The cdc25 protein controls tyrosine dephosphorylation of the cdc2 protein in a cell-free system

Cell, Vol. 64, 903-914,

March

6, 1991, Copyright

0 1991 by Cell Press

The cdc25 Protein Controls Tyrosine Dephosphorylation of the cdc2 Protein in a CelLFre6 System Akiko Kumagai and William G. Dunphy Division of Biology California Institute of Technology Pasadena, California 91125

Summary As a prerequisite for the activation of MPF, the cdc2 protein kinase must undergo tyrosine dephosphorylation. Genetic studies have demonstrated that the cdc25 protein activates the cdc2 protein kinase once DNA replication has been completed. We have produced the cdc25 protein in bacteria and shown that it activates MPF in Xenopus extracts. In extracts that normally cannot enter mitosis owing to inhibition of DNA synthesis, the addition of active cdc25 protein efficiently elicits the mitotic state by inducing premature dephosphorylation of tyrosine on the cdc2 protein. The cdc25-dependent activation reaction can be reconstituted in a partially purified system lacking ATP. These biochemical experiments demonstrate that the cdc25 protein actively drives tyrosine dephosphorylation of the cdc2 protein and offer the prospect for characterizing the individual factors that regulate the activation of MPF during the progression from S phase to mitosis. Introduction In dividing eukaryotic cells, a circuit of regulatory enzymes oversees both the initiation and completion of the major transitions of the cell cycle. This regulatory network guarantees that the successive events of the cell cycle occur in a faithful and punctual manner. For example, mitosis cannot begin until the cell has grown sufficiently and replicated itsgenome accurately. Likewise, cell division cannot ensue until the mitotic spindle has distributed the chromosomes equally to both daughter cells. A central player in these critical regulatory events is M phase-promoting factor or MPF (for reviews and background references see Do&e, 1990; Dunphy and Newport, 1988; Hunt, 1989; Lewin, 1990; Lohka, 1989; Murray and Kirschner, 1989a; Nurse, 1990; Pines and Hunter, 1990). ,A biochemical elucidation of cell cycle control mechanisms will require a molecular description of the processes that govern the activation of MPF at prophase and the subsequent inactivation of MPF at the metaphase-anaphase transition. MPF is known to consist of two distinct subunits: the cdc2 protein kinase (Dunphy et al., 1988; Gautier et al., 1988) and cyclin (Draetta et al., 1989; Gautier et al., 1990; Labbe et al., 1989a; Meijer et al., 1989; Murray and Kirschner, 1989b; Pines and Hunter, 1989). Near the end of mitosis, MPF most probably directs its own inactivation by turning on a protease system that destroys thecyclinsubunit(Murrayetal., 1989). In parallel, thecdc2 protein loses its kinase activity. In contrast to the completion of mitosis, the activation of

MPF at the onset of M phase appears to be the result of extensive interaction between competing stimulatory and inhibitory molecules. This complexity stems from the fact that the cell must temporally coordinate the activation of MPF with earlier events in the cell cycle. In addition, the cell must possess monitoring systems that verify that numerous biochemical prerequisites for mitosis, such as cell growth, centriole duplication, and DNA replication, have taken place normally (Hartwell and Weinert, 1989). An outline of the molecular events leading to the activation of MPF has taken shape rapidly over the past several years. During each cell cycle, fresh cyclin protein is produced to replace the protein degraded in the previous division (Evans et al., 1983; Murray and Kirschner, 1989b; Minshull et al., 1989). However, the binding of new cyclin protein to cdc2 does not immediately regenerate active MPF. Before mitosis, the cdc2 protein receives inhibitory phosphate groups from distinct kinases whose role is to check the premature activation of MPF. In particular, cdc2 is suppressed by tyrosine phosphorylation and most probably by threonine phosphorylation (Draetta et al., 1988; Dunphy and Newport, 1989; Gautier et al., 1989; Labbe et al., 1989b; Gould and Nurse, 1989; Morla et al., 1989; Pondaven et al., 1990; Russell and Nurse, 1987; Solomon et al., 1990). The dephosphorylation of cdc2 in the latent precursor to MPF (pre-MPF) appears to be an important rate-determining event in MPF activation (Felix et al., 1990). The biochemical mechanisms regulating the dephospho rylation and activation of the cdc2 protein can be studied conveniently in extracts from Xenopus eggs and oocytes. In extracts from activated eggs, the periodic alternation between S phase and mitosis can be recreated in vitro (Lohka and Masui, 1983; Murray and Kirschner, 1989b). During each cycle, the DNA in newly formed nuclei replicates, and, after the completion of DNA synthesis, the nuclei undergo disassembly following activation of the pre-MPF that had accumulated during interphase. In lysates from Xenopus oocytes, a stored supply of pre-MPF can be activated in a cell-free reaction (Wasserman and Masui, 1975; Cyert and Kirschner, 1988). The activation of pre-MPF entails tyrosine dephosphorylation of cdc2 and activation of its capacity to phosphorylate mitotic substrates (Dunphy and Newport, 1989). Several negative regulatorsof this reaction have been described. One inhibitory factor is INH, which appears to contain a phosphatase that negatively controls mitotic activation (Cyert and Kirschner, 1988). Another inhibitory molecule is fission yeast p13 (the sucl gene product). p13 binds directly to the cdc2 protein and can effectively block the process of tyrosine dephosphorylation in vitro (Hayles et al., 1986a, 1986b; Brizuela et al., 1987; Dunphy et al., 1988; Dunphy and Newport, 1989). However, since genetic studies have not yet provided a definitive picture of the role of p13 in vivo, it remains to be established whether this inhibitory effect reflects a true physiological function of p13 (Hayles et al., 1986a, 1986b; Moreno et al., 1989). The activation of pre-MPF at the onset of M phase must

Cell 904

involve the recruitment of one or more cdcPspecific phosphatases. Genetic studies in fission yeast have established that the cdc25 protein kinase serves as a ratedetermining activator of the cdc2 protein kinase (Russell and Nurse, 1988; Moreno et al., 1990). In yeast mutants with a conditionally defective cdc25 protein, the tyrosine phosphorylated form of cdc2 accumulates at the restrictive temperature (Gould and Nurse, 1989; Ducommun et al., 1990). Moreover, yeast ceils that express a mutant cdc2 protein that cannot be phosphorylated on tyrosine do not require the cdc25 protein to enter mitosis (Gould and Nurse, 1989). These and related observations have led to the notion that the cdc25 protein controls the tyrosine dephosphorylation of cdc2 either by activating a tyrosine phosphatase or by inhibiting a tyrosine kinase. Furthermore, on the basis of the recent findings of Enoch and Nurse (1990), the stimulation of cdc2specific tyrosine dephosphorylation appears to be coupled to the completion of DNA synthesis. Enoch and Nurse (1990) reported that yeast cells in which the cdc25 control pathway had been circumvented can enter mitosis before the completion of S phase. Thus, the cdc25 protein normally helps to ensure that mitosis does not occur until there are two faithful copies of the genome for transmission to daughter cells. To examine the biochemistry of the cdc25 protein and its regulation during the cell cycle, we have introduced bacterially produced cdc25 protein into Xenopus extracts. In particular, we have used the Drosophila cdc25 homolog encoded by the string gene (Edgar and CYFarrell, 1989; CYFarrell et al., 1989). We find that the recombinant cdc25 protein efficiently induces the tyrosine dephosphorylation of the Xenopus cdc2 protein, thus corroborating the genetic experiments in yeast. The dephosphorylation is clearly driven by an increase in phosphatase activity rather than a decrease in kinase activity. Moreover, the active cdc25 protein can bypass the need for complete DNA synthesis and induce mitosis in the presence of unreplicated DNA. These experiments should provide a means for examining the molecular mechanism of MPF activation and, more broadly, should allow delineation of the regulatory pathways that guarantee that mitotic activation occurs at the appropriate time during the cell cycle. Results Production of the Drosophila cdc25 Protein in Bacteria To isolate amounts of cdc25 protein sufficient for biochemical studies, we utilized a bacterial expression system (Studier et al., 1990). In initial studies, we produced a fragment of the Drosophila cdc25 protein comprising the C-terminal 60% of the full-length polypeptide (Figure 1A). This truncated polypeptide (designated ~35~~7 contains all of the amino acids that have been conserved in evolution between yeast, flies, and humans (Russell and Nurse, 1986; Edgar and O’Farrell, 1989; Russell et al., 1989; Sadhu et al., 1990). As is typically the case, the vast majority of p35”dc= was found in the insoluble, inclusion body fraction of lysates from overexpressing bacteria. We solubilized the precipitated ~35~“~~ in 8 M urea, removed the urea by slow dialysis, and found that the protein refolded into a

