- Email: [email protected]
The Changes of Aquaporin 2 in the Graft of Acute Rejection Rat Renal Transplantation Model
The Changes of Aquaporin 2 in the Graft of Acute Rejection Rat Renal Transplantation Model B. Chen, C.S. Zang, J.Z. Zhang, W.G. Wang, J.-G. Wang, H.L. Zhou, and Y.W. Fu ABSTRACT Aim. To investigate the significance and changes of Aquaporin 2 (AQP2) in the rat renal graft of acute rejection (AR). Methods. Wistar recipients of Spraque-Dawley or Wistar renal grafts were treated with cyclosporine (CsA). Renal grafts were harvested at various times after transplantation for analysis of the levels of AQP2 mRNA and protein of by RT-PCR and immunohistochemistry. Results. The expression of AQP2 mRNA and protein in the acutely rejecting were grafts significantly decreased (P ⬍ 0.05) compared with the control group. But the expression of AQP2 mRNA and protein in the syngeneic grafts (sTX) versus the immunosuppression group (aTX⫹CsA) showed no difference compared with a control group (P ⬎ 0.05). Furthermore, at day 5 and day 7 after transplantation the expressions of AQP2 expression in the allogeneic group (aTX) were decreased significantly compared with day 3 after transplantation (P ⬍ 0.05). In addition, there was no remarkable difference at day 5 or 7 after transplantation. Conclusion. AQP2 mRNA and protein expressions were down-regulated during renal transplant acute rejection, which had no relationship to the ischemia reperfusion injury and denervation damage. Furthermore, CsA administration after kidney transplantation blunted this down-regulation (P ⬎ 0.05). HE MOST COMMON complication after transplantation is rejection. Even among long-term surviving renal transplant patients, rejection is still a major cause of graft failure.1,2 Actually, many cellular and molecular mechanisms contribute to allograft rejection, some of which are not clear. Aquaporin (AQP) is a cell-membrane protein that exists widely in plants, animals, and bacteria. In 1984, the AQP system was separated from bovine lens proteins, as the membrane-integral protein 26.3 Until now, 13 kinds of AQP (AQP0 to AQP12) have been described, to as collectively referred as AQPs.4 The water that is necessary for cell metabolism is transported by AQPs, which have a highly selective ability to aid water to cross biological membranes.5 AQP2, known as water channel of the collecting duct (WCH-CD), encodes 271 amino acids.6 Every AQP has a special distribution and cell expression to meet the needs of various tissues and organs. AQP2, which only exists in the kidney collecting duct, is distributed at the top of the cell membrane and at intracellular vesicles. AQP2 plays a substantial role in collecting duct cellular epithelium. It is
T
regulated by antidiuretic hormone (AVP). AQP2 has been found to be changed in nephrogenic diabetes insipidus, urinary tract obstruction, acute renal failure (ARF), dilutional hyponatremia, and nephrotic syndrome.7–12 In cases of graft acute rejection, water and sodium balance are disordered, but the relationship between AQP2 and AR is not clear. In the present study, we assessed the expression of AQP2 in the graft using a rat renal transplantation model. We showed that AQP2 down-regulation was positively related to acute graft rejection. Furthermore, when CsA was administered, AQP2 down-regulation disappeared.
From the First Hospital of The Jinlin University, Changchun, China. Address reprint requests to B. Chen, The First Hospital of The Jinlin University, Changchun 130021, China.
0041-1345/10/$–see front matter doi:10.1016/j.transproceed.2010.02.070
© 2010 by Elsevier Inc. All rights reserved. 360 Park Avenue South, New York, NY 10010-1710
1884
Transplantation Proceedings, 42, 1884 –1887 (2010)
CHANGES OF AQP2
MATERIALS AND METHODS Animals Male 8 to 10-week-old Wistar and Spraque-Dawley rats purchased from The Jilin University Animal Breeding and Research Center (Changchun, China) were housed and cared for using protocols approved by our Subcommittee on Research Animal Care. The rats were divided into 4 groups: an allogeneic group (aTX) of Wistar recipients receiving SD renal grafts; a syngeneic group (sTX), of Wistar recipients receiving Wistar renal grafts; an immunosuppression group (aTX⫹CsA) that was gavaged with cyclosporine A (CsA) (50 mg/kg/d) for seven days after transplantation of SD renal grafts; and a control sham operation group that included Wistar rats explored without undergoing transplantation.
