The characterization of Lucilia cuprina acetylcholinesterase as a drug target, and the identification of novel inhibitors by high throughput screening

Insect Biochemistry and Molecular Biology 41 (2011) 470e483

Contents lists available at ScienceDirect

Insect Biochemistry and Molecular Biology journal homepage: www.elsevier.com/locate/ibmb

The characterization of Lucilia cuprina acetylcholinesterase as a drug target, and the identification of novel inhibitors by high throughput screening Thomas Ilg*, Jörg Cramer 1, Jürgen Lutz, Sandra Noack, Harald Schmitt, Heike Williams, Trevor Newton 2 Intervet Innovation GmbH, Zur Propstei, 55270 Schwabenheim, Germany

a r t i c l e i n f o

a b s t r a c t

Article history: Received 4 February 2011 Received in revised form 6 April 2011 Accepted 13 April 2011

Acetylcholinesterase (AChE, EC3.1.1.7.) is the molecular target for the carbamate and organophosphate pesticides that are used to combat parasitic arthropods. In this paper we report the functional heterologous expression of AChE from Lucilia cuprina (the sheep blowfly) in HEK293 cells. We show that the expressed enzyme is cell-surface-exposed and possesses a glycosyl-phosphatidylinositol membrane anchor. The substrates acetyl-, propionyl- and butyrylthiocholine (AcTC, PropTC, ButTC), and also 11 further thiocholine and homo-thiocholine derivatives were chemically synthesized to evaluate and compare their substrate properties in L. cuprina AChE and recombinant human AChE. The MichaeliseMenten constants KM for AcTC, PropTC and ButTC were found to be 3e7-fold lower for the L. cuprina AChE than for the human AChE. Additionally, 2-methoxyacetyl-thiocholine and isobutyryl-thiocholine were better substrates for the insect enzyme than for the human AChE. The AcTC, PropTC and ButTC specificities and the MichaeliseMenten constants for recombinant L. cuprina AChE were similar to those determined for AChE extracted from L. cuprina heads, which are a particularly rich source of this enzyme. The median inhibition concentrations (IC50 values) were determined for 21 organophosphates, 23 carbamates and also 9 known non-covalent AChE inhibitors. Interestingly, 11 compounds were 100- to >4000-fold more active on the insect enzyme than on the human enzyme. The substrate and inhibitor selectivity data collectively indicate that there are structural differences between L. cuprina and human AChE in or near the active sites, suggesting that it may be possible to identify novel, specific L. cuprina AChE inhibitors. To this end, a high throughput screen with 107,893 compounds was performed on the L. cuprina head AChE. This led to the identification of 195 non-carbamate, non-organophosphate inhibitors with IC50 values below 10 mM. Analysis of the most potent hit compounds identified 19 previously unknown inhibitors with IC50 values below 200 nM, which were up to 335-fold more potent on the L. cuprina enzyme than on the human AChE. Some of these compounds may serve as leads for lead optimization programs to generate fly-specific pesticides. Ó 2011 Elsevier Ltd. All rights reserved.

Keywords: Acetylcholinesterase Cholinergic system Blowfly High throughput screening Pesticidal target

1. Introduction Pest insects are important causative agents of economic damage to crops in agriculture, and also play a role in veterinary and human medicine, being significant sources of disease and nuisance to man, companion animals and livestock. A sub-group of insects that have an impact in all these areas are the cyclorrapