of CBF/NF-Y in untreated cells was the highest. To assess whether the decreasing binding of CBF/NF-Y to Wt CCAAT Dist was special, we also tested the binding of Oct-1 to the Oct-1 consensus binding sequence Wt Oct-1 in nuclear extracts of HeLa cells untreated or treated with A23187. The DNA–protein band corresponded to Oct-1 binding, for it disappeared almost completely in the presence of excess of unlabeled Wt Oct-1 probes, whereas an excess of unlabeled Mut Oct-1 was unable to compete with the binding activity (Fig. 5B, lanes 6–7). Compared with CBF/NF-Y, the binding of Oct-1 did not decrease in nuclear extracts prepared from HeLa cells treated with A23187 for less than 48 h (Fig. 5B, lanes 2–4), indicating that the decreasing binding of CBF/NF-Y to Wt CCAAT Dist with A23187-treated time is special. The binding activity of Oct-1 was slightly reduced in extracts of HeLa cells treated with A23187 for 72 h, possibly due to protein degradation during the later stages of A23187-induced apoptosis. The decrease in the binding activity of CBF/NF-Y to the distal CCAAT motif within the AChE promoter was associated with the increased AChE promoter activity (Fig. 1B), further suggesting
Fig. 5. A23187-dependent decreases in the interactions of CBF/NF-Y with the distal CCAAT motif. (A) 32P-labeled Wt CCAAT Dist was incubated with nuclear extracts from HeLa cells prepared from untreated cells (lanes 2, 6–8, 12–14) and A23187-treated cells (lanes 3–5, 9–11). Competition assays were also conducted using oligonucleotides as competitors: Wt CCAAT Dist (lanes 7 and 10) and Mut CCAAT Dist (lanes 8 and 11). (B) The binding of Oct-1 to Wt Oct-1 does not decrease in nuclear extracts prepared from HeLa cells treated with A23187 for less than 48 h. 32P-labeled Wt Oct-1 was incubated with nuclear extracts from HeLa cells prepared from untreated cells (lane 2) and A23187treated cells (lanes 3–7). Competition assays were also conducted using consensus oligonucleotides as competitors: Wt Oct-1 (lane 6) and Mut Oct-1 (lane 7).
that a suppressive effect exists when CBF-B/NF-Y binds to the distal CCAAT motif. The results also suggest that A23187 upregulates AChE promoter activity at least in part through the loss of CBF/NF-Y binding to the distal CCAAT sequence within the AChE promoter. We demonstrated that A23187 could eliminate CBF/NF-Y proteins from the distal CCAAT motif within the AChE promoter and reverse the suppressive effect, resulting in the observed increase in AChE promoter activity. 4. Discussion The CCAAT motif is one of the most common elements in eukaryotic promoters. Mammalian promoters containing the
H. Zhu et al. / Biochimica et Biophysica Acta 1770 (2007) 1475–1482
CCAAT motif are divided into three groups based on the effect of mutations of this motif on promoter activity of [13]. In group I, mutation of the CCAAT motif decreases basal promoter activity. In groups II and III, the CCAAT motif is necessary for the induction of promoter activity by various agents and for the alteration of promoter activity during cell growth, respectively. CBF/NF-Y is one of several proteins that bind to CCAAT motifs and requires a high degree of conservation of the CCAAT sequence [13]. The transcriptional activation functions reside in the large N-terminal end of CBF-B/NF-YA and in the C-terminal end of CBF-C/NF-YC [15]. However, it has also been reported previously that mutations in CBF/NF-Y sites cause an increase in promoter activity [16,17]. Nicolas et al. have reported that mutation of the NF-Y site in the NF-Y/Sp1overlapping box within the human Sp1 promoter resulted in an increase in Sp1 binding to the overlapping box, and caused an increase in its promoter activity [16]. A repressing mechanism may also be involved in the regulation of the human nicotinic receptor gene by NF-Y, as suggested by the increase in transcriptional activity observed in C2C12 and COS cells after mutating the NF-Y site in a NF-Y/Sp1 overlap site [17]. Ronchi et al. [18] showed that NF-Y could induce bends of 62–82° at the site of a CCAAT box in DNA and that the degree of bending was influenced by the flanking sequence. Hence, a possible explanation for our findings is that the loss of CBF/NF-Y binding to the distal CCAAT motif induces a critical conformational change in the AChE promoter, which in turn alters the affinity of cis-acting elements for their trans-acting factors. The absence of CBF/NF-Y may facilitate the binding of some other activating factor. In fact, EMSAs performed with a probe in which the CBF/NF-Y site had been altered (Fig. 1B, lane 8) revealed the formation of a complex that was not observed with the wild-type probe. Interestingly, since there is also an overlap within the Sp1 and the distal CCAAT sites of the AChE promoter, the absence of CBF/NF-Y would alleviate steric restrictions and increase the binding of Sp1, thus helping to enhance promoter activity, which deserves further study. CBF/ NF-Y can also increase the binding affinity of neighboring factors and make the two complexes much more stable on the DNA [12]. The binding of CBF/NF-Y to the distal CCAAT motif may also stabilize the binding of other repressors to the juxtaposed site. Thus, the absence of CBF/NF-Y destabilizes binding of the repressor and increases AChE promoter activity. Differential expression of CBF-B/NF-YA has been observed in several cell lines under specific conditions that also resulted in alterations in CBF-dependent promoter activity [19–22]. There is mounting evidence that CBF-B/NF-YA is a regulatory subunit of the trimeric complex, whose levels vary in different cell types and/or under different growth conditions, which response for different CBF binding to DNA [12]. In the present study, we selected CBF-B/NF-YA as a target and inhibited endogenous CBF-B/NF-YA expression by RNAi. We hypothesized that decreasing the expression of CBF-B/NF-YA may affect the formation of the trimeric complex, resulting in a reduction in the binding activity of CBF/NF-Y to the CCAAT motif. Our results showed that endogenous CBF-B/NF-YA
1481
expression was significantly inhibited and the basal AChE promoter activity increased as expected, further suggesting that CBF/NF-Y bound to the distal CCAAT motif suppresses AChE promoter activity. Decreases in CBF/NF-Y binding to the distal CCAAT motif of the AChE promoter were also observed after A23187 treatment. Given the suppressive effect of CBF/NF-Y binding to the distal CCAAT motif, this repression may be relieved by the decrease in binding of CBF/NF-Y to the CCAAT motif after A23187 treatment, resulting in the increase in AChE promoter activity. The challenge now is to delineate changes in the binding of other transcriptional activators or repressors upon decreases in CBF/NF-Y binding. The reason for the loss in CBF/NF-Y binding is not clear. The expression of the three subunits of CBF/NF-Y did not decrease after A23187 treatment (data not shown). Though it has been reported that the binding of NF-Y to DNA is influenced by intracellular calcium concentration during transcriptional regulation of the GRP78/ Bip gene [23], differences in the binding of CBF/NF-Y to the distal CCAAT motif at different calcium concentrations were not observed in DNA binding experiments in vitro (data not shown). During A23187-induced apoptosis of HeLa cells, A23187 can cause a rapid rise in intracellular Ca2+ levels and perturb the nucleus calcium homeostasis, thus high nucleus calcium concentration may decrease the binding activity of CBF/NF-Y upon the CCAAT motif or destabilize CBF/NF-Y binding to the CCAAT site. Changes in the nucleus calcium homeostasis may also change the modification of CBF/NF-Y subunits and change the interactions of CBF/NF-Y with other transcription factors, resulting the decrease in the binding of CBF/NF-Y to the CCAAT motif, all of which need to be further examined. Blocking the expression of AChE with antisense oligonucleotides inhibited apoptosis [10], and silencing of the AChE gene by siRNA abolished the decrease in cell viability [24], suggesting that AChE could be a novel regulator of apoptosis. Although it has been reported that AChE plays a pivotal role in the formation of apoptosome during apoptosis, the more detailed molecular mechanism explaining the role of AChE in apoptosis should be elucidated. Further investigation of the mechanisms regulating AChE expression during apoptosis may help us to elucidate the function of AChE during apoptosis and develop improved therapeutic methods to regulate apoptosis which is an important factor in prominent diseases including cancers and neurodegenerative disorders such as Alzheimer's and Parkinson's disease (where unwanted apoptosis of neurons occurs) [25]. 5. Conclusion In the present study, we examined the molecular basis of CBF/NF-Y regulation of the AChE promoter during A23187induced apoptosis of HeLa cells. We showed that binding of CBF/NF-Y to the distal CCAAT motif inhibited AChE promoter activity, and that A23187 increased AChE promoter activity at least in part through the dissociation of CBF/NF-Y from the distal CCAAT motif within the AChE promoter.