Rat Renal Transplantation Heterotopic renal transplantations were performed by removal of the native left kidney of the recipient prior to transplantation with anastomosis of the graft renal artery to the recipient aorta and the graft renal vein to the recipient renal vein, both by the end-to-side method. The graft ureter was anastomosed to the recipient ureter by an end-to-end method. The renal grafts were harvested at the day 3, 5, and 7 after transplantation. The excised kidney grafts were split with some parts immersed in 10% formalin for histology, and others stored in liquid nitrogen for reverse transcriptase– polymerase chain reaction (RT-PCR).
1885 was added, and the section maintained at room temperature for 30 min, PBS-washed 3 more times, and counterstained. The sections were then examined under a microscope. The epithelial cell membranes IN Collection system which have a brown staining WAS positive cells. Image analysis of the gray value of positive cells (IOD values) yielded the relative expression of AQP2 proteins.
Statistical Analysis Statistical analysis was performed using SPSS 10.0 for Windows and Student’s t-test and ANOVA for repeated measures considering values of P ⬍ .05 to be significant.
RESULTS Histopathological Expression
The aTX group showed AR at days 3, 5 and 7 displayed higher scores compared with normal controls (P ⬍ .05). While the AR score increased a bit in both the sTX group and aTX⫹CsA group, there were no differences compared with the control group (P ⬎ 0.05). The aTX group, which showed AR at days 3, 5, and 7, displayed higher AR scores compared with the sTX and the aTX⫹CsA groups (P ⬍ 0.05). In the aTX group, the AR score increased significantly at days 5 and 7 compared with day 3 (P ⬍ 0.05). In addition, there was no remarkable difference between days 5 and 7 after transplantation (P ⬍ 0.05; Table 1).
Histopathological Evaluation The fixed graft tissues dehydrated in graded ethanol were embedded in paraffin; for sectioning into 3 m and staining with hematoxylin and eosin (H&E). The slides were reviewed by 3 pathologists. The overall severity of rejection was determined by the pattern and intensity of intersitital inflammation and glomerular, tubular, and vascular abnormalities according to the Banff 2005 working classification scale.13
RT-PCR of AQP2 The graft samples homogenized with the appropriate volume of RNAzol B solution were placed in centrifuge tubes for mRNA extraction and RT-PCR. AQP2 upstream primer sequence was: 5=TGTGGGAACTCAGATCCATAG3, downstream primer sequence was: 5=AGGCTCTGAGGAGAGTGGA 3=, a total of 793 base pairs (bp). -actin upstream primer sequence was: 5=AAGAGAGGCATCCTGACCCT3=, downstream primer sequence was: 5=TACATGGCTGGGGTGTTGAA3=. The 218 bp PCR products from each sample, including AQP2 and -actin, were analyzed on 1% agarose gels. The final results visualized on an ultraviolet light box were photographed on Kodak film. The density of each band was compared with a 218-bp band that expressed -actin. The intensity ratio of the difference was later used to compare daily results after transplantation.
AQP2 Immunohistochemical Analysis Anti AQP2-specificity antibody (mAb) was purchased from Boster Co., Wuhan, China. The sections were washed with phosphatebuffered saline (PBS) (Ph 7.4) thrice for 3 min, each time. The sections were fixed with H2O2 for 10 min at room temperature, washed with PBS thrice, each time for 3 min. After PBS washing 3 more times, we added anti-AQP2 antibody at room temperature for 1 h, and PBS-washed thrice further. Then the second antibody
AQP2 mRNA Expression
To evaluate serial changes in AQP2 associated with acute renal allograft rejection, RT-PCR was used to analyze mRNA expression at days 3, 5 and 7 after transplantation. AQP2 mRNA expression in the aTX group was significantly down-regulated at these 3 times compared with normal controls (P ⬍ .05). There was no difference in AQP2 mRNA expression among the sTX group and the aTX⫹CsA groups compared with normal controls (P ⬎ .05). AQP2 mRNA expression was significantly downregulated at days 5 and 7 after transplantation compared with day 3. In addition, there was no remarkable difference between day 5 and 7 values after transplantation (Fig 1). AQP2 Protein Expression
AQP2 protein expression in the aTX group significantly down-regulated at days 3, 5 and 7 compared with normal controls (P ⬍ 0.05). There were no differences in AQP2 Table 1. The Semiquantity Scores of AR After Rat Renal Transplantation Groups
3 d After TX
Control sTX aTX aTX⫹CsA
(0.00 ⫾ 0.00) (0.16 ⫾ 0.40) (1.83 ⫾ 1.16)* (0.00 ⫾ 0.00)
5 d After TX
(0.00 ⫾ 0.00) (0.50 ⫾ 0.83) (3.16 ⫾ 0.75)*† (0.33 ⫾ 0.51)
7 d After TX
(0.00 ⫾ 0.00) (0.66 ⫾ 0.81) (3.50 ⫾ 1.04)*‡ (0.50 ⫾ 0.83)
AR, acute rejection; aTX, allogenic group; CsA, cyclosporine A; sTX, syngeneic group; TX, transplantation. *P ⬍ 0.05 (aTX groups compared with control groups). † P ⬍ 0.05 (in aTX groups 3 d after TX compared with 5 d after TX). ‡ P ⬍ 0.05 (in aTX groups 3 d after TX compared with 7 d after TX).
1886
protein expression among the sTX group versus the aTX⫹CsA group compared with normal controls (P ⬎ 0.05). AQP2 protein expression was significantly decreased at days 5 and 7 compared with day 3 (P ⬍ 0.05). In addition, there was no remarkable difference between AQP2 protein expressions at days 5 and 7 after transplantation (Figs 2 and 3).
CHEN, ZANG, ZHANG ET AL
Day 3
Day 5
Day 7
Control
sTX
aTX
aTX+CsA
Fig 2. Wistar rats were used as recipients received SD and Wistar renal grafts, respectively. The grafts were harvested at days 3, 5, and 7 after transplantation. They were sectioned into 3 m. The epithelial cells membrane in collection system which have a brown staining was positive cells. Measurement through image analysis of the gray value of positive cells (IOD values) as the relative expression of AQP2 protein analysis was carried out. Abbreviations as in Fig 1.
DISCUSSION
Fig 1. Wistar rats were used as recipients and received SD and Wistar renal grafts, respectively. The grafts were harvested at days 3, 5, and 7 after transplantation. The -actin 218 gene transcript was used as a reference template. The pairs of RT-PCR product were separated by 1.0% agarose gel electrophoresis. The upper band is AQP2, and the lower one is -actin 218. A: The level of AQP2 gene transcript of renal grafts at day 3 after transplantation. B: The level of AQP2 gene transcript of renal grafts at day 5 after transplantation. C: The level of AQP2 gene transcript of renal grafts at day 5 after transplantation. D: The level of AQP2 gene transcript of renal grafts in sTX group at days 3, 5, and 7 after transplantation. E: The level of AQP2 gene transcript of renal grafts in aTX group at days 3, 5, and 7 after transplantation. F: The level of AQP2 gene transcript of renal grafts in aTX⫹CsA group at days 3, 5, and 7 after transplantation. AQP, aquaporin; RT-PCR, reverse transcriptase-polymerase chain reaction; SD, Spraque-Dawley.
Although the incidence of kidney graft rejection has decreased, the response is still a major complication after kidney transplantation. AQPs are a family of functionally important water channel proteins with diverse intracellular targeting and trafficking properties. At present, we believe that water has 2 ways through the cell membrane: one is diffusion through the lipid bilayer, the other via AQP in the cellular membrane. Mediation of AQP hold the leading rolein transmembrane transport of hydroner. AQPs have been found in many cells and tissues. The kidney is the chief organ to adjust water equilibrium. AQP2 is the most important AQP in collecting duct epithelial cells. It mediates vasopressin-dependent permeability of the kidney collecting duct.14 AQP2 levels on collecting duct principal cell membranes are regulated by vasopressin: when vasopressin levels increase, vasopressin binds to its receptor on the basolateral membrane of collecting duct principal cells, initiating a cascade of events that results in the insertion of AQP2 into the apical plasma membrane. The steps include stimulation of adenylate cyclase (AC) by the heterotrimeric G protein, Gs, with an increase in intracellular cAMP. AQP2 located on intracel-
Fig 3. Control group 2, 3, 4. sTX group 3, 5, and 7 d after TX; 5, 6, 7: aTX group 3, 5, and 7 d after TX; 8, 9, 10: aTX⫹CsA group 3, 5, and 7 d after TX. aTX, allogenic group; CsA, cyclosporine A; sTX, syngeneic group; TX, transplantation.
CHANGES OF AQP2
lular vesicles is phosphorylated at serine-256 by protein kinase A (PKA). The vesicles move toward the plasma membrane, with which they ultimately fuse by exocytosis, thereby inserting AQP2 into the membrane. It opens the water channel, thereby increasing water permeability of membranes.15 When levels of vasopressin decrease, collecting duct principal permeability of membranes.15 When levels of vasopressin decrease, collecting duct principal cell membranes undergo endocytosis with AQP2-containing vesicles moving to intracytoplasmic membranes, with a reduced volume of AQP2 in principal cell luminal membranes and depressed luminal membrane permeability for water. The relationship between AQP2 and acute rejection is not clear. Our data showed that AQP2 expression was significantly down-regulated with acute rejection in the aTX compared with control group at days 3, 5 and 7 after transplantation (P ⬍ 0.05), particularly at the last 2 times (P ⬍ 0.05). The semi-quantitative scores of AR among the aTX group indicated that AQP2 expression was decreased, a down-regulation that paralleled its severity. After transplantation, AR grafts display water-sodium retention; reduced vasopressin at this time may be closely related to the down-regulation of AQP2 expression.16,17 Previous studies have shown that kidney graft ischemia/ reperfusion injury increases urinary production with reduced concentrated functions of the kidney. To eliminate the possibility that the reduction observed in our study was related to ischemia/reperfusion or denervation injury, we used a syngeneic group. Our data showed no significant differences among AQP2 expression by the kidneys in the syngeneic group versus the normal control (P ⬎ 0.05), consistent with our previous conclusion18 that ischemia reperfusion injury decreases expression of AQP1, AQP3, and AQP4 but not AQP2. Thus down-regulation of AQP2 has nothing to do with the ischemica/reperfusion injury and other operative factors. To confirm that denervation had no relationship to AR, we established an aTX⫹CsA group. Allografts under immunosuppression showed similar AR semiquantitative scores compared with the control and the sTX group (P ⬎ 0.05). AQP2 down-regulation was mitigated when the allograft host received immunosuppression (P ⬎ 0.05). Therefore, we believe that AQP2 down-regulation was related to acute renal graft rejection after transplantation. Our study showed that the down-regulation of AQP2 decreased collecting system function, decreasing reabsorption with water retention during acute rejection. This may be a method to save energy.19 AQP2 may thus be a new
1887
diagnostic marker and treatment target during acute graft rejection. REFERENCES 1. Hsich HG, Loong CC, Lui WY, et al: IL-17 expression as a possible predictive parameter for subclinical renal allograft rejection. Transpl Int 14:287, 2001 2. Harada KM, Mandia-Sampaio, EL, de Sandes-Freitas TV, et al: Risk factors associated with graft loss and patient survival after kidney transplantation. Transplant Proc 41:3667, 2009 3. Dibas AI, Mia AJ, Yorio AT: Aquaporins (water channels): role in vasopressin-activated water transport. Proc Soc Exp Biol Med 219:183, 1998 4. Itoh T, Rai T, Kuwahara M, et al: Identification of a novel aquaporin, AQP12, expressed in pancreatic acinarcells. Biochem Biophys Res Commun 330:832, 2005 5. Walz T, Fujiyoshi Y, Engel A. The AQP structure and functional implications. Handb Exp Pharmacol 190:31, 2009 6. Yang B, Gillespie A, Carlson EJ, et al. Neonatal mortality in an aquaporin-2 knock-in mouse model of recessive nephrogenic diabetes insipidus. J Biol Chem 276:2775, 2001 7. Apostol E, Ecelbarger CA, Terris J, et al: Reduced renal medullary water channel expression in puromycin aminonucleo-sideinduced nephrotic syndrome. J Am Soc Nephrol 8:15, 1997 8. Ward DT, Hammond TG, Harris HW: Modulation of vasopressin-elicited water transport by trafficking of aquaporin2containing vesicles. Annu Rev Physiol 61:683, 1999 9. Mattia F, Savelkoul PJ, Kamsteeg EJ, et al: Lack of arginine vasopressin-induced phosphorylation of aquaporin-2 mutant AQP2-R254L explains dominant nephrogenic diabetes insipidus. J Am Soc Nephrol 16:2872, 2005 10. Soowan K, Samhyeo C, Bongsuk O, et al: Diminished renal expression of aquaporin water channels in rats with experimental bilateral ureteral obstraction. J Am Soc Nephrol 12:2019, 2001 11. Gong H Wang W, Kwon TH, et al: EPO and alpha-MSH prevent ischemia 2 /reperfusion-induced down-regulation of AQPs and sodium transporters in rat kidney. Kidney Int 66:683, 2004 12. Ivarsen P, Frokiaer J, Aagaard NK, et al: Increased urinary excretion of aquaporin-2 in patients with liver cirrhosis. Gut 52:1194, 2003 13. Alexander MP, Patel TV, Farag YM, et al: Kidney pathological changes in metabolic syndrome: a cross-sectional study. Am J Kidney Dis 53:751, 2009 14. Nielsen S, Frokiaer J, Marples D, et al: Aquaporins in the kidney: from molecules to medicine. Physiol Rev 82:205, 2002 15. Brown D, Katsura T, Gustafson CE: Cellular mechanisms of aquaporin trafficking. Am J Physiol Renal Physiol 275:328, 1998 16. Agrawal V, Agarwal M, Joshi SR, et al: Hyponatremia and hypernatremia: disorders of water balance. J Assoc Physicians India 56:956, 2008 17. Grzeszczak W, Kokot F, Wiecek A: Changes in the activity of the renin-angiotensin-aldosterone system and serum vasopressin (AVP) level during acute rejection of transplanted kidney. Pol Arch Med Wewn 80:1– 8, 1988 18. Edemir B, Reuter S, Borgulya R, et al: Acute rejection modulates gene expression in the collecting duct. J Am Soc Nephrol 19:538, 2008 19. Anavelic JR, Hirsch JB et al: Renal transplantation modulates expression and function of receptors and transporters of rat proximal tubules. J Am Soc Nephrol 15:967, 2004
T
regulated by antidiuretic hormone (AVP). AQP2 has been found to be changed in nephrogenic diabetes insipidus, urinary tract obstruction, acute renal failure (ARF), dilutional hyponatremia, and nephrotic syndrome.7–12 In cases of graft acute rejection, water and sodium balance are disordered, but the relationship between AQP2 and AR is not clear. In the present study, we assessed the expression of AQP2 in the graft using a rat renal transplantation model. We showed that AQP2 down-regulation was positively related to acute graft rejection. Furthermore, when CsA was administered, AQP2 down-regulation disappeared.
From the First Hospital of The Jinlin University, Changchun, China. Address reprint requests to B. Chen, The First Hospital of The Jinlin University, Changchun 130021, China.
0041-1345/10/$–see front matter doi:10.1016/j.transproceed.2010.02.070
© 2010 by Elsevier Inc. All rights reserved. 360 Park Avenue South, New York, NY 10010-1710
1884
Transplantation Proceedings, 42, 1884 –1887 (2010)
CHANGES OF AQP2
MATERIALS AND METHODS Animals Male 8 to 10-week-old Wistar and Spraque-Dawley rats purchased from The Jilin University Animal Breeding and Research Center (Changchun, China) were housed and cared for using protocols approved by our Subcommittee on Research Animal Care. The rats were divided into 4 groups: an allogeneic group (aTX) of Wistar recipients receiving SD renal grafts; a syngeneic group (sTX), of Wistar recipients receiving Wistar renal grafts; an immunosuppression group (aTX⫹CsA) that was gavaged with cyclosporine A (CsA) (50 mg/kg/d) for seven days after transplantation of SD renal grafts; and a control sham operation group that included Wistar rats explored without undergoing transplantation.
Rat Renal Transplantation Heterotopic renal transplantations were performed by removal of the native left kidney of the recipient prior to transplantation with anastomosis of the graft renal artery to the recipient aorta and the graft renal vein to the recipient renal vein, both by the end-to-side method. The graft ureter was anastomosed to the recipient ureter by an end-to-end method. The renal grafts were harvested at the day 3, 5, and 7 after transplantation. The excised kidney grafts were split with some parts immersed in 10% formalin for histology, and others stored in liquid nitrogen for reverse transcriptase– polymerase chain reaction (RT-PCR).
1885 was added, and the section maintained at room temperature for 30 min, PBS-washed 3 more times, and counterstained. The sections were then examined under a microscope. The epithelial cell membranes IN Collection system which have a brown staining WAS positive cells. Image analysis of the gray value of positive cells (IOD values) yielded the relative expression of AQP2 proteins.
Statistical Analysis Statistical analysis was performed using SPSS 10.0 for Windows and Student’s t-test and ANOVA for repeated measures considering values of P ⬍ .05 to be significant.
RESULTS Histopathological Expression
The aTX group showed AR at days 3, 5 and 7 displayed higher scores compared with normal controls (P ⬍ .05). While the AR score increased a bit in both the sTX group and aTX⫹CsA group, there were no differences compared with the control group (P ⬎ 0.05). The aTX group, which showed AR at days 3, 5, and 7, displayed higher AR scores compared with the sTX and the aTX⫹CsA groups (P ⬍ 0.05). In the aTX group, the AR score increased significantly at days 5 and 7 compared with day 3 (P ⬍ 0.05). In addition, there was no remarkable difference between days 5 and 7 after transplantation (P ⬍ 0.05; Table 1).
Histopathological Evaluation The fixed graft tissues dehydrated in graded ethanol were embedded in paraffin; for sectioning into 3 m and staining with hematoxylin and eosin (H&E). The slides were reviewed by 3 pathologists. The overall severity of rejection was determined by the pattern and intensity of intersitital inflammation and glomerular, tubular, and vascular abnormalities according to the Banff 2005 working classification scale.13
RT-PCR of AQP2 The graft samples homogenized with the appropriate volume of RNAzol B solution were placed in centrifuge tubes for mRNA extraction and RT-PCR. AQP2 upstream primer sequence was: 5=TGTGGGAACTCAGATCCATAG3, downstream primer sequence was: 5=AGGCTCTGAGGAGAGTGGA 3=, a total of 793 base pairs (bp). -actin upstream primer sequence was: 5=AAGAGAGGCATCCTGACCCT3=, downstream primer sequence was: 5=TACATGGCTGGGGTGTTGAA3=. The 218 bp PCR products from each sample, including AQP2 and -actin, were analyzed on 1% agarose gels. The final results visualized on an ultraviolet light box were photographed on Kodak film. The density of each band was compared with a 218-bp band that expressed -actin. The intensity ratio of the difference was later used to compare daily results after transplantation.
AQP2 Immunohistochemical Analysis Anti AQP2-specificity antibody (mAb) was purchased from Boster Co., Wuhan, China. The sections were washed with phosphatebuffered saline (PBS) (Ph 7.4) thrice for 3 min, each time. The sections were fixed with H2O2 for 10 min at room temperature, washed with PBS thrice, each time for 3 min. After PBS washing 3 more times, we added anti-AQP2 antibody at room temperature for 1 h, and PBS-washed thrice further. Then the second antibody
AQP2 mRNA Expression
To evaluate serial changes in AQP2 associated with acute renal allograft rejection, RT-PCR was used to analyze mRNA expression at days 3, 5 and 7 after transplantation. AQP2 mRNA expression in the aTX group was significantly down-regulated at these 3 times compared with normal controls (P ⬍ .05). There was no difference in AQP2 mRNA expression among the sTX group and the aTX⫹CsA groups compared with normal controls (P ⬎ .05). AQP2 mRNA expression was significantly downregulated at days 5 and 7 after transplantation compared with day 3. In addition, there was no remarkable difference between day 5 and 7 values after transplantation (Fig 1). AQP2 Protein Expression
AQP2 protein expression in the aTX group significantly down-regulated at days 3, 5 and 7 compared with normal controls (P ⬍ 0.05). There were no differences in AQP2 Table 1. The Semiquantity Scores of AR After Rat Renal Transplantation Groups
3 d After TX
Control sTX aTX aTX⫹CsA
(0.00 ⫾ 0.00) (0.16 ⫾ 0.40) (1.83 ⫾ 1.16)* (0.00 ⫾ 0.00)
5 d After TX
(0.00 ⫾ 0.00) (0.50 ⫾ 0.83) (3.16 ⫾ 0.75)*† (0.33 ⫾ 0.51)
7 d After TX
(0.00 ⫾ 0.00) (0.66 ⫾ 0.81) (3.50 ⫾ 1.04)*‡ (0.50 ⫾ 0.83)
AR, acute rejection; aTX, allogenic group; CsA, cyclosporine A; sTX, syngeneic group; TX, transplantation. *P ⬍ 0.05 (aTX groups compared with control groups). † P ⬍ 0.05 (in aTX groups 3 d after TX compared with 5 d after TX). ‡ P ⬍ 0.05 (in aTX groups 3 d after TX compared with 7 d after TX).
1886
protein expression among the sTX group versus the aTX⫹CsA group compared with normal controls (P ⬎ 0.05). AQP2 protein expression was significantly decreased at days 5 and 7 compared with day 3 (P ⬍ 0.05). In addition, there was no remarkable difference between AQP2 protein expressions at days 5 and 7 after transplantation (Figs 2 and 3).