A

B

-61

Figure

1. Production

of cdc25

Protein

in Bacteria

p35’6’25 (A) and p61cdcz5 (6) were produced in Escherichia coli as described in Experimental Procedures. Each polypeptide (5 vgof protein) was electrophoresed in a 10% acrylamide gel and stained with Coomassie blue.

soluble form. Subsequently, we produced the full-length cdc25 protein (designated p61cdcZ5) by a similar method (Figure 1 B). After renaturation, both p35cdc25and p61cdcZ5 migrated on a gel filtration column (Sephacryl S-200) with the expected mobilities for monomeric species. The cdc25 Protein Induces the Activation of Pre-MPF in Xenopus Oocyte Extracts To test the ability of the bacterially expressed cdc25 protein to regulate the tyrosine dephosphorylation of the cdc2 protein, we first utilized extracts from Xenopus oocytes. In vivo, Xenopus oocytes remain blocked in G2/prophase until meiotic maturation into unfertilized eggs. The oocytes contain a store of pre-MPF that can be activated in a cellfree reaction in the presence of small amounts of crude mitotic extract from unfertilized eggs (Cyert and Kirschner, 1988). During this in vitro reaction, the Xenopus cdc2 protein undergoes tyrosine dephosphorylation and acquires the ability to phosphorylate mitotic substrates such as histone Hl (Dunphy and Newport, 1989). The tyrosine dephosphorylation of cdc2 can be monitored conveniently by immunoblotting with anti-phosphotyrosine antibodies, and elevation of CdcBassociated kinase activity can be assessed easily by measuring the incorporation of radioactive phosphate into exogenously added histone Hl We added varying concentrations of ~35~“~ and p61 CdC25 to oocyte extracts, and found that both proteins were potent inducers of cdc2specific tyrosine dephosphorylation (Figure 2). ~35”~“‘~ and p61 cdc25induced half-maximal removal of phosphotyrosine in 60 min at concentrations of 2 pglml (60 nM) and 5 Kg/ml (80 nM), respectively, as judged by immunoblotting with anti-phosphotyrosine antibodies. At higher concentrations, the removal of phosphotyrosine proceeded to completion in 60 min or less (Figure 2). The rate of tyrosine dephosphorylation could be quite rapid. For example, at a concentration of 30 f.rg/ml, ~35~~“‘~ elicited complete tyrosine dephosphorylation within 15 min at 23% Control experiments indicated that the abundance of Xenopus cdc2 protein remained constant in the

cdc25-Dependent 9at5

Dephosphorylation

A

a

b

B

abcdefgh

c

of cdc2

d

e

f

separate biochemical criteria-tyrosine dephosphorylation and kinase activation-recombinant cdc25 protein is fully capable of activating pre-MPF in G2/prophase-arrested extracts from Xenopus oocytes. A further consideration is whether the concentrations of cdc25 protein that we have used are physiologically relevant. By quantitative immunoblotting with known amounts of bacterially produced Xenopuscdc2 protein, we have estimated that theconcentration of endogenous cdc2 protein in Xenopus oocyte extracts is approximately 200 nM. Since this value is not largely different from the levels of exogenous cdc25 protein that we have added, it seems reasonable to expect that these in vitro experiments represent a physiological process. Finally, we have observed that the C-terminal 60% of the Drosophila cdc25 protein appears to be qualitatively and quantitatively similar to the full-length protein in its capacity to activate pre-MPF.

g

34-W

-a

0

I

I

I

10

20

30

protein (pg/ml) Figure 2. The cdc25 Protein Induces Tyrosine Dephosphorylation the cdd Subunit of Pre-MPF in Oocyte Cytoplasm

of

The total soluble fraction (5 ~1 volume) from oocytes was incubated for 1 hr at 23°C either in the presence of control buffer (lane a in each gel) or in the presence of the indicated concentrations of cdc25 protein. The activities of both p35c6c*5 (gel A) and p61 cdc25(gel B) were examined. The concentrations of the tested proteins were: lane b, 60 &ml; lane c, 30 @g/ml; lane d, 15 pglml; lane e, 6 pglml; lane f, 4 pg/ml; lane g, 2 pglml; and lane h, 1 Kg/ml. Each photograph depicts an immunoblot probed with anti-phosphotyrosine antibodies as described in Experimental Procedures. The marker denotes the Xenopus cdc2 protein (p:34). (C) Graphical depiction of the phosphotyrosine content of cdc2 in (A) and (B) determined by densitometric scanning of the immunoblots. The x axis indicates the final concentration of cdc25 protein. Open circles, tyrosine dephosphorylation induced by p35cd’25. Closed circles, tyrosine dephosphotylation induced by p61c”c25.

presence of recombinant cdc25 protein (as judged by immunoblotting with anti-cdc2 antibodies), indicating that the reduced labeling with anti-phosphotyrosine antibodies was due to tyrosine dephosphorylation and not proteolysis of the cdc2 protein. In addition, the phosphotyrosine content of other proteins in the extract was largely unchanged, demonstrating that the cdc254nduced tyrosine dephosphorylation is selective for the cdc2 protein. Finally, sodium vanadate, an inhibitor of the known tyrosine phosphatases (Tonks et al., 1988; Morla et al., 1989), completely blocked the dephosphorylation reaction. In addition to cdc2-specific tyrosine dephosphorylation, bacterially produced cdc25 protein also induced activation of cdc2-associated histone Hl kinase activity. At saturating concentrations of 15 pglml and 30 pglml, respectively, P35cdc’5 and p61 cdc25caused an 8.2-fold and 7.8-fold increase in Hl kinase activity (data not shown). Thus, by two

The Tyrosine-Phosphorylated Form of cdc2 Accumulates When DNA Replication Cannot Be Completed To examine the ability of the recombinant cdc25 protein to regulate the progression from S phase to M phase during the mitotic cycle, we turned our attention to activated egg extracts that can undergo the entire cell cycle in vitro (Lohka and Masui, 1983; Murray and Kirschner, 1989b; Murray et al., 1989). Routinely, we prepared extracts from unactivated eggs, added sperm chromatin, and then drove the extracts into interphase with calcium ion. Typically, nuclear assembly around the sperm chromatin is complete 30 min after calcium-induced activation. Subsequently, the extracts enter mitosis (about 80-90 min after activation) in response to the synthesis of endogenous cyclin. As a result of the entry into mitosis, the reconstituted nuclei undergo nuclear envelope disassembly and chromosome condensation. We set out to examine the ability of the cdc25 protein to regulate dephosphorylation of cdc2 under conditions where mitotic initiation depends upon the prior completion of DNA synthesis. First, we monitored the phosphotyrosine content of cdc2 under conditions where the extracts were blocked in interphase with aphidicolin, an inhibitor of DNA synthesis, according to the protocol described by Dasso and Newport (1990). The aphidicolin-induced arrest in the cell cycle is most likely due to the generation of an inhibitor that accumulates in the presence of unreplicated DNA (reviewed in Hartwell and Weinert, 1989). Since the activation of MPF is required for mitosis, this inhibitor presumably acts directly or indirectly upon a component of MPF. In control cycling extracts with no inhibitors of cell cycle progression, the tyrosine phosphorylation of the cdc2 protein increased in a linear fashion for the first 75 min, and then abruptly decreased at 90 min, when the extract entered mitosis (Figure 3A). If we added cycloheximide to the extracts to block the synthesis of cyclin, the tyrosine phosphorylation of the cdc2 protein remained low throughout the incubation (Figure 38). On the other hand, if we added aphidicolin, tyrosine phosphorylation of the cdc2 protein readily occurred and continued to increase to very high

Cell 906

abcdefghr

A

34

C

Figure 4. Inhibition of Nuclear Transport Allows Tyrosine lation but Not Dephosphorylation of the cdc2 Protein Figure 3. Tyrosine Dephosphorylation DNA Synthesis Is Inhibited

of cdc2 Cannot

Occur

When

CSF extracts from unactivated Xenopus eggs containing 1000 frog sperm nuclei per ul were activated by the addition of Car& (0.4 mM, final concentration) at t = 0. The marker denotes the Xenopus cdc2 protein (~34). This identification is based upon the fact that this poly peptide is immunoprecipitated with anti-cdc2 antibodies and is retained on pl3-agarose (see Dunphy and Newport, 1969). Aliquots (2 pl) were removed, subjected to SDS gel electrophoresis, and immunoblotted with anti-phosphotyrosine antibodies at the following times: lane a, 15 min; lane b, 30 min; lane c, 45 min; lane d, 60 min; lane e, 75 min; lane f, 90 min; lane g, 105 min; lane h. 120 min; and lane i, 135 min. The phosphotyrosine-containing protein of higher molecular mass (42 kd), described earlier in Dunphy and Newport (1969) is an indicator of M phase. (A)Control extract with no inhibitor.(B) An extract containing 50 uglml cycloheximide. (C) An extract containing 50 pgl ml aphidicolin. This extract did not enter mitosis for at least 3 hr after the start of the incubation.

levels, indicating that tyrosine dephosphorylation of cdc2, a necessity for mitotic activation, could not take place in the presence of unreplicated DNA (Figure 3C). Recently, Solomon et al. (1990) have demonstrated that binding of cyclin is required for tyrosine phosphorylation of cdc2. Here, we find that in the presence of an inhibitor of DNA synthesis, tyrosine phosphorylation of cdc2 does occur, but the subsequent dephosphorylation step required for mitotic activation cannot take place. Taken together, these observations suggest that tyrosine phosphorylation of cdc2 plays at least a partial role in suppressing the activation of the cyclin-cdc2 complex until DNA synthesis is complete. To characterize further the relationship between DNA replication and tyrosine phosphorylation of cdc2, we examined whether this phosphorylation reaction occurs in the nucleus or cytoplasm. For this purpose, we incubated Xenopus extracts containing 1000 nuclei per microliter with wheat germ agglutinin (WGA), a lectin that blocks nuclear transport by binding to glycoproteins in the nuclear pore (Finlay et al., 1987). As a control, we incubated extracts with both WGA and an excess of triacetylchitotriose, a competing sugar that abolishes the block in nuclear uptake. We observed that tyrosine phosphorylation of cdc2 occurred with equal efficiency whether or not nuclear transport could take place (Figure 4). In the WGA-treated extract, we confirmed by differential centrifugation that the tyrosine-phosphorylated cdc2 protein resided in the post-nuclear supernatant (cytoplasmic) fraction and not the nuclear fraction. Thus, the cyclin-dependent tyrosine

Phosphory-

Xenopus extracts containing 1000 frog sperm nuclei per ul were activated as described in the legend to Figure 3, and incubated with 1 mglml WGA either in the presence (open circles) or absence (closed circles)of 1 mM triacetylchitotriose. At the indicated times, 2 ul aliquots were removed for immunoblotting with anti-ptyr antibodies. The phosphotyrosine content of cdc2 (expressed in arbitrary units on they axis) was determined by densitometric scanning of the immunoblots. Mitosis (and tyrosine dephosphorylation) occurred at approximately 100 min in the extract treated with triacetylchitotriose. The WGA-treated extract remained in interphase for at least 3 hr.

phosphorylation of cdc2 appears to occur in the cytoplasm. Since DNA replication occurs with the nucleus, it would appear that information regarding the extent of DNA synthesis must somehow be relayed to the cytoplasm. Finally, in sharp contrast to the phosphorylation reaction, the tyrosine dephosphorylation of cdc2 in the egg extract containing nuclei was strongly inhibited in the presence of WGA (Figure 4). However, WGA did not inhibit tyrosine dephosphorylation of cdc2 in the soluble oocyte extracts lacking nuclei (data not shown), indicating that the lectin does not interfere directly with the tyrosine phosphatase. Apparently, in activated egg extracts containing a large number of nuclei, normal traffic through the nuclear pore is essential for the activation of cdc2 by tyrosine dephosphorylation. The cdc25 Protein Can Drive Interphase-Arrested Egg Extracts into Mitosis Prematurely by Short-Circuiting the Dependence of Mitotic Initiation upon the Completion of DNA’Synthesis Normally, mitosis cannot occur until replication of the cellular DNA is complete. Recently, Enoch and Nurse (1990) have provided evidence that the cdc25 protein is critical for providing the regulatory link between mitotic initiation and the completion of S phase. For this reason, we asked whether the active cdc25 protein could function in Xenopus extracts containing unreplicated DNA. For this experiment, we incubated activated Xenopus egg extracts in the presence or absence of aphidicolin (50 uglml). As described above, the control extracts lacking aphidicolin entered mitosis after 75-90 min, but the aphidicolin-treated extracts did not enter mitosis (even after 3 hr). After 100 min of incubation, the aphidicolin-treated extract was aliquoted into two portions. The Drosophila cdc25 protein was added to one portion, while buffer alone was added to the other. We observed that the cdc25 pro-

cdc25Dependent 907

Dephosphorylation

of cdd

tein rapidly induced mitosis even though DNA replication could not occur (Figure 5). After the addition of exogenous cdc25 protein to the aphidicolin-treated extract, nuclear disassembly and chromosome condensation occurred within 30 min, as assessed by visualization of the nuclei in the fluorescence microscope (Figure 5C). With similar kinetics, the cdc2 component of pre-MPF underwent tyrosine dephosphorylation (Figure 5A, lanes I, m, n, and o; Figure 5B). In the control incubation with buffer alone, neither nuclear breakdown nor tyrosine dephosphorylation took place. Instead, the phosphotyrosine content of cdc2 steadily increased in the absence of exogenous cdc25 protein (Figure 5A, lanes h, i, j, and k; and Figure 5B). Both ~35~~“~~ and p61cdcZ5were comparably effective in their ability to induce mitosis in the aphidicolin-treated extract (data not shown). Even at concentrations as low as l-2 Kg/ml, ~35”~“~~ and p61cdcz5 induced mitosis in the aphidicolin-treated extract by 90 min after addition. The cdc25 protein could induce mitosis in the aphidicolinarrested extract in the presence of cycloheximide, indicating that cdc25 does not act by inducing synthesis of new protein. In summary, we have demonstrated that the purified cdc25 protein can induce mitosis in extracts that would nosrmally remain in interphase owing to inhibition of DNA synthesis. Consequently, the exogenous introduction of the active cdc25 protein into the cell-free extracts is sufficient to circumvent or bypass the regulatory mechanism that verifies that DNA replication is complete. The cdc25 Protein Can Modulate the Timing of Mitosis in a Ceil-Free System In fission yeast and most likely all somatic cells, the intracellular concentration of cdc25 protein is a critical determina.nt of the timing of mitotic initiation (Russell and Nurse, 1986; Edgar and CYFarrell, 1989). For example, in fission yeast there appears to be a direct correlation between the level of expression of the cdc25 protein and the rate of mitotic initiation. Superficially, early embryonic cells such as those of Xenopus and Drosophila appear to be an exception to this rule. For example, in early embryonic frog cells, the accumulation of cyclin protein is clearly both necessary and sufficient to drive the cell cycle (Murray and Kirschner, 1989b; Minshull et al., 1989). How can these observations be reconciled with the finding that the cdc25 protein can activate pre-MPF in Xenopus extracts? One plausible explanation is that early embryonic frog cells contain a preexisting store of cdc25 protein, as proposed by Enoch and Nurse (1990). In this event, the progression of the cell cycle would be limited by the synthesis of cyclin protein, even though the cdc25 protein would still be required for the ensuing final events in the activation of MPF. We reasoned that if this model were correct, it might be possible to control the timing of mitosis in Xenopus egg extracts by manipulating the concentrations of ex,ogenously added cyclin and cdc25 protein. In particular, at excess levels of cyclin protein, the rate of mitotic initiation might become dependent on the level of cdc25 protern. To perform this experiment, it was necessary to obtain convenient quantities of active cyclin protein for

A

34-

B

abcdefghijklmno

"

4001

0

50

100

150

Time (min)

C

0

10

20

30

40

lime (min) Figure 5. The cdc25 Protein Activates lication Is Blocked

Pre-MPF

Even When

DNA Rep-

A CSF-arrested extract (250 ul volume) from unactivated Xenopus eggs was incubated with frog sperm nuclei (1000 per ul) in the presence of aphidicolin (50 t@ml). At the beginning of the incubation (t = 0), CaC12 (0.4 mM, final concentration) was added to activate the extract. At the indicated times, aliquots (2 @I) were removed, subjected to SDS gel electrophoresis, and immunoblotted with anti-phosphotyrosine antibodies. At t = 100 min, the extract was divided to produce two 100 nl aliquots. One aliquot received p35’“c25 (15 pglml protein, final concentration), whereas the other received control buffer alone. At successive 15 min intervals thereafter, aliquots of 2 nl and 3.5 ul, respectively, were removed either for immunoblotting with antiphosphotyrosine antibodies or for assessment of nuclear envelope integrity with a fluorescence microscope (see Experimental Procedures). (A) Anti-phosphotyrosine immunoblot. Lane a, t = 0; lane b, t = 15 min; lane c, 30 min; lane d, 45 min; lane e, 60 min; lane f, 75 min; lane g. 90 min. At t = 100 min, control buffer (lanes h, i, j, and k) or p35cdc25 (lanes I, m, n, and o) was added. Lanes h and I, 115 min; lanes i and m, 130 min; lanes j and h, 145 min; and lanes k and o, 160 min. (B) Quantitation of the phosphotyrosine content (in arbitrary units) of the cdc2 protein in the immunoblot shown in (A). Open circles indicate both the initial incubation (before 100 min) and the incubation that received control buffer (after 100 min). Closed circles denote the incubation that received p35cdc25 at 100 min. (C) Quantitation of nuclear disassembly in response to p3Sdcz5. Times indicated are minutes after the addition of cdc25 protein.

biochemical studies. Kirschner and colleagues have demonstrated that recombinant cyclin protein retains full biological activity (Solomon et al., 1990). Subsequently, we have found that sea urchin cyclin from the inclusion body fraction of overexpressing bacteria can be solubilized in 6 M urea and then refolded into a biologically active polypeptide (Figure 6A). We examined the effect of exogenously added cdc25 protein on the rate of mitotic induction in the presence of a saturating concentration of cyclin protein. We incubated cycloheximide-containing interphase extracts that are incapable of synthesizing their own cyclin with purified sea urchin cyclin (50 ug/ml) either in the absence or presence of a 15 pglml concentration of the recombinant cdc25 protein (Figure 6). In the incubation with cyclin alone, there was a sharp rise in cdc2-associated Hl kinase activity between 30 and 40 min after the addition of cyclin (Figure 6C). The disassembly of nuclei in the extracts rapidly followed, and was complete by 50 min (Figure 6B). However, in the combined presence of cyclin and the cdc25 protein, there was a pronounced increase in both the rate of activation of the cdc2-associated Hl kinase activity and the rate of nuclear disassembly. In the presence of both cyclin and cdc25 protein, the steep rise in Hl kinase activity occurred between 10 and 20 min of incubation, and nuclear disassembly was complete by 30 min (see Figure 5). In control experiments, the cdc25 protein did not induce mitosis in the absence of cyclin (data not shown), as would be expected (Murray and Kirschner, 1969b). In conclusion, we have demonstrated that the exogenous recombinant cdc25 protein can accelerate the cyclin-dependent entry of Xenopus extracts into mitosis. It would appear that at saturating concentrations of cyclin protein, the rate at which Xenopus extracts can enter mitosis is limited (at least in part) by the rate at which tyrosine dephosphorylation of cdc2 can occur. By supplementing the extract with exogenous cdc25 protein, we can hasten the activation of pre-MPF appreciably. Activation of Pre-MPF by the cdc25 Protein in a Partially Purified System To examine the biochemistry of the cdc25 protein, we set out to study the activation reaction in a more defined system. For this purpose, we isolated pre-MPF from Xenopus oocyte extracts with pl9coupled agarose (Dunphy et al., 1968). It was previously demonstrated that the phosphotyrosine-containing cdc2 protein (presumably complexed with cyclin) from Xenopus oocytes binds efficiently to pl3agarose (Dunphy and Newport, 1989). We applied Xenopus oocyte extract to pl3-agarose, and after extensive washing of the beads with buffer, we added the recombinant cdc25 protein in order to ascertain whether activation of the pre-MPF that had adhered to the p13 beads could occur. Strikingly, the cdc25 protein effectively induced the tyrosine dephosphorylation of the cdc2 protein, even though >95% of the Xenopus oocyte extract proteins had previously been removed by chromatography on pl3-agarose (see Dunphy et al., 1988). Tyrosine dephosphorylation proceeded rapidly to completion in lo-15 min, and thus occurred at approximately the same rate as in the unfrac-

A

50-

0

F a .s .2 P .st f

-

10

20

30

40

50

60

10

20

I 30

.,.,., 40

50

60

____ 2000

-

1000 -

z 2 P 0

.,.,. 0

Time (min) Figure 6. The cdc25 Protein ence of an Excess of Cyclin

Accelerates Protein

MPF Activation

in the Pres-

(A) Bacterially produced sea urchin cyclin (5 rrg of protein) was subjected to SDS gel electrophoresis and stained with Coomassie blue. (B and C) A CSF extract from unactivated eggs was activated by the addition of 0.4 mM CaCI,. Xenopus sperm nuclei (1000 per ~1) and cycloheximide (50 pg/ml) were added, and then the extract was incubated for 30 min at 23°C. By this time, the extract had entered interphase and nuclear envelope assembly around all of the added sperm chromatin had occurred. At this point, sea urchin cyclin, p35cdcz5, or control buffer was added as indicated. Triangles, no addition. Open circles, cyclin alone (50 &ml). Closed circles, cyclin (50 Kg/ml) plus ~35~“~~ (15 pglml). The buffer conditions were adjusted to be identical in all three incubations. At the indicated times, aliquots were removed and examined for the percentage of nuclti in the extract that had disassembled (6) or were assayed for histone HI kinase activity (C).

tionated oocyte extract (Figures 7A and 78). The dephosphorylation reaction occurred in the absence or presence of ATP (Figure 7A). After the dephosphorylation reaction, we measured kinase activity toward histone Hl and found that the cdc25 protein had also induced activation of the CdcSassociated Hl kinase in this simplified system. In the partially purified system described in Figure 7, it is

cdc25Dependent 909

A,

B

C

a

Dephosphorylation

b

a

a

c

d

e

b c -aIn

d

e

a’

of cdc2

b’

c’

d’

e’

a” b”

c”

d”

e”

abcdef

b D

1

E

a

b

c

d

e

Figure 7. Thecdc25 Protein (~35 cdc25)InducesTyrosine lation of the cdc2 Component of Pre-MPF in a Partially in the Absence of ATP

DephosphoryPurified System

(A:) The pre-MPF fraction (1.2 mg of protein) was applied to a 0.25 ml ~13 agarose column (containing 1 mg of ~13 protein per ml of resin). The column was washed with 40 column volumes of EB buffer, and then the agarose beads were resuspended as a 20% suspension in EB containing 1 mM dithiothreitol. Aliquots of the bead suspension (50 ul) were incubated for 1 hr at 23°C in a final volume of 250 ul containing the following additions: lanes a, a’, and a”, 60 ug/ml cdc25 protein without ATP; lanes b, b’, and b”, no cdc25 protein or ATP; lanes c, c’, and c”, no cdc25 protein, with ATP; lanes d, d’, and d”, 60 uglml cdc25 protein with ATP and 2 mM sodium vanadate; and lanes e, e’, and e”, 60 uglml cdc25 protein with ATP. Incubations with ATP contained IO mM phosphocreatine, 1 mM ATP, and 50 uglml creatine kinase. For all incubations with ATP, similar results were obtained in the absence of ATP. After the incubation, 50 pl samples were boiled in gel sample buffer, electrophoresed and immunoblotted with anti-phosphotyrosine antibodies (lanes a, b, c, d, and e) or anti-cdc2 antibodies (lanes a’, b’, c’, d’, and e’). For lanes a”, b”, c”, d”, and e”, the ~13 beads were pelleted at 1000 x g for 1 min, and 50 PI of the supernatant was boiled in gel sample buffer, subjected to SDS gel electrophoresis, and immunoblotted with anti-cdd antibodies. (B) This photograph depicts a longer exposure of the same immunoblot shown in lanes a, b, c, d. and e in (A). (C) In an experiment similar to that described in (A), pre-MPF bound to pl3-agarose was incubated in the absence (lane a) and presence (lane b)of 60 uglml cdc25 protein for 1 hr at 23’C. After the incubation, the ~13 beads were pelleted for 1 min at 1000 x g, washed, and then the beads were boiled in SDS gel sample buffer. The eluted proteins were electrophoresed and immunoblotted with anti-cdc2 antibodies. (D:) The cdc25 protein cannot induce dephosphorylation of the cdc2 protein that has been eluted from pl3-agarose under denaturing conditions. The pre-MPF fraction was applied to a p13 column, and after extensive washing, the bound cdc2 protein was eluted with 50 mM diethylamine (pli 11.5). After neutralization, cdc25-dependent dephosphorylation was assessed by immunoblotting with anti-cdc2 antibodies. Lanes a, b, and c: the cdc2 protein bound to ~13 (before treatment with diethylamine) was incubated for 1 hr on ice (lane a), at 23OC (lane b), or at 23°C with 60 uglml cdc25 protein. Lanes d, e, and f: the cdc2 protein eluted with diethylamine and incubated for 1 hr on ice (lane d), at 23OC (lane e), or at 23OC with 60 uglml cdc25 protein. (E) Aliquots (10 ul) of the incubations described in (A) were assayed for Hl kinase activity after equalization ofthe ATP level in each sample.