1482
H. Zhu et al. / Biochimica et Biophysica Acta 1770 (2007) 1475–1482
Acknowledgments We thank Dr. Hermona Soreq of The Hebrew University of Jerusalem, Israel and Dr. Karl W. K. Tsim of The Hong Kong University of Science and Technology, Hong Kong for providing us with the human AChE promoter construct. This work was supported in part by National Natural Science Foundation of China Grants (30570920), The third phase creative program of Chinese Academy of Sciences (KSCX1YW-R-13), National Key Basic Research Project 973 (2005CB522602), and Science and Technology Commission of Shanghai Municipality (06JC14076, 06DZ22032). References [1] P. Taylor, Z. Radic, The cholinesterases: from genes to proteins, Annu. Rev. Pharmacol. Toxicol. 34 (1994) 281–320. [2] H. Soreq, S. Seidman, Acetylcholinesterase—new roles for an old actor, Nat. Rev., Neurosci. 2 (2001) 294–302. [3] E.K. Tung, R.C. Choi, N.L. Siow, J.X. Jiang, K.K. Ling, J. Simon, E.A. Barnard, K.W. Tsim, P2Y2 receptor activation regulates the expression of acetylcholinesterase and acetylcholine receptor genes at vertebrate neuromuscular junctions, Mol. Pharmacol. 66 (2004) 794–806. [4] L.M. Angus, R.Y. Chan, B.J. Jasmin, Role of intronic E- and N-box motifs in the transcriptional induction of the acetylcholinesterase gene during myogenic differentiation, J. Biol. Chem. 276 (2001) 17603–17609. [5] Z. Luo, M.E. Fuentes, T. Yaylor, Regulation of acetylcholinesterase mRNA stability by calcium during differentiation from myoblasts to myotubes, J. Biol. Chem. 269 (1994) 27216–27223. [6] T.V. Cohen, W.R. Randall, The regulation of acetylcholinesterase by ciselements within intron I in cultured contracting myotubes, J. Neurochem. 98 (2006) 723–734. [7] T.V. Cohen, W.R. Randall, NFATc1 activates the acetylcholinesterase promoter in rat muscle, J. Neurochem. 90 (2004) 1059–1067. [8] N.L. Siow, R.C. Choi, A.W. Cheng, J.X. Jiang, D.C. Wan, S.Q. Zhu, K.W. Tsim, A cyclic AMP-dependent pathway regulates the expression of acetylcholinesterase during myogenic differentiation of C2C12 cells, J. Biol. Chem. 277 (2002) 36129–36136. [9] R. Ben Aziz-Aloya, S. Seidman, R. Timberg, M. Sternfeld, H. Zakut, H. Soreq, Expression of a human acetylcholinesterase promoter–reporter construct in developing neuromuscular junctions of Xenopus embryos, Proc. Natl. Acad. Sci. U. S. A. 90 (1993) 2471–2475. [10] X.J. Zhang, L. Yang, Q. Zhao, J.P. Caen, H.Y. He, Q.H. Jin, L.H. Guo, M. Alemany, L.Y. Zhang, Y.F. Shi, Induction of acetylcholinesterase expression during apoptosis in various cell types, Cell Death Differ. 9 (2002) 790–800.
[11] X.Y. Li, R. Mantovani, R. Hooft van Huijsduijnen, I. Andre, C. Benoist, D. Mathist, Evolutionary variation of the CCAAT-binding transcription factor NF-Y, Nucleic Acids Res. 20 (1992) 1087–1091. [12] R. Mantovani, The molecular biology of the CCAAT-binding factor NF-Y, Gene 239 (1999) 15–27. [13] S.N. Maity, B. de Crombrugghe, Role of the CCAAT-binding protein CBF/ NF-Y in transcription, Trends Biochem. Sci. 23 (1998) 174–178. [14] S.N. Maity, B. De Crombrugghe, Purification, characterization, and role of CCAAT-binding factor in transcription, Methods Enzymol. 273 (1996) 217–232. [15] F. Coustry, S.N. Maity, S. Sinha, B. de Crombrugghe, The transcriptional activity of the CCAAT-binding factor CBF is mediated by two distinct activation domains, one in the CBF-B subunit and the other in the CBF-C subunit, J. Biol. Chem. 271 (1996) 14485–14491. [16] M. Nicolas, V. Noe, C.J. Ciudad, Transcriptional regulation of the human Sp1 gene promoter by the specificity protein (Sp) family members nuclear factor Y (NF-Y) and E2F, Biochem. J. 371 (2003) 265–275. [17] L.M. Valor, A. Campos-Caro, C. Carrasco-Serrano, J.A. Ortiz, J.J. Ballesta, M. Criado, Transcription factors NF-Y and Sp1 are important determinants of the promoter activity of the bovine and human neuronal nicotinic receptor beta 4 subunit genes, J. Biol. Chem. 277 (2002) 8866–8876. [18] A. Ronchi, M. Bellorini, N. Mongelli, R. Mantovani, CCAAT-box binding protein NF-Y (CBF, CP1) recognizes the minor groove and distorts DNA, Nucleic Acids Res. 23 (1995) 4565–4572. [19] G. Marziali, E. Perrotti, R. Ilari, U. Testa, E.M. Coccia, A. Battistini, Transcriptional regulation of the ferritin heavy-chain gene: the activity of the CCAAT binding factor NF-Y is modulated in heme-treated Friend leukemia cells and during monocyte-to-macrophage differentiation, Mol. Cell. Biol. 17 (1997) 1387–1395. [20] L.F. Good, K.Y. Chen, Cell cycle- and age-dependent transcriptional regulation of human thymidine kinase gene: the role of NF-Y in the CBP/tk binding complex, Biol. Signals 5 (1996) 163–169. [21] Z.F. Chang, C.J. Liu, Human thymidine kinase CCAAT-binding protein is NF-Y, whose A subunit expression is serum-dependent in human IMR-90 diploid fibroblasts, J. Biol. Chem. 269 (1994) 17893–17898. [22] A. Farina, I. Manni, G. Fontemaggi, M. Tiainen, C. Cenciarelli, M. Bellorini, R. Mantovani, A. Sacchi, G. Piaggio, Down-regulation of cyclin B1 gene transcription in terminally differentiated skeletal muscle cells is associated with loss of functional CCAAT-binding NF-Y complex, Oncogene 18 (1999) 2818–2827. [23] B. Roy, A.S. Lee, Transduction of calcium stress through interaction of the human transcription factor CBF with the proximal CCAAT regulatory element of the grp78/BiP promoter, Mol. Cell. Biol. 15 (1995) 2263–2274. [24] S.E. Park, N.D. Kim, Y.H. Yoo, Acetylcholinesterase plays a pivotal role in apoptosome formation, Cancer Res. 64 (2004) 2652–2655. [25] B. Fadeel, S. Orrenius, B. Zhivotovsky, Apoptosis in human disease: a new skin for the old ceremony? Biochem. Biophys. Res. Commun. 266 (1999) 699–717.