CHEN, ZANG, ZHANG ET AL
Day 3
Day 5
Day 7
Control
sTX
aTX
aTX+CsA
Fig 2. Wistar rats were used as recipients received SD and Wistar renal grafts, respectively. The grafts were harvested at days 3, 5, and 7 after transplantation. They were sectioned into 3 m. The epithelial cells membrane in collection system which have a brown staining was positive cells. Measurement through image analysis of the gray value of positive cells (IOD values) as the relative expression of AQP2 protein analysis was carried out. Abbreviations as in Fig 1.
DISCUSSION
Fig 1. Wistar rats were used as recipients and received SD and Wistar renal grafts, respectively. The grafts were harvested at days 3, 5, and 7 after transplantation. The -actin 218 gene transcript was used as a reference template. The pairs of RT-PCR product were separated by 1.0% agarose gel electrophoresis. The upper band is AQP2, and the lower one is -actin 218. A: The level of AQP2 gene transcript of renal grafts at day 3 after transplantation. B: The level of AQP2 gene transcript of renal grafts at day 5 after transplantation. C: The level of AQP2 gene transcript of renal grafts at day 5 after transplantation. D: The level of AQP2 gene transcript of renal grafts in sTX group at days 3, 5, and 7 after transplantation. E: The level of AQP2 gene transcript of renal grafts in aTX group at days 3, 5, and 7 after transplantation. F: The level of AQP2 gene transcript of renal grafts in aTX⫹CsA group at days 3, 5, and 7 after transplantation. AQP, aquaporin; RT-PCR, reverse transcriptase-polymerase chain reaction; SD, Spraque-Dawley.
Although the incidence of kidney graft rejection has decreased, the response is still a major complication after kidney transplantation. AQPs are a family of functionally important water channel proteins with diverse intracellular targeting and trafficking properties. At present, we believe that water has 2 ways through the cell membrane: one is diffusion through the lipid bilayer, the other via AQP in the cellular membrane. Mediation of AQP hold the leading rolein transmembrane transport of hydroner. AQPs have been found in many cells and tissues. The kidney is the chief organ to adjust water equilibrium. AQP2 is the most important AQP in collecting duct epithelial cells. It mediates vasopressin-dependent permeability of the kidney collecting duct.14 AQP2 levels on collecting duct principal cell membranes are regulated by vasopressin: when vasopressin levels increase, vasopressin binds to its receptor on the basolateral membrane of collecting duct principal cells, initiating a cascade of events that results in the insertion of AQP2 into the apical plasma membrane. The steps include stimulation of adenylate cyclase (AC) by the heterotrimeric G protein, Gs, with an increase in intracellular cAMP. AQP2 located on intracel-
Fig 3. Control group 2, 3, 4. sTX group 3, 5, and 7 d after TX; 5, 6, 7: aTX group 3, 5, and 7 d after TX; 8, 9, 10: aTX⫹CsA group 3, 5, and 7 d after TX. aTX, allogenic group; CsA, cyclosporine A; sTX, syngeneic group; TX, transplantation.
CHANGES OF AQP2
lular vesicles is phosphorylated at serine-256 by protein kinase A (PKA). The vesicles move toward the plasma membrane, with which they ultimately fuse by exocytosis, thereby inserting AQP2 into the membrane. It opens the water channel, thereby increasing water permeability of membranes.15 When levels of vasopressin decrease, collecting duct principal permeability of membranes.15 When levels of vasopressin decrease, collecting duct principal cell membranes undergo endocytosis with AQP2-containing vesicles moving to intracytoplasmic membranes, with a reduced volume of AQP2 in principal cell luminal membranes and depressed luminal membrane permeability for water. The relationship between AQP2 and acute rejection is not clear. Our data showed that AQP2 expression was significantly down-regulated with acute rejection in the aTX compared with control group at days 3, 5 and 7 after transplantation (P ⬍ 0.05), particularly at the last 2 times (P ⬍ 0.05). The semi-quantitative scores of AR among the aTX group indicated that AQP2 expression was decreased, a down-regulation that paralleled its severity. After transplantation, AR grafts display water-sodium retention; reduced vasopressin at this time may be closely related to the down-regulation of AQP2 expression.16,17 Previous studies have shown that kidney graft ischemia/ reperfusion