clear that a cdc2specific tyrosine phosphatase is present. However, we have found no evidence that the cdc25 protein itself acts directly as a tyrosine phosphatase. We have observed that the isolated, recombinant cdc25 protein will not remove phosphate from several model phosphatase substrates, including p-nitrophenylphosphate, the tyrosine-phosphorylated v-abl protein kinase (Wang, 1985) or the tyrosine-phosphorylated cdc2 protein that had been eluted from pl3-agarose under denaturing conditions (Figure 7D). Moreover, the cdc25 protein does not share sequence homology with the known tyrosine phosphatases (Cool et al., 1989). Although these observations do not rigorously exclude the possibility that cdc25 is a novel and exquisitely specific phosphatase, it seems more likely that cdc25 activates or facilitates the action of a tyrosine phosphatase. Accordingly, it appears that a tyrosine phosphatase must be associated with the pre-MPF-containing p13 beads. An intriguing possibility is that a latent phosphatase is an intrinsic component of the pre-MPF complex. In this regard, it is noteworthy that pre-MPF appears to be larger in molecular weight than active MPF (Cyert and Kirschner, 1988; Felix et al., 1989). Alternatively, a tyrosine phosphatase could bind directly to pl3-agarose. A definitive resolution of the origin of the tyrosine phosphatase in these experiments will require the purification of pre-MPF from Xenopus oocytes to homogeneity. Nonetheless, it is clear from these experiments that the tyrosine dephosphorylation of the cdc2 protein associated with the p13 column cannot proceed in the absence of exogenous cdc25 protein. To pursue this observation further, we asked whether the cdc25 protein might dislodge cdc2 from the p13 column. To examine this possibility, we centrifuged p13 beads that had been incubated in the presence or absence of cdc25 protein, and monitored the level of cdc2 protein in the pellet and supernatant by immunoblotting with anticdc2 antibodies. We observed that the large majority of the activated, dephosphorylated cdc2 protein was not in the supernatant (Figure 7A), but was in the pellet fraction (Figure 7C), indicating that it was still associated with ~13. The cdc25 Protein Induces at Least Two Molecular Alterations of the cdc2 Subunit During cdc254nduced tyrosine dephosphorylation of the cdc2 protein, we observed that the mobility of the cdc2 protein during SDS gel electrophoresis increased substantially (compare lanes a’ and b’ in Figure 7A). We asked whether this mobility shift was due entirely to tyrosine dephosphorylation. For this purpose, we performed the cdc25dependent activation reaction in the presence of sodium vanadate, an inhibitor of tyrosine phosphatases (Morla et al., 1989). Sodium vanadate blocked the tyrosine dephosphorylation of cdc2 (Figure 7A, lanes d and d’), but the mobility of cdc2 nonetheless increased so that it now electrophoresed at a position intermediate between the inactive cdc2 protein and the cdc25-activated, tyrosine dephosphorylated form of cdc2 (compare lanes d and d’ in Figure 7A with the other lanes). These findings suggest that, in addition to vanadatesensitive tyrosine dephosphorylation, the cdc25 protein normally induces at least one

Cell 910

additional molecular alteration of the cdc2 protein. This alteration occurs independently of tyrosine dephosphorylation, since it takes place even when the cdcPdirected tyrosine phosphatase cannot function. The cdc2 protein also undergoes threonine dephosphorylation near mitosis (Gautier et al., 1989; Gould and Nurse, 1989; Morla et al., 1989; Solomon et al., 1990). The additional cdc25-dependent alteration could reflect threonine dephosphorylation or, alternatively, an as yet unidentified modification. The cdc25 Protein Can Override the Inhibitory Effect of p13 on the Activation of Pre-MPF It has been shown that fission yeast p13 (the sucl gene product) can inhibit the activation of pre-MPF in Xenopus extracts (Dunphy et al., 1988; Dunphy and Newport, 1989; Jessus et al., 1990). For example, the cdc2 protein in the 33% ammonium sulfate pellet fraction from Xenopus oocyte cytosol undergoes spontaneous tyrosine dephosphorylation and Hl kinase activation in the presence of an ATP regenerating system (Dunphy and Newport, 1989; see also Cyert and Kirschner, 1988). The activation of cdc2 occurs spontaneously owing to the removal of an inhibitor(s) during ammonium sulfate fractionation (Cyert and Kirschner, 1988). Exogenously added pl3 is a potent inhibitor of this activation reaction. The observation that the cdc25 protein can activate the cdc2 protein bound to p13agarose suggests that the cdc25 protein can override the inhibitory effect of ~13. To investigate this observation more directly, we added soluble p13 and cdc25 protein to the 33% ammonium sulfate fraction from oocyte cytosol. In the experiment depicted in Figure 8, we blocked the activation of pre-MPF completely with 25 trglml ~13, and then added varying concentrations of cdc25 protein. We observed thatthecdc25 protein could overcome the inhibitory effect of p13 on both tyrosine dephosphorylation (Figure 8A) and Hl kinase activation (Figure 88). Fifty percent reversal occurred at a concentration of 1 O-l 5 pglml cdc25 protein, and, at a concentration of 30 trglml, the cdc25 protein could completely override the ability of pl3 to block tyrosine dephosphorylation and kinase activation of the cdc2 protein (Figure 8-C).

A

abcdefghl ., .

an@-

34- I*

B

abcdefghi

100

100

SO

SO

SO m

60

40

40

20

20

0

0 0

10 cdc25

20

prom

30

(Kg/ml)

Figure 9. The cdc25 Protein Can Override on the Activation of Pre-MPF

the Inhibitory

Effect of p13

(A) The pre-MPF fraction from Xenopus oocytes (IO ul volume) was incubated with an ATP regenerating system either in the absence (lanes a and b) or presence (lanes c-i) of 25 &ml ~13. In addition, lane d, 30 uglml; P35cd”zs was included at the following concentrations: lane e, 15 uglml; lane f, 9 uglml; lane g, 4 wglml; lane h, 2 uglml; and lane i, 1 uglml. Each sample was either kept on ice (lane a) or incubated at 23OC for 1 hr (lanes b-i). After the incubation, 5 ul of each sample was subjected to SDS gel electrophoresis and immunoblotted with anti-phosphotyrosine antibodies. (6) The cdcBassociated Hl kinase activity was determined for each sample (lanes a-i) described in part (A). For each sample, 0.5 ul was assayed. The autoradiogram depicts the incorporation of radioactive phosphate by histone Hl. (C) Quantitation of the data in parts (A) and (6). Open circles represent the level of Hl kinase activation relative to the sample with no cdc25 protein Closed circles represent the level of tyrosine dephosphorylation.

Discussion In fission yeast, genetic studies have established that the cdc25 protein serves as a dose-dependent activator of the cdc2 protein kinase (Russell and Nurse, 1988; Gould and Nurse, 1989; Morenoet al., 1990; Ducommunet al., 1990). We have demonstrated here that many aspects of the cdc25 control pathway can be recreated in Xenopus extracts. Moreover, the cdc25 protein clearly possesses many of the biochemical properties that were surmised from the genetic experiments in yeast. In three distinct assays we have shown that the bacterially produced cdc25 protein from Drosophila can activate the latent precursor to MPF in Xenopus extracts. In oocyte extracts, the cdc25 protein efficiently activates the premeiotic form of MPF. In activated egg extracts, the addition of exogenous cdc25 protein markedly accelerates the rate at which cyclin drives the entry into mitosis. Moreover, in egg extracts

arrested in interphase owing to inhibition of DNA synthesis with aphidicolin, the introduction of the active cdc25 protein rapidly induces the mitotic state. Otherwise, in the absence of exogenous cdc25 protein, these aphidicolintreated extracts would never enter mitosis, even though cyclin is present and associated with cdc2 (Dasso and Newport, 1990). In all three contexts, the cdc25 protein stimulates the tyrosine dephosphorylation of cdc2. In addition, the ability of exogenously introduced cdc25 protein to induce premature mitosis in aphidicolin-arrested extracts fits nicely with the observation of Enoch and Nurse (1990) that disruption of the cdc25 control pathway in yeast removes the dependence of mitotic initiation upon the completion of DNA replication. The biochemical steps that accompany the cdc25dependent activation of the cdc2 protein kinase are sum-

cdlc25-Dependent 911

Dephosphorylation

incomplete replication

/

of cdc2

Figure

completion

~

H

Of;:

‘eph~~,L

p13 ?

removal of X

marized in Figure 9. In Xenopus oocytes and eggs, preMPF contains a complex of cyclin and the cdc2 protein (Labbg et al., 1989a; Pondaven et al., 1990; Roy et al., 1990). The catalytic activity of cdc2 is suppressed by tyrosine phosphorylation and one or more additional inhibitory modifications, most probably including threonine phosphorylation (Draetta et al., 1989; Gould and Nurse, 1989; Morla et al., 1989; Solomon et al., 1990). During mitotic activation, the cdc25 protein induces tyrosine dephosphofylation of cdc2 in a reaction that is sensitive to sodium vanadate. In parallel, at least one additional molecular alteration of the cdc2 protein distinct from tyrosine dephosphorylation takes place. This reaction is unaffected by sodium vanadate, and quite probably corresponds to threonine dephosphorylation (Solomon et al., 1990). The end result of these cdc25-dependent biochemical events is the activation of the catalytic capacity of cdc2 to phosphorylate mitotic substrates. In cell-free extracts, the cdc25 protein can override the inhibitory effect of p13 on dephosphorylation of cdc2. However, since the precise physiological role of p13 in regulating cdc2 is as yet unclear (Dunphy and Newport, 1989; Moreno et al., 1989), the relevance of this finding to cell cycle regulation in vivo remains to be established. A Conserved Functional Domain of the cdc25 Protein Since the identification of the cdc25 protein from Schizosaccharomyces pombe (Russell and Nurse, 1986), homologs of cdc25 have been found in budding yeast, Drosophila, and humans (Russell et al., 1989; Edgar and O’Farrell, 1989; Sadhu et al., 1990). Comparison of the sequences of the four identified cdc25 proteins has revealed that only the C-terminal region of the protein has been conserved during evolution (Sadhu et al., 1990). Moreover, in terms of capacity to activate MPF in Xenopus extracts, the fulllength Drosophila cdc25 protein (p61cdcz5)and the C-terminal 60% of the protein (~35~~~~) are qualitatively and quantitatively indistinguishable. Evidently, the N-terminal 40% of the Drosophila cdc25 protein is dispensable for mitosisinducing activity. These studies do not, however, rule out the possibility that the N-terminal region might play a role inI some other function such as regulation of either the activity or stability of the cdc25 protein during the cell cycle. Kinases versus Phosphatases It is clear that the action of the cdc25 protein leads to the selective dephosphorylation of the cdc2 component of MPF. In principle, the dephosphorylation of cdc2 could be

of the Steps

in the cdc25-

See text for discussion. X represents an unde;;yn’ Activation Of MPF fined modification of the cdc2 protein. The phosphorylation state of cyclin is not specified

~

cdd-specific tyrosine klnase

pre-MPF

9. Diagram

active

MPF

achieved by either an increase in phosphatase activity or a decrease in kinase activity. The latter mechanism would require that there be an appreciable, constitutive dephosphorylation of cdc2 during interphase. Here we have shown that the bacterially expressed cdc25 protein can elicit the dephosphorylation of cdc2 in a defined system in the absence of ATP (i.e., under conditions where kinases cannot function). Consequently, the cdc25 protein must actively drive dephosphorylation by increasing the rate of phosphate removal from cdc2. An additional implication of these experiments is that phosphorylation of the cdc25 protein is not absolutely required for mitosis-inducing activity, suggesting that the observed phosphorylation of cdc25 in fission yeast might serve distinct purposes (Moreno et al., 1990). The precise biochemical mechanism bywhich thecdc25 protein triggers dephosphorylation of cdc2 remains to be elucidated. The cdc25 protein does not appear to contain intrinsic phosphatase activity against a number of model substrates, and the sequence of cdc25 bears no resemblance to known phosphatases. Accordingly, it seems likely that cdc25 activates or facilitates the action of a cdc2-specific tyrosine phosphatase. If the second cdc25dependent modification of cdc2 that we have observed represents threonine dephosphorylation, then cdc25 would also mediate the action of a threonine phosphatase. The cdc25 protein could act by stimulating phosphatase activity or by overcoming an inhibitor of dephosphorylation such as ~13. A particularly intriguing observation is that the cdc25 protein can bring about dephosphorylation of the cdc2 component of pre-MPF that has been enriched by affinity chromatography on pl3-agarose. This finding was unexpected, since we had anticipated that the tyrosine phosphatase, for example, would flow through the p13 column. Clearly, it will be important to isolate the cdcP specific phosphatase(s) in order to determine how the cdc25 protein controls its ability to dephosphorylate cdc2. Functional Significance of Tyrosine Phosphorylation/Dephosphorylation of cdc2 The cdc2 protein is phosphorylated at multiple sites during the cell cycle (see Introduction). These phosphorylation events serve as molecular handles for the elucidation of the numerous regulatory steps that govern the cyclical activation and inactivation of cdc2 during each cell division. To date, the phosphorylation of cdc2 on tyrosine has been analyzed in the most detail. Biochemical and genetic studies have established beyond a reasonable doubt that

Cell 912

tyrosine phosphorylation inhibits the kinase activity of cdc2 (Draetta et al., 1988; Dunphy and Newport, 1989; Gould and Nurse, 1989; Morlaet al., 1989; Pondaven et al., 1990). In principle, tyrosine phosphorylation could serve either of two purposes: it could inactivate cdc2 at the end of mitosis or it could prevent premature activation of cdc2 until the cell is ready for mitosis. Several observations indicate that the former possibility is untenable. Morla et al. (1989) found that tyrosine phosphorylation of cdc2 in mouse cells commences in S phase, long after the inactivation of MPF has occurred. Moreover, Solomon et al. (1990) have observed that the tyrosine phosphorylated form of cdc2 accumulates only after the binding of cyclin. Here, we find that the tyrosine phosphorylation of cdc2 markedly increases when DNA replication is blocked with aphidicolin. Taken together, these findings suggest the following model: a cdc2-specific tyrosine kinase participates in suppressing the activation of a preformed complex of cyclin and cdc2 until the completion of DNA synthesis, a prerequisite for mitosis, has taken place. However, these observations do not exclude the possibility that additional modifications of cdd and/or cyclin also contribute to the suppression of MPF activity in the aphidicolin-blocked extracts. Interestingly, the cdcPspecific tyrosine kinase appears to act in the cytoplasm. Since DNA synthesis occurs within the nucleus, it seems that information regarding the extent of DNA replication must be transmitted from the nucleus to the cytoplasm. The molecular nature of this signaling process is unknown, but the identification of molecules that regulate the activity of the cdcBspecific tyrosine kinase might provide an avenue for elucidation of this control pathway. Once DNA replication has been completed, the cdc25 protein reverses the inhibitory restraint upon the kinase activity of cdc2 by eliciting its dephosphorylation. Intriguingly, tyrosine dephosphorylation of cdc2 requires that nuclei in the activated egg extract be capable of nuclear transport, since no dephosphorylation occurs in the presence of WGA, an inhibitor of transport through the nuclear pore. A straightforward explanation would be that dephosphorylation occurs within the nucleus. This would be consistent with the observation that the cyclin-cdc2 complex enters the nucleus before mitosis in yeast (Booher et al., 1989). However, since WGA can also block export from the nucleus, we cannot exclude the possibility that a molecule must exit the nucleus following DNA replication so that activation of cdc2 can occur. In any event, MPF must ultimately enter the nucleus to phosphorylate mitotic substrates such as the nuclear lamins. Regulation of the cdc25 Protein A question for future study is how the cdc25 protein is regulated. Based on the observation that the active cdc25 protein can induce premature mitosis in the presence of unreplicated DNA (provided that cyclin and cdc2 are present), one would predict that the cdc25 protein normally would either be absent or inactive until the completion of S phase. In dividing fission yeast, the concentration of cdc25 mRNA and protein increase substantially in G2, indicating that the completion of DNA replication is fol-