The CCAAT-binding factor CBF/NF-Y regulates the human acetylcholinesterase promoter activity during calcium ionophore A23187-induced cell apoptosis Hui Zhu a,b,1 , Wei Gao a,b,1 , Yu-fang Shi b , Xue-Jun Zhang a,⁎ a
b
Laboratory of Molecular Cell Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 320 YueYang Road, Shanghai 200031, China Department of Molecular Genetics, Microbiology and immunology, University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, NJ 08854, USA Received 10 February 2007; received in revised form 4 July 2007; accepted 6 July 2007 Available online 20 July 2007
Abstract We previously reported that the expression of acetylcholinesterase during A23187-induced apoptosis of HeLa cells is regulated by Ca2+ mobilization through the modulation of mRNA stability and acetylcholinesterase promoter activity. Transactivation of the human acetylcholinesterase promoter by A23187 was partially mediated by the distal CCAAT motif within the − 1270 to −1248 fragment of the human acetylcholinesterase promoter, which was bound by the CCAAT binding factor (CBF/NF-Y). In the present study, we investigated the molecular mechanisms by which CBF/NF-Y regulates A23187-induced activation of the human acetylcholinesterase promoter. The results indicate that CBF/NF-Y binding to the distal CCAAT motif suppresses the promoter activity. Electrophoretic mobility shift assays (EMSAs) demonstrated that binding of CBF/NF-Y to the distal CCAAT motif decreased after A23187 treatment. Our results suggest that acetylcholinesterase promoter activation during A23187-induced HeLa cell apoptosis may result partly from the dissociation of CBF/NF-Y from the distal CCAAT motif in the acetylcholinesterase promoter, reversing this suppression. © 2007 Elsevier B.V. All rights reserved. Keywords: Acetylcholinesterase; CBF/NF-Y; Promoter activity; The distal CCAAT motif
1. Introduction Acetylcholinesterase (AChE) is a type B carboxylesterase that rapidly hydrolyzes the neurotransmitter acetylcholine at cholinergic synapses and neuromuscular junctions [1]. AChE is also involved in many non-cholinergic functions such as cell adhesion, cell proliferation, neurite outgrowth, and tumorigenesis [2]. The molecular mechanisms regulating ACHE gene expression have mostly been studied in muscle cells [3–5], neurons, and hematopoietic cells, which have been extensively Abbreviations: AChE, Acetylcholinesterase acetylcholine acetyl hydrolase; CBF/NF-Y, the CCAAT-binding Factor; EMSAs, electrophoretic mobility shift assays; RNAi, RNA interference; PMSF, phenylmethylsulfonyl fluoride ⁎ Corresponding author. Tel.: +86 21 54921402; fax: +86 21 54921403. E-mail address: [email protected] (X.-J. Zhang). 1 These authors contributed equally to this work. 0304-4165/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.bbagen.2007.07.007
reviewed [2]. The transcriptional activity of the ACHE gene has been proposed to play roles in regulating the AChE expression [4,6–9]. Transcription of human AChE mRNA can be driven by a 2.2-kb sequence upstream from the initiator AUG in the ACHE gene, and the promoter sequence of the ACHE gene has been functionally characterized [8,9]. The 2.2-kb human AChE promoter sequence includes multiple potential binding sites for universal and tissue-specific transcription factors such as clustered MyoD elements, E-box, SP1, EGR1, AP-2, and the development-related GAGA motif [9]. The promoter also contains two CCAAT motifs with the distal CCAAT motif located within the − 1270 to − 1248 fragment and the other located within the − 592 to − 571 fragment. We recently showed that the synapse type AChE expression can be induced during apoptosis in various cell types, including those derived from non-muscle, non-nervous, and non-hematopoietic
1476
H. Zhu et al. / Biochimica et Biophysica Acta 1770 (2007) 1475–1482
tissues, suggesting that AChE is a novel regulator of apoptosis [10]. We also reported that intracellular Ca2+ played a critical role in the regulation of AChE expression during apoptosis of HeLa cells induced by the calcium ionophore A23187 by modulating the mRNA stability and promoter activity of the ACHE gene [8]. A23187 increased the activity of the human AChE promoter, with inducibility partially due to the distal CCAAT motif within the −1270 to −1248 fragment of the AChE promoter [8]. We also demonstrated that the CCAAT binding factor (CBF/NF-Y) bound to this motif, suggesting that CBF/NF-Y may mediate AChE transcriptional activity during A23187-induced apoptosis [8]. However, the exact molecular mechanisms by which CBF/NF-Y regulates AChE promoter activity during apoptosis are not fully understood. CBF/NF-Y is one of the most ubiquitous transcription factors, found in a variety of eukaryotes and is highly conserved throughout evolution [11]. CBF/NF-Y is a complex minimally composed of three subunits: CBF-A/NF-YB, CBF-B/NF-YA, and CBF-C/NF-YC, all of which are required for DNA binding [12,13]. CBF/NF-Y is not only involved in high basal-level transcriptional activation, but also contributes to transcriptional regulation induced by various agents [13]. In the present study, we examined the basal levels of AChE promoter activity when the distal CCAAT motif within the − 1270 to − 1248 fragment of the AChE promoter was mutated by transfection of HeLa cells with luciferase constructs. We tested basal levels of AChE promoter activity when endogenous CBF-B/NF-YA subunit expression was knocked down by RNA interference (RNAi). Electrophoretic mobility shift assays (EMSAs) were also performed to identify A23187-dependent changes in the binding of CBF/NF-Y to the distal CCAAT motif. 2. Materials and methods 2.1. Cell culture and treatments HeLa cells were maintained in RPMI 1640 (GIBCO-BRL, Gaithersburg, MD) with 10% fetal bovine serum (GIBCO-BRL, Gaithersburg, MD). 293T human embryonic kidney epithelial cells were cultured in Dulbecco's modified Eagle's medium (GIBCO-BRL, Gaithersburg, MD) with 10% fetal bovine serum (GIBCO-BRL, Gaithersburg, MD). Apoptosis of HeLa cells was induced by 2 μM A23187 (Calbiochem, La Jolla, CA).