injury increases urinary production with reduced concentrated functions of the kidney. To eliminate the possibility that the reduction observed in our study was related to ischemia/reperfusion or denervation injury, we used a syngeneic group. Our data showed no significant differences among AQP2 expression by the kidneys in the syngeneic group versus the normal control (P ⬎ 0.05), consistent with our previous conclusion18 that ischemia reperfusion injury decreases expression of AQP1, AQP3, and AQP4 but not AQP2. Thus down-regulation of AQP2 has nothing to do with the ischemica/reperfusion injury and other operative factors. To confirm that denervation had no relationship to AR, we established an aTX⫹CsA group. Allografts under immunosuppression showed similar AR semiquantitative scores compared with the control and the sTX group (P ⬎ 0.05). AQP2 down-regulation was mitigated when the allograft host received immunosuppression (P ⬎ 0.05). Therefore, we believe that AQP2 down-regulation was related to acute renal graft rejection after transplantation. Our study showed that the down-regulation of AQP2 decreased collecting system function, decreasing reabsorption with water retention during acute rejection. This may be a method to save energy.19 AQP2 may thus be a new
1887
diagnostic marker and treatment target during acute graft rejection. REFERENCES 1. Hsich HG, Loong CC, Lui WY, et al: IL-17 expression as a possible predictive parameter for subclinical renal allograft rejection. Transpl Int 14:287, 2001 2. Harada KM, Mandia-Sampaio, EL, de Sandes-Freitas TV, et al: Risk factors associated with graft loss and patient survival after kidney transplantation. Transplant Proc 41:3667, 2009 3. Dibas AI, Mia AJ, Yorio AT: Aquaporins (water channels): role in vasopressin-activated water transport. Proc Soc Exp Biol Med 219:183, 1998 4. Itoh T, Rai T, Kuwahara M, et al: Identification of a novel aquaporin, AQP12, expressed in pancreatic acinarcells. Biochem Biophys Res Commun 330:832, 2005 5. Walz T, Fujiyoshi Y, Engel A. The AQP structure and functional implications. Handb Exp Pharmacol 190:31, 2009 6. Yang B, Gillespie A, Carlson EJ, et al. Neonatal mortality in an aquaporin-2 knock-in mouse model of recessive nephrogenic diabetes insipidus. J Biol Chem 276:2775, 2001 7. Apostol E, Ecelbarger CA, Terris J, et al: Reduced renal medullary water channel expression in puromycin aminonucleo-sideinduced nephrotic syndrome. J Am Soc Nephrol 8:15, 1997 8. Ward DT, Hammond TG, Harris HW: Modulation of vasopressin-elicited water transport by trafficking of aquaporin2containing vesicles. Annu Rev Physiol 61:683, 1999 9. Mattia F, Savelkoul PJ, Kamsteeg EJ, et al: Lack of arginine vasopressin-induced phosphorylation of aquaporin-2 mutant AQP2-R254L explains dominant nephrogenic diabetes insipidus. J Am Soc Nephrol 16:2872, 2005 10. Soowan K, Samhyeo C, Bongsuk O, et al: Diminished renal expression of aquaporin water channels in rats with experimental bilateral ureteral obstraction. J Am Soc Nephrol 12:2019, 2001 11. Gong H Wang W, Kwon TH, et al: EPO and alpha-MSH prevent ischemia 2 /reperfusion-induced down-regulation of AQPs and sodium transporters in rat kidney. Kidney Int 66:683, 2004 12. Ivarsen P, Frokiaer J, Aagaard NK, et al: Increased urinary excretion of aquaporin-2 in patients with liver cirrhosis. Gut 52:1194, 2003 13. Alexander MP, Patel TV, Farag YM, et al: Kidney pathological changes in metabolic syndrome: a cross-sectional study. Am J Kidney Dis 53:751, 2009 14. Nielsen S, Frokiaer J, Marples D, et al: Aquaporins in the kidney: from molecules to medicine. Physiol Rev 82:205, 2002 15. Brown D, Katsura T, Gustafson CE: Cellular mechanisms of aquaporin trafficking. Am J Physiol Renal Physiol 275:328, 1998 16. Agrawal V, Agarwal M, Joshi SR, et al: Hyponatremia and hypernatremia: disorders of water balance. J Assoc Physicians India 56:956, 2008 17. Grzeszczak W, Kokot F, Wiecek A: Changes in the activity of the renin-angiotensin-aldosterone system and serum vasopressin (AVP) level during acute rejection of transplanted kidney. Pol Arch Med Wewn 80:1– 8, 1988 18. Edemir B, Reuter S, Borgulya R, et al: Acute rejection modulates gene expression in the collecting duct. J Am Soc Nephrol 19:538, 2008 19. Anavelic JR, Hirsch JB et al: Renal transplantation modulates expression and function of receptors and transporters of rat proximal tubules. J Am Soc Nephrol 15:967, 2004