lowed by increased synthesisof thecdc25 protein (Moreno et al., 1990; Ducommun et al., 1990). However, a different situation most probably exists in Xenopus egg extracts. Here, translation of the mRNA for cyclin is sufficient to elicit mitosis (Murray and Kirschner, 1989b). Apparently, the synthesis of new cdc25 protein is not required during the early divisions in Xenopus. This suggests that there is a stored supply of cdc25 protein (see Enoch and Nurse, 1990) or, alternatively, that the early divisions can occur without the cdc25 protein. The egg extracts clearly can perform tyrosine dephosphorylation of cdc2. Since the cdc25 protein is indispensable for tyrosine dephosphorylation in yeast (Gould and Nurse, 1989), it seems likely that a cdc25 homolog or its functional equivalent is present in Xenopus egg extracts. In this event there presumably must be a mechanism to suppress the action of the putative cdc25 homolog when the extracts are treated with aphidicolin in the presence of a high concentration of DNA. By adding the active, bacterially produced cdc25 protein, we can bypass this block to mitotic progression, and the activation of MPF can proceed. In conclusion, we have been able to re-create in vitro the final biochemical steps in the activation of MPF with the isolated, bacterially expressed cdc25 protein. We have shown that the cdc25 protein actively drives the dephosphorylation of tyrosine on the cdc2 protein. Moreover, we have shown that the opposing effects of an inhibitory, cdc2-specific tyrosine kinase and a stimulatory, cdc25regulated tyrosine phosphatase may help to monitor the completion of S phase so that mitosis does not occur prematurely. Ultimately, it may be feasible to reconstitute the entire process of MPF activation with purified components. Such a reconstituted system would allow a step-bystep elucidation of the regulatory events that govern the onset of mitosis. Experimental Procedures Preparation of Xenopus Oocyte and Egg Extracts The total soluble fraction and pre-MPF fraction (i.e., the

33% ammonium sulfate pellet fraction) from Xenopus oocytes was prepared exactly as described before (Cyerl and Kirschner, 1988; Dunphy and Newport, 1989), frozen in liquid nitrogen, and stored at - 80°C until use. Cycling extracts from activated Xenopus eggs were prepared as described (Murray and Kirschner, 1989b). For some experiments, we prepared CSF-arrested extracts from unactivated Xenopus eggs, and drove the extracts into interphase in vitro by the addition of 0.4 mM CaCI,. As described by Murray et al. (1989), CSF-arrested extracts were prepared by lysing unactivated eggs in cycling extract buffer (XB) containing an added 5 mM EGTA and 1 mM MgCI,.

Electrophoretic Techniques lmmunoblotting with anti-cdc2 and anti-phosphotyrosine antibodies was performed exactly as described before (Dunphy and Newport, 1989). For quantitation of immunoblotting data, an LKB Ultroscan laser densitometer was used.

Production of cdc25 Protein in Bacteria The plasmid pARSTG1, which contains the 278 C-terminal amino acids from the Drosophila cdc25 protein (string), was kindly provided by Drs. Bruce Edgar and Pat O’Farrell (University of California at San Francisco). It was prepared by ligating the Smal-Hindlll fragment from the sffirtg gene (Edgar and O’Farrell, 1989) into the T7 expression vector pET3b (Studier et al., 1990) that had been cut with BarnHI, filled in with polymerase, and cut with Hindlll. This vector produces a fusion

;rd;25-Dependent

Dephosphorylation

of cdc2

protein that contains 11 amino acids from the gene 10 protein, two linker amino acids, and 278 amino acids from string. The gene encoding the full-length Drosophila cdc25 protein was inserted into the NdelHindlll site of pET3c after the sequence encompassing the initiation codon was mutated to an Ndel site with the oligonucleotide CAAAACCAACCATATGCTGTG using the kit from Amersham. Plasmids containing the full-length and truncated form of Drosophila cdc25 protein were transformed into BL21(DES)LysS and grown to an ODaoo of 0.3 at 37% in LB containing 50 uglml ampicillin and 30 ugl ml chloramphenicol. The temperature was reduced to 30°C, and IPTG was added to a final concentration of 0.4 mM. After 3 hr, the bacteria were collected by centrifugation (3700 rpm for 15 min in the Beckman GPR centrifuge) and washed once in buffer containing 10 mM TrisHCI (pH 7.4) 100 mM NaCI, 1 mM MgCI,, and 1 mM dithiothreitol. The bacterial pellet was frozen, thawed, and allowed to sit on ice for 15 min. The bacteria were lysed with a sonicator (Branson 450) and the inclusion body fraction was collected by centrifugation for 10 min at 10,000 rpm in the Sorvall HE-4 rotor. The pellet was washed once in renaturation buffer (RB), which contained 0.2 M Tris-HCI (pH 8.2) and 0.5 M NaCI. The washed inclusion body fraction was dissolved in 8 M urea and then successively dialyzed into 4 M urea for 12 hr, 2 M urea for 12 hr, 1 M urea for 12 hr, and finally for 12 hr in RB lacking urea. The refolded protein was aliquoted, frozen in liquid nitrogen, and stored at - 80%. Typically, we obtained 5-10 mg of refolded protein per liter of bacterial culture. Sea urchin cyclin (Pines and Hunt, 1987) was produced in the same manner as described for cdc25 protein except that the inclusion body fraction was initially dissolved in 6 M urea. At the the minimal effective concentration (12.5 &ml), refolded cyclin induced mitosis in cycloheximide-containing activated egg extracts (as judged by nuclear disassembly)60minaftertheadditionofcyclin. Atmuch higherconcentrations (250 pglml), cyclin induced nuclear disassembly at 50 min after addition (see Solomon et al., 1990). In some cases, cyclin and cdc25 protein were purified further by gel filtration on a Sephacryl S-200 column equilibrated in RB. Miscellaneous cdc2-associated histone Hl kinase activity was described earlier (Dunphy and Newport, 1989). was determined with the Bio-Rad protein assay albumin as the standard. Fission yeast ~13 was to agarose as described (Dunphy et al., 1988).

measured exactly as Protein concentration kit with bovine serum purified and coupled

We are especially grateful to B. Edgar and P. O’Farrell for providing the string cDNA clones. We thank T. Hunt and J. Pines for the sea urchin cyclin cDNA clone. W. G. D. is a Lucille P. Markey Scholar and is supported by funds from the NIH and Lucille P. Markey Charitable Trust. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC Section 1734 solely to indicate this fact. August

2, 1990; revised

December

19, 1990

References Booher, R. N., Alfa, C. E., Hyams, J. S., and Beach, D. H. (1989). The fission yeast cdc2/cdcl3/sucl protein kinase: regulation of catalytic activity and nuclear localization. Cell 58, 485-497. Brizuela, L., Draetta, G., and Beach, D. (1987). p13’““’ acts in the fission yeast cell division cycle as a component of the ~34~~~ protein kinase. EMBO J. 6, 3507-3514. Cool, D. E., Tonks, N. K., Charbonneau, H., Walsh, K., Fischer, E. H., and Krebs, E. G. (1989). cDNA isolated from a human T-cell library encodes a member of the protein-tyrosine-phosphatase family. Proc. Natl. Acad. Sci. USA 86, 5257-5281. Cyert, M. S., and Kirschner, in vitro. Cell 53, 185-195. Dasso,

M., and Newport,

M. W. (1988). J. W. (1990).

Regulation

Completion

Doree, M. (1990). Control of M-phase Curr. Opinion Cell Biol. 2, 269-273.

the initiation

by maturation-promoting

of mitosis factor.

Draetta, G., Piwinca-Worms, H., Morrison, D., Druker, B., Roberts, T.. and Beach, D. (1988). Human cdc2 protein kinase is a major cell-cycle regulated tyrosine kinase substrate. Nature 336, 738-744. Draetta, G., Luca, Beach, D. (1989). A and B: evidence 838.

F., Westendorf, J., Brizuela, L., Ruderman, J., and cdc2 protein kinase is complexed with both cyclin for proteolytic inactivation of MPF. Cell 56, 829-

Ducommun, B., Draetta, G., Young, yeast cdc25 is a cell-cycle regulated Commun. 167, 301-309.

P., and Beach, D. (1990). Fission protein. Biochem. Biophys. Res.

Dunphy, W. G., and Newport, J. W. (1988). mechanisms. Cell 55, 925-928.