2.2. Flow cytometry analysis Both floating and adherent cells were harvested, and fixed in 70% ethanol followed by incubation in PBS containing RNase A (50 μg/ml) for 1 h at 37 °C. Cells were stained with propidium iodide (50 μg/ml) for 15 min at room temperature, and then analyzed by flow cytometry using a Becton-Dickinson FACSorter and Cell Quest software. Apoptotic cells were defined as those containing a lower DNA content than the diploid cells in the G1/G0 phase.
2.3. Immunocytochemistry Immunocytochemistry analysis protocol has been previously described [10]. AChE-TRITC antibody and cleaved caspase-3-FITC antibody were prepared by our own laboratory. Cell pellets were incubated with antibody overnight at 4 °C and stained with Hoechst 33258. Stained cells were analyzed with an Olympus fluorescence microscope.
2.4. Plasmid construction and mutagenesis The 2.2-kb DNA fragment of the human AChE promoter [9] was subcloned into the BglII and HindIII sites of the pGL3 basic vector (Promega, Madison, WI) with a downstream tagged firefly luciferase gene and named pAChE-Luc [8]. The construct containing a mutation in the distal CCAAT motif within the −1270 to − 1248 fragment of the AChE promoter was constructed as described previously [8] and named Distal CCAAT binding mutant. The mammalian expression vector pSUPER (OligoEngine) was used for expression of siRNA in HeLa cells. The gene-specific insert specifies a 19nucleotide sequence corresponding to (1: 5′-GCCGATGAAGAAGCAATGA3′; 2: 5′-CACAGGGTTTGCAGCAAAT-3′; 3: 5′-CTAGAGGCAGAAGGGAAAA-3′; 4: 5′-ACAGGAGCCAATACCAACA-3′) of CBF-B/NF-YA, which is separated by a 9-nucleotide non-complementary spacer (TTCAAGAGA) from the reverse complement of the same 19-nucleotide sequence. The sequences were inserted into the pSUPER backbone after digestion with BglII and HindIII. The constructs were referred to CBF-B siRNA1, CBF-B siRNA2, CBF-B siRNA3, and CBF-B siRNA4, respectively. The mismatch sequence of the target sequence (4: 5′-ACAGGAGCCAATACCAACA-3′) was 5′- GACCGAGACAACACATACA-3′, which was used to construct the negative control construct CBF-B siRNA4mis.
2.5. Transient transfections and luciferase assays Using LipofectAMINE regent (Invitrogen, Carlsbad, CA), HeLa cells were co-transfected with the firefly luciferase reporter construct pAChE-Luc, the Distal CCAAT binding mutant, and the Renilla luciferase reporter plasmid pRLSV40 (Promega, Madison, WI) as an internal control. For co-transfection experiments with CBF-B siRNA vectors, total DNA was normalized to the corresponding pSUPER empty vectors. Luciferase assays were performed according to the Dual-Luciferase Reporter Assay System (Promega, Madison, WI), and activities were measured in a luminometerBGP (MGM). Firefly luciferase activity was normalized based on Renilla luciferase activity in each well. Transfection experiments were independently repeated 3 times.
2.6. Western blotting Cells were resuspended in a lysis buffer (50 mM Tris–HCl pH 8.0, 150 mM NaCl, 0.1% SDS, 10% Nonidet P-40, 0.5% sodium deoxycholate, 1 mM PMSF, 1 μg/ml Aprotinin, and 1.0 μM Pepstain A). After incubation on ice for 30 min, cell lysates were centrifuged at 12,000 rpm for 10 min at 4 °C, and the insoluble pellets were discarded. The protein concentration of the lysates was determined by the BCA protein assay (Pierce, Rockford, IL). Equal amounts of proteins were separated on 10% SDS-PAGE and transferred to a nitrocellulose membrane. Immunoblotting was carried out as described previously [10]. The CBF-B/NF-YA monoclonal antibody and the horseradish peroxidase-conjugated secondary antibody were from Santa Cruz Biotechnology (Santa Cruz, CA). The β-actin monoclonal antibody was from Sigma (St. Louis, MO). Polyclonal rabbit anti caspase-3 (Cell Signaling Technology) was used to test caspase-3 cleavage in HeLa cells apoptosis induced by A23187. The AChE monoclonal antibody was from BD Biosciences (San Jose, CA). The immunoreactive protein was visualized using a chemiluminescence detection kit (ECL, Santa Cruz Biotechnology).
2.7. Electrophoretic mobility shift assays (EMSAs) Nuclear extracts were prepared as described previously [8]. EMSAs were performed with 4 μg of nuclear extract proteins in binding buffer (10 mM Tris– HCl, 1 mM MgCl2, 0.5 mM EDTA, 50 mM NaCl, 0.5 mM DTT, 4% glycerol, pH 7.5) with 1 μg of poly (dI–dC). The binding reactions were incubated for 20 min at room temperature with 20,000 cpm (0.1–0.5 ng) of double-stranded oligonucleotides end-labeled with [γ-32P] ATP using T4 polynucleotide kinase (Invitrogen, Carlsbad, CA). A 100-fold excess of unlabeled double-stranded oligonucleotides were used as competitors where indicated. The sequence of the double-stranded oligonucleotide corresponding to the distal CCAAT site was 5′ACCCCCTAATTGGGGCGGTACCC-3′ and named Wt CCAAT Dist. The sequence of the mutant double-stranded oligonucleotide corresponding to the
H. Zhu et al. / Biochimica et Biophysica Acta 1770 (2007) 1475–1482 distal CCAAT site was 5′-ACCCCCTGATATCGGCGGTACCC-3′ and named Mut CCAAT Dist. The consensus binding sequence for CBF/NF-Y was 5′AGACCGTACGTGATTGGTTAATCT CTT-3′) (sc-2591; Santa Cruz) and named CBF wt. The mutant binding sequence for CBF/NF-Y was 5′AGACCGTACGAAATACGGGAATCTCTT-3′ (sc-2592; Santa Cruz) and named CBF mut. The sequence of the double-stranded oligonucleotide corresponding to the Oct-1 consensus biding site was 5′- TGTCGAATGCAAATCACTAGAA -3′ (sc-2506; Santa Cruz) and named Wt Oct-1. The sequence of the mutant double-stranded oligonucleotide corresponding to the Oct-1 consensus binding site was 5′-TGTCGAATGCAAGCCACTAGAA-3′ (sc-2515; Santa Cruz) and named Mut Oct-1. Antibody supershift assays were carried out in binding buffer, with a further addition of 2 μl of anti-CBF-A/NFYB (sc-13045X), anti-CBF-B/NF-YA (sc-10779 X), and anti-CBF-C/NF-YC (sc-13044X) antibodies (Santa Cruz, CA).
1477
3. Results 3.1. Activation of the AChE promoter activity during A23187-induced HeLa cell apoptosis A23187 is a Ca2+ ionophore that equilibrates Ca2+ gradients across membranes and can cause a rapid rise in intracellular Ca2+ levels. A23187 increased levels of apoptosis in HeLa cells over the course of 72 h, as assessed by the appearance of the subdiploid peak on DNA content analysis (Fig. 1A). Cleavage of caspase-3 is another hallmark of apoptosis. A23187 treatment led to increased caspase-3 cleavage over a 72-h period (Fig. 1B).
Fig. 1. Increases in human AChE promoter activity during A23187-induced HeLa cell apoptosis. (A) A23187 induced apoptosis in HeLa cells. Flow cytometry analysis of DNA content. (B) A23187-induced caspase-3 activation in HeLa cells. Western blot analysis of extract of HeLa cells treated with DMSO (control) or A23187 (2 μM) for indicated time. (C) AChE and cleaved caspase-3 were both positive in condensed nuclei cells (arrow head) while negative in living cells (arrow). Immunocytochemistry analysis of HeLa cells treated with A23187 or DMSO. (D) AChE protein expression level increased according to the lengths of treatment. Western bolt analysis of extract of HeLa cells treated with DMSO (control) or A23187 (2 μM) for indicated time. (E) A23187-dependent increases in human AChE promoter activity. HeLa cells were co-transfected with pAChE-Luc and pRL-SV40. After 24 h, transfected cells were incubated with dimethyl sulfoxide (un-induced control) or induced by A23187 (2 μM) for the indicated lengths of time. AChE promoter activity was analyzed by normalizing firefly luciferase activity to Renilla luciferase activity in each well.
1478
H. Zhu et al. / Biochimica et Biophysica Acta 1770 (2007) 1475–1482
Furthermore, apoptotic cells with condensed nuclei were positive for both AChE and cleaved caspase-3 staining while living cells were negative for both (Fig. 1C). AChE protein expression level increased according to the lengths of treatment (Fig. 1D). We also performed transient transfections of the firefly luciferase reporter construct driven by the human AChE promoter, pAChE-Luc and the Renilla luciferase reporter plasmid, pRL-SV40 as an internal control in HeLa cells and treated with or without A23187 (2 μM) for various lengths of time. There was a significant time-dependent increase in luciferase activity in treated cells compared to the control untreated cells (Fig. 1E). After 72 h, a more than three-fold induction of AChE promoter activity was observed. 3.2. Mutational analysis of the distal CCAAT motif within the AChE promoter We have previously shown that transactivation of the human AChE promoter by A23187 was partially mediated by the distal CCAAT motif within the − 1270 to − 1248 fragment of the human AChE promoter [8]. In the present study, we examined the basal levels of AChE promoter activity when the distal CCAAT motif was mutated. Fig. 2A shows by EMSA that one major complex forms when the distal CCAAT site probe (Wt CCAAT Dist) was incubated with nuclear extracts from HeLa cells. A 100-fold excess of CBF wt consensus oligonucleotide significantly inhibited binding (Fig. 2A, lane 3), whereas the
CBF/NF-Y consensus mutant (CBF mut) could not (Fig. 2A, lane 4). The formation of DNA–protein complexes was also clearly inhibited by anti-CBF antibodies, namely anti-CBF-B/ NF-YA (Fig. 2A, lane 5), CBF-A/NF-YB (Fig. 2A, lane 6), and CBF-C/NF-YC (Fig. 2A, lane 7). An excess of unlabeled probe specific for the distal CCAAT site almost abolished CBF/NF-Y binding, whereas an excess of unlabeled probe that incorporated mutations in the distal CCAAT binding site did not (Fig. 2B, lanes 2–7). Notably, the DNA binding band of CBF/NF-Y from nuclear extracts of HeLa cells treated with A23187 for 48 h was weaker than the one from untreated HeLa cells (Fig. 2B, lanes 2 and 5). The CBF/NF-Y binding bands disappeared when using labeled Mut CCAAT Dist probes, indicating that the mutation of the distal CCAAT sequence destroyed the ability of CBF/NFNY to bind to the distal CCAAT motif (Fig. 2B, lane 8). A lowmobility band was observed when using labeled Mut CCAAT Dist probes (Fig. 2B, lane 8). One possible reason was that mutations in the distal CCAAT motif destroyed the binding activity of CBF/NF-Y, leading to changes in the binding activity of uncharacterized proteins to sequences near the distal CCAAT sequence. Fig. 3 shows that mutation of the distal CCAAT motif increased the basal AChE promoter activity by approximately 10-fold. Since the destruction of CBF/NF-Y binding activity caused an increase in AChE promoter activity, this suggests that CBF/NF-Y binding to the distal CCAAT motif leads to suppression of AChE promoter activity.
Fig. 2. Mutation in the distal CCAAT sequence destroys the binding activity of CBF/NF-NY to the distal CCAAT motif. (A) Competition assays using CBF consensus oligonucleotides and antibodies as competitors. 32P-labeled Wt CCAAT Dist was incubated with nuclear extracts from HeLa cells in the presence of CBF wt (lane 3), CBF mut (lane 4), anti-CBF-B/NF-YA (lane 5), anti-CBF-A/NF-YB (lane 6), and anti-CBF-C/NF-YC (lane 7). (B) 32P-labeled Wt CCAAT Dist was incubated with nuclear extracts from HeLa cells prepared from untreated cells (lanes 2–4) and A23187-treated cells (lanes 5–7). Competition assays were also conducted using oligonucleotides as competitors: Wt CCAAT Dist (lanes 3 and 6) and Mut CCAAT Dist (lanes 4 and 7). 32P-labeled Mut CCAAT Dist was incubated with nuclear extracts from HeLa cells prepared from untreated cells (lane 8).