Unraveling

of mitoticcontrol

Dunphy, W. G., and Newport, J. W. (1989). Fission yeast ~13 blocks mitotic activation and tyrosine dephosphorylation of the Xenopus cdc2 protein kinase. Cell 58, 181-191. Dunphy, W. G., Brizuela, L., Beach, Xenopus cdc2 protein is a component of mitosis. Cell 54, 423-431. Edgar, B. A., and O’Farrell, patterns in the Drosophila

D., and Newport, J. (1988). The of MPF, a cytoplasmic regulator

P. H. (1989). Genetic control embryo. Cell 57, 177-187.

of cell division

Enoch, T., and Nurse, P. (1990). Mutation of fission yeast cell cycle control genes abolishes dependence of mitosis on DNA replication. Cell 60, 665-673. Evans, T., Rosenthal, E. T., Youngblom, J., Distel, D., and Hunt, T. (1983). Cyclin: a protein specified by maternal mRNA in sea urchin eggs that is destroyed at each cleavage division. Cell 33, 389-396. Felix, M. A., Pines, J., Hunt, T., and Karsenti, E. (1989). A postribosomal supernatant from activated Xenopus eggs that displays post-translationally regulated oscillation of its cdc2+ mitotic kinase activity. EMBO J. 8, 3059-3069. Felix, M. A., Cohen, P., and Karsenti, E. (1990). cdc2 Hl kinase is negatively regulated by a type 2A phosphatase in the Xenopus early embryonic cell cycle: evidence from the effects of okadaic acid. EMBO J. 9, 675-683. Finlay. D. R., Newmeyer, D. D., Price, T. M., and Forbes, D. J. (1987). Inhibition of in vitro nuclear transport by a lectin that binds to nuclear pores. J. Cell Biol. 704, 189-200.

Acknowledgments

Received

is monitored by afeedbacksystem that controls in vitro: studies in Xenopus. Cell 67, 81 i-823.

of MPF activity

of DNA replication

Gautier. J., Norbury, C.. Lohka, M., Nurse, P., and Mailer, J. (1988). Purified maturation-promoting factor contains the product of a Xenopus homolog of the fission yeast cell cycle control gene cdc2‘. Cell 54, 433-439. Gautier, J., Matsukawa, T., Nurse, P., and Mailer, J. (1989). Dephosphorylation and activation of Xenopus ~34 protein kinase during the cell cycle. Nature 339, 626-629. Gautier, J., Minshull, J., Lohka, M., Glotzer, M., Hunt, T., and Mailer, J. L. (1990). Cyclin isacomponentof maturation-promotingfactorfrom Xenopus. Cell 60, 487-494. Gould, K., and Nurse, P. (1989). Tyrosine phosphorylation yeast cdc2’ protein kinase regulates entry into mitosis. 39-45.

of the fission Nature 342,

Hartwell, L., and Weinert, T. (1989). Checkpoints: controls the order of cell cycle events. Science 246, 629-634.

that ensure

Hayles, J., Aves, S., and Nurse, P. (1986a). sucl is an essential gene involved in both the cell cycle and growth in fission yeast. EMBO J. 5, 3373-3379. Hayles, J., Beach, D., Durkacz, B., and Nurse, P. (1986b). The fission yeast cell cycle control gene cdc2; isolation of a sequence sucl that suppresses cdc2 mutant function. Mol. Gen. Genet. 202, 291-293. Hunt, T. (1989). Maturation promoting factor, cyclin, M-phase. Curr. Opinion Cell Biol. 7, 268-274.

and the control

of

Jessus, C.. Ducommun. B.. and Beach, D. (1990). Direct cdc2 with phosphatase: identification of pl3”‘-sensitive tive steps. FEBS Lett. 266, 4-8.

activation of and insensi-

Labbe,

Derancourt,

J.-C.,

Capony,

J.-P.,

Caput,

D., Cavadore,

J.-C.,

Cell 914

J., Kaghad. M., Lelias, J.-M., Picard, A., and Doree, M. (1989a). MPF from starfish oocytes at first meiotic metaphase is an heterodimer containing 1 molecule of cdc2 and 1 molecule of cyclin B. EMBO J. 8, 3053-3058. Labbe, J. C., Picard, A., Peaucellier, G.. Cavadore, J. C., Nurse, P., and Dome, M. (1989b). Purification of MPFfrom starfish: identification as the Hl histone kinase p34”“* and a possible mechanism for its periodic activation. Cell 57, 253-263. Lewin, 8. (1990). Driving the cell cycle: and substrates. Cell 67, 743-752.

M phase

kinase,

its partners,

Lohka, M. J. (1989). Mitotic control by metaphase-promoting and cdc proteins. J. Cell Sci. 92, 131-135.

factor

Lohka, M. J., and Masui, Y. (1983). Formation in vitro of sperm pronuclei and mitotic chromosomes induced by amphibian ooplasmic components. Science 220, 719-721. Meijer, L., Arion, D., Golsteyn, R., Pines, J., Brizuela, L., Hunt, T., and Beach, D. (1989). Cyclin is acomponent of the sea urchin egg M-phase specific histone Hl kinase. EMBO J. 8, 2275-2282. Minshull, J., Blow, J. J., and Hunt, T. (1989). Translation of cyclin mRNA is necessary for extracts of activated Xenopus eggs to enter mitosis. Cell 56, 947-956. Moreno, S., Hayles, J., and Nurse, P. (1989). Regulation protein kinase during mitosis. Cell 58, 361-372. Moreno, S., Nurse, cyclic accumulation 344, 549-552.

of p34cdc2

P., and Russell, P. (1990). Regulation of mitosis by of p80cdCz5 mitotic inducer in fission yeast. Nature

Morla, A. O., Draetta, G., Beach, D., and Wang, J. Y. J. (1989). Reversible tyrosine phosphorylation of cdc2: dephosphorylation accompanies activation during entry into mitosis. Cell 58, 193-203. Murray, A. W., and Kirschner, M. W. (1989a). Dominoes and clocks: the union of two views of the cell cycle. Science 246, 614-621. Murray, A. W., and Kirschner, M. W. (1989b). Cyclin synthesis the early embryonic cell cycle. Nature 339, 275-280.

drives

Murray, A. W., Solomon, M. J., and Kirschner, M. W. (1989). The role of cyclin synthesis and degradation in the control of MPF activity. Nature 339, 280-286. Nurse, P. (1990). Universal control M-phase. Nature 344, 503-508. O’Farrell, Directing

mechanism

regulating

onset

of

P. H., Edgar, B. A., Lakich, D., and Lehner, C. F. (1989). cell division during development. Science 246, 635-640.

Pines, J., and Hunt, T. (1987). Molecular cloning and characterization of the mRNA for cyclin from sea urchin eggs. EMBO J. 6, 2987-2995. Pines, J., and Hunter, T. (1989). Isolation of a human cyclin cDNA: evidence for cyclin mRNA and protein regulation in the cell cycle and for interaction with ~34’~“. Cell 58, 833-846. Pines, J., and Hunter, Biologist 2, 389-401.

T. (1990).

~34~~~~: the S and M kinase.

New

Pondaven, P., Meijer. L., and Beach, D. (1990). Activation of M-phasespecific histone Hl kinase by modification of the phosphorylation of its p34mc2 and cyclin components. Genes Dev. 4, 9-17. Roy, L. M., Singh, B.. Gautier, J., Arlinghaus, R. B., Nordeen, S. K., and Mailer, J. L. (1990). The cyclin 82 component of MPF is a substrate for the c-~os’~ proto-oncogene product. Cell 61, 825-831. Russell, P., and Nurse, P. (1986). cdc25+ functions as an inducer the mitotic control of fission yeast. Cell 45, 145-153. Russell, P., and Nurse, weel’, a gene encoding Russell, controls

in

P. (1987). Negative regulation of mitosis by a protein kinase homolog. Cell 49, 559-567.

P., Moreno, S., and Reed, S. I. (1989). Conservation in fission and budding yeasts. Cell 57, 295-303.

of mitotic

Sadhu, K.. Reed, S. I., Richardson, H., and Russell, P. (1990). Human homolog of fission yeast cdc25 mitotic inducer is predominantly expressed in G2. Proc. Natl. Acad. Sci. USA 87, 5139-5143. Solomon, M. J., Glotzer, M., Lee, T. H., Philippe, M.. and Kirschner, M. W. (1990). Cyclin activation of ~34~‘. Cell 63, 1013-1024. Studier, W. F., Rosenberg, A. H., Dunn, J. J., and Dubendorff, J. W. (1990). Use of T7 RNA polymerase to direct the expression of cloned genes. Meth. Enzymol. 185, 60-89.

Tonks, N. K., Diltz, C. D., and Fischer, of the major protein-tyrosine-phosphatases Chem. 263, 6731-6737.

E. H. (1988). Characterization of human placenta. J. Biol.

Wang, J. Y. J. (1985). Isolation of antibodies immunization with a v-abl oncogene encoded 5, 3640-3643.

for phosphotyrosine by protein. Mol. Cell. Biol.

Wasserman, W., and Masui, Y. (1975). Effects of cycloheximide cytoplasmic factor for meiotic maturation in Xenopus oocytes. Cell Res. 97, 381-388.

on a Exp.