H. Zhu et al. / Biochimica et Biophysica Acta 1770 (2007) 1475–1482
1479
recting the synthesis of four different 19–base pair doublestranded CBF-B/NF-YA target sequences and compared the ability of these constructs to inhibit the endogenous expression of CBF-B/NF-YA after transient expression in 293T cells. As Fig. 4A shows, CBF-B siRNA4 was the most effective at
Fig. 3. Mutation of the distal CCAAT motif increases basal AChE promoter activity and reduces its inducibility by A23187. HeLa cells were cotransfected with pAChE-Luc or the Distal CCAAT binding mutant plus pRL-SV40. (A) Transfectants were incubated with DMSO or induced by A23187 (2 μM) for 24 h and 48 h. AChE promoter activity was analyzed by normalizing firefly luciferase activity to Renilla luciferase activity in each well. ⁎⁎p b 0.01 = significant difference from cells cotransfected with pAChE-Luc and Distal CCAAT binding mutant. (B) AChE promoter activity was represented as the fold induction relative to un-induced controls. ⁎p b 0.05 = significant difference from cells cotransfected with pAChE-Luc and Distal CCAAT binding mutant.
3.3. AChE promoter activity is enhanced by knockdown of CBF-B/NF-YA All three CBF/NF-Y subunits (CBF-A/NF-YB, CBF-B/NFYA, and CBF-C/NF-YC) are needed for DNA binding and the CBF–DNA complex contains one molecule of each [14]. CBF-A and CBF-C interact with each other to form a stable heterodimer. CBF-B only interacts with the CBF-A/CBF-C heterodimer to form a heterotrimer that then binds to DNA [13]. Only the heterotrimeric CBF forms a CBF–DNA complex, and differential expression of CBF-B/NF-YA can result in variable CBF/NF-Y activity [13]. To further test the suppressive effect of CBF/NF-Y binding to the distal CCAAT motif on AChE promoter activity, we examined the regulation of the AChE promoter activity when the endogenous CBF-B/NF-YA protein was knocked down by RNAi. We designed four constructs (CBF-B siRNA1–4) di-
Fig. 4. Knockdown of endogenous CBF-B/NF-YA expression results in an increase in basal levels of human AChE promoter activity and a decrease in the A23187-induced AChE promoter activity. (A) Endogenous CBF-B/NF-YA expression was knocked down by siRNA. 293T cells were co-transfected with pSUPER or constructs expressing CBF-B/NF-YA siRNA CBF-B siRNA1-4. After 48 h, CBF-B/NF-YA protein levels were analyzed by western blot. (B) Each well of HeLa cells was co-transfected with 0.3 μg pAChE-Luc, 0.03 μg pRL-SV40, along with different amounts of CBF-B siRNA4 or CBF-B siRNA4mis. Each well was also co-transfected with the corresponding empty vectors to keep the amount of transfected DNA constant. After 24 h, firefly luciferase activity was normalized against Renilla luciferase activity in each well. (C) Each well of HeLa cells was co-transfected with 0.3 μg pAChE-Luc, 0.03 μg pRL-SV40 and 0.6 μg empty vector plasmid or CBF-B siRNA4. After 24 h, HeLa cells were treated with 2 μM A23187 or DMSO. After 24 h, firefly luciferase activity was normalized against Renilla luciferase activity in each well.
1480
H. Zhu et al. / Biochimica et Biophysica Acta 1770 (2007) 1475–1482
knocking down CBF-B/NF-YA protein expression. Transfection of siRNA targeting the CBF-B/NF-YA gene resulted in a distinct reduction in endogenous CBF-B/NF-YA protein expression. Next, we showed that after knockdown of CBF-B/NF-YA expression, basal AChE promoter activity increased in a dose-dependent fashion based on the amount transfected (Fig. 4B) whereas transfection of CBF-B siRNA4mis was unable to enhance AChE promoter activity. Furthermore, in CBF-B/NF-YA siRNA transfected cells, the A23187-induced increase in the AChE promoter activity is blocked (Fig. 4C), further indicating that CBF/NF-Y is involved in the regulation of AChE promoter activity during A23187 induced apoptosis and binding of CBF/NF-Y to the distal CCAAT motif within the AChE promoter caused a decrease in AChE promoter activity. 3.4. CBF/NF-Y binding to the CCAAT motif is decreased in nuclear extracts from HeLa cells treated with A23187 To elucidate how CBF/NF-Y regulates AChE promoter activity during A23187-induced apoptosis, we next examined A23187-dependent changes in the interaction of CBF/NF-Y with the distal CCAAT motif within the AChE promoter. Nuclear extracts were prepared from HeLa cells treated or untreated with A23187 and EMSAs were performed with the Wt CCAAT Dist sequence as the labeled probe. Two major complexes (I and II) were observed in the presence of extract (Fig. 5A). Complex I may be a nonspecific binding complex since it was largely eliminated by pre-incubation with increasing amounts of poly (dI–dC) (Fig. 5A, lanes 12–14). Complex II was specific for Wt CCAAT Dist and referred to CBF/NF-Y because an excess of unlabeled Wt CCAAT Dist probes abolished complex II whereas an excess of unlabeled Mut CCAAT Dist probes did not (Fig. 5A, lanes 6–11). Fig. 5A also shows that the DNA binding activity of CBF/NF-Y from nuclear extracts of cells treated with A23187 significantly decreased as the length of incubation with A23187 increased (Fig. 5A, lanes 2–5). The DNA binding activity of CBF/NF-Y in untreated cells was the highest. To assess whether the decreasing binding of CBF/NF-Y to Wt CCAAT Dist was special, we also tested the binding of Oct-1 to the Oct-1 consensus binding sequence Wt Oct-1 in nuclear extracts of HeLa cells untreated or treated with A23187. The DNA–protein band corresponded to Oct-1 binding, for it disappeared almost completely in the presence of excess of unlabeled Wt Oct-1 probes, whereas an excess of unlabeled Mut Oct-1 was unable to compete with the binding activity (Fig. 5B, lanes 6–7). Compared with CBF/NF-Y, the binding of Oct-1 did not decrease in nuclear extracts prepared from HeLa cells treated with A23187 for less than 48 h (Fig. 5B, lanes 2–4), indicating that the decreasing binding of CBF/NF-Y to Wt CCAAT Dist with A23187-treated time is special. The binding activity of Oct-1 was slightly reduced in extracts of HeLa cells treated with A23187 for 72 h, possibly due to protein degradation during the later stages of A23187-induced apoptosis. The decrease in the binding activity of CBF/NF-Y to the distal CCAAT motif within the AChE promoter was associated with the increased AChE promoter activity (Fig. 1B), further suggesting
Fig. 5. A23187-dependent decreases in the interactions of CBF/NF-Y with the distal CCAAT motif. (A) 32P-labeled Wt CCAAT Dist was incubated with nuclear extracts from HeLa cells prepared from untreated cells (lanes 2, 6–8, 12–14) and A23187-treated cells (lanes 3–5, 9–11). Competition assays were also conducted using oligonucleotides as competitors: Wt CCAAT Dist (lanes 7 and 10) and Mut CCAAT Dist (lanes 8 and 11). (B) The binding of Oct-1 to Wt Oct-1 does not decrease in nuclear extracts prepared from HeLa cells treated with A23187 for less than 48 h. 32P-labeled Wt Oct-1 was incubated with nuclear extracts from HeLa cells prepared from untreated cells (lane 2) and A23187treated cells (lanes 3–7). Competition assays were also conducted using consensus oligonucleotides as competitors: Wt Oct-1 (lane 6) and Mut Oct-1 (lane 7).
that a suppressive effect exists when CBF-B/NF-Y binds to the distal CCAAT motif. The results also suggest that A23187 upregulates AChE promoter activity at least in part through the loss of CBF/NF-Y binding to the distal CCAAT sequence within the AChE promoter. We demonstrated that A23187 could eliminate CBF/NF-Y proteins from the distal CCAAT motif within the AChE promoter and reverse the suppressive effect, resulting in the observed increase in AChE promoter activity. 4. Discussion The CCAAT motif is one of the most common elements in eukaryotic promoters. Mammalian promoters containing the
H. Zhu et al. / Biochimica et Biophysica Acta 1770 (2007) 1475–1482
CCAAT motif are divided into three groups based on the effect of mutations of this motif on promoter activity of [13]. In group I, mutation of the CCAAT motif decreases basal promoter activity. In groups II and III, the CCAAT motif is necessary for the induction of promoter activity by various agents and for the alteration of promoter activity during cell growth, respectively. CBF/NF-Y is one of several proteins that bind to CCAAT motifs and requires a high degree of conservation of the CCAAT sequence [13]. The transcriptional activation functions reside in the large N-terminal end of CBF-B/NF-YA and in the C-terminal end of CBF-C/NF-YC [15]. However, it has also been reported previously that mutations in CBF/NF-Y sites cause an increase in promoter activity [16,17]. Nicolas et al. have reported that mutation of the NF-Y site in the NF-Y/Sp1overlapping box within the human Sp1 promoter resulted in an increase in Sp1 binding to the overlapping box, and caused an increase in its promoter activity [16]. A repressing mechanism may also be involved in the regulation of the human nicotinic receptor gene by NF-Y, as suggested by the increase in transcriptional activity observed in C2C12 and COS cells after mutating the NF-Y site in a NF-Y/Sp1 overlap site [17]. Ronchi et al. [18] showed that NF-Y could induce bends of 62–82° at the site of a CCAAT box in DNA and that the degree of bending was influenced by the flanking sequence. Hence, a possible explanation for our findings is that the loss of CBF/NF-Y binding to the distal CCAAT motif induces a critical conformational change in the AChE promoter, which in turn alters the affinity of cis-acting elements for their trans-acting factors. The absence of CBF/NF-Y may facilitate the binding of some other activating factor. In fact, EMSAs performed with a probe in which the CBF/NF-Y site had been altered (Fig. 1B, lane 8) revealed the formation of a complex that was not observed with the wild-type probe. Interestingly, since there is also an overlap within the Sp1 and the distal CCAAT sites of the AChE promoter, the absence of CBF/NF-Y would alleviate steric restrictions and increase the binding of Sp1, thus helping to enhance promoter activity, which deserves further study. CBF/ NF-Y can also increase the binding affinity of neighboring factors and make the two complexes much more stable on the DNA [12]. The binding of CBF/NF-Y to the distal CCAAT motif may also stabilize the binding of other repressors to the juxtaposed site. Thus, the absence of CBF/NF-Y destabilizes binding of the repressor and increases AChE promoter activity. Differential expression of CBF-B/NF-YA has been observed in several cell lines under specific conditions that also resulted in alterations in CBF-dependent promoter activity [19–22]. There is mounting evidence that CBF-B/NF-YA is a regulatory subunit of the trimeric complex, whose levels vary in different cell types and/or under different growth conditions, which response for different CBF binding to DNA [12]. In the present study, we selected CBF-B/NF-YA as a target and inhibited endogenous CBF-B/NF-YA expression by RNAi. We hypothesized that decreasing the expression of CBF-B/NF-YA may affect the formation of the trimeric complex, resulting in a reduction in the binding activity of CBF/NF-Y to the CCAAT motif. Our results showed that endogenous CBF-B/NF-YA
1481
expression was significantly inhibited and the basal AChE promoter activity increased as expected, further suggesting that CBF/NF-Y bound to the distal CCAAT motif suppresses AChE promoter activity. Decreases in CBF/NF-Y binding to the distal CCAAT motif of the AChE promoter were also observed after A23187 treatment. Given the suppressive effect of CBF/NF-Y binding to the distal CCAAT motif, this repression may be relieved by the decrease in binding of CBF/NF-Y to the CCAAT motif after A23187 treatment, resulting in the increase in AChE promoter activity. The challenge now is to delineate changes in the binding of other transcriptional activators or repressors upon decreases in CBF/NF-Y binding. The reason for the loss in CBF/NF-Y binding is not clear. The expression of the three subunits of CBF/NF-Y did not decrease after A23187 treatment (data not shown). Though it has been reported that the binding of NF-Y to DNA is influenced by intracellular calcium concentration during transcriptional regulation of the GRP78/ Bip gene [23], differences in the binding of CBF/NF-Y to the distal CCAAT motif at different calcium concentrations were not observed in DNA binding experiments in vitro (data not shown). During A23187-induced apoptosis of HeLa cells, A23187 can cause a rapid rise in intracellular Ca2+ levels and perturb the nucleus calcium homeostasis, thus high nucleus calcium concentration may decrease the binding activity of CBF/NF-Y upon the CCAAT motif or destabilize CBF/NF-Y binding to the CCAAT site. Changes in the nucleus calcium homeostasis may also change the modification of CBF/NF-Y subunits and change the interactions of CBF/NF-Y with other transcription factors, resulting the decrease in the binding of CBF/NF-Y to the CCAAT motif, all of which need to be further examined. Blocking the expression of AChE with antisense oligonucleotides inhibited apoptosis [10], and silencing of the AChE gene by siRNA abolished the decrease in cell viability [24], suggesting that AChE could be a novel regulator of apoptosis. Although it has been reported that AChE plays a pivotal role in the formation of apoptosome during apoptosis, the more detailed molecular mechanism explaining the role of AChE in apoptosis should be elucidated. Further investigation of the mechanisms regulating AChE expression during apoptosis may help us to elucidate the function of AChE during apoptosis and develop improved therapeutic methods to regulate apoptosis which is an important factor in prominent diseases including cancers and neurodegenerative disorders such as Alzheimer's and Parkinson's disease (where unwanted apoptosis of neurons occurs) [25]. 5. Conclusion In the present study, we examined the molecular basis of CBF/NF-Y regulation of the AChE promoter during A23187induced apoptosis of HeLa cells. We showed that binding of CBF/NF-Y to the distal CCAAT motif inhibited AChE promoter activity, and that A23187 increased AChE promoter activity at least in part through the dissociation of CBF/NF-Y from the distal CCAAT motif within the AChE promoter.
1482
H. Zhu et al. / Biochimica et Biophysica Acta 1770 (2007) 1475–1482
Acknowledgments We thank Dr. Hermona Soreq of The Hebrew University of Jerusalem, Israel and Dr. Karl W. K. Tsim of The Hong Kong University of Science and Technology, Hong Kong for providing us with the human AChE promoter construct. This work was supported in part by National Natural Science Foundation of China Grants (30570920), The third phase creative program of Chinese Academy of Sciences (KSCX1YW-R-13), National Key Basic Research Project 973 (2005CB522602), and Science and Technology Commission of Shanghai Municipality (06JC14076, 06DZ22032). References [1] P. Taylor, Z. Radic, The cholinesterases: from genes to proteins, Annu. Rev. Pharmacol. Toxicol. 34 (1994) 281–320. [2] H. Soreq, S. Seidman, Acetylcholinesterase—new roles for an old actor, Nat. Rev., Neurosci. 2 (2001) 294–302. [3] E.K. Tung, R.C. Choi, N.L. Siow, J.X. Jiang, K.K. Ling, J. Simon, E.A. Barnard, K.W. Tsim, P2Y2 receptor activation regulates the expression of acetylcholinesterase and acetylcholine receptor genes at vertebrate neuromuscular junctions, Mol. Pharmacol. 66 (2004) 794–806. [4] L.M. Angus, R.Y. Chan, B.J. Jasmin, Role of intronic E- and N-box motifs in the transcriptional induction of the acetylcholinesterase gene during myogenic differentiation, J. Biol. Chem. 276 (2001) 17603–17609. [5] Z. Luo, M.E. Fuentes, T. Yaylor, Regulation of acetylcholinesterase mRNA stability by calcium during differentiation from myoblasts to myotubes, J. Biol. Chem. 269 (1994) 27216–27223. [6] T.V. Cohen, W.R. Randall, The regulation of acetylcholinesterase by ciselements within intron I in cultured contracting myotubes, J. Neurochem. 98 (2006) 723–734. [7] T.V. Cohen, W.R. Randall, NFATc1 activates the acetylcholinesterase promoter in rat muscle, J. Neurochem. 90 (2004) 1059–1067. [8] N.L. Siow, R.C. Choi, A.W. Cheng, J.X. Jiang, D.C. Wan, S.Q. Zhu, K.W. Tsim, A cyclic AMP-dependent pathway regulates the expression of acetylcholinesterase during myogenic differentiation of C2C12 cells, J. Biol. Chem. 277 (2002) 36129–36136. [9] R. Ben Aziz-Aloya, S. Seidman, R. Timberg, M. Sternfeld, H. Zakut, H. Soreq, Expression of a human acetylcholinesterase promoter–reporter construct in developing neuromuscular junctions of Xenopus embryos, Proc. Natl. Acad. Sci. U. S. A. 90 (1993) 2471–2475. [10] X.J. Zhang, L. Yang, Q. Zhao, J.P. Caen, H.Y. He, Q.H. Jin, L.H. Guo, M. Alemany, L.Y. Zhang, Y.F. Shi, Induction of acetylcholinesterase expression during apoptosis in various cell types, Cell Death Differ. 9 (2002) 790–800.
[11] X.Y. Li, R. Mantovani, R. Hooft van Huijsduijnen, I. Andre, C. Benoist, D. Mathist, Evolutionary variation of the CCAAT-binding transcription factor NF-Y, Nucleic Acids Res. 20 (1992) 1087–1091. [12] R. Mantovani, The molecular biology of the CCAAT-binding factor NF-Y, Gene 239 (1999) 15–27. [13] S.N. Maity, B. de Crombrugghe, Role of the CCAAT-binding protein CBF/ NF-Y in transcription, Trends Biochem. Sci. 23 (1998) 174–178. [14] S.N. Maity, B. De Crombrugghe, Purification, characterization, and role of CCAAT-binding factor in transcription, Methods Enzymol. 273 (1996) 217–232. [15] F. Coustry, S.N. Maity, S. Sinha, B. de Crombrugghe, The transcriptional activity of the CCAAT-binding factor CBF is mediated by two distinct activation domains, one in the CBF-B subunit and the other in the CBF-C subunit, J. Biol. Chem. 271 (1996) 14485–14491. [16] M. Nicolas, V. Noe, C.J. Ciudad, Transcriptional regulation of the human Sp1 gene promoter by the specificity protein (Sp) family members nuclear factor Y (NF-Y) and E2F, Biochem. J. 371 (2003) 265–275. [17] L.M. Valor, A. Campos-Caro, C. Carrasco-Serrano, J.A. Ortiz, J.J. Ballesta, M. Criado, Transcription factors NF-Y and Sp1 are important determinants of the promoter activity of the bovine and human neuronal nicotinic receptor beta 4 subunit genes, J. Biol. Chem. 277 (2002) 8866–8876. [18] A. Ronchi, M. Bellorini, N. Mongelli, R. Mantovani, CCAAT-box binding protein NF-Y (CBF, CP1) recognizes the minor groove and distorts DNA, Nucleic Acids Res. 23 (1995) 4565–4572. [19] G. Marziali, E. Perrotti, R. Ilari, U. Testa, E.M. Coccia, A. Battistini, Transcriptional regulation of the ferritin heavy-chain gene: the activity of the CCAAT binding factor NF-Y is modulated in heme-treated Friend leukemia cells and during monocyte-to-macrophage differentiation, Mol. Cell. Biol. 17 (1997) 1387–1395. [20] L.F. Good, K.Y. Chen, Cell cycle- and age-dependent transcriptional regulation of human thymidine kinase gene: the role of NF-Y in the CBP/tk binding complex, Biol. Signals 5 (1996) 163–169. [21] Z.F. Chang, C.J. Liu, Human thymidine kinase CCAAT-binding protein is NF-Y, whose A subunit expression is serum-dependent in human IMR-90 diploid fibroblasts, J. Biol. Chem. 269 (1994) 17893–17898. [22] A. Farina, I. Manni, G. Fontemaggi, M. Tiainen, C. Cenciarelli, M. Bellorini, R. Mantovani, A. Sacchi, G. Piaggio, Down-regulation of cyclin B1 gene transcription in terminally differentiated skeletal muscle cells is associated with loss of functional CCAAT-binding NF-Y complex, Oncogene 18 (1999) 2818–2827. [23] B. Roy, A.S. Lee, Transduction of calcium stress through interaction of the human transcription factor CBF with the proximal CCAAT regulatory element of the grp78/BiP promoter, Mol. Cell. Biol. 15 (1995) 2263–2274. [24] S.E. Park, N.D. Kim, Y.H. Yoo, Acetylcholinesterase plays a pivotal role in apoptosome formation, Cancer Res. 64 (2004) 2652–2655. [25] B. Fadeel, S. Orrenius, B. Zhivotovsky, Apoptosis in human disease: a new skin for the old ceremony? Biochem. Biophys. Res. Commun. 266 (1999) 699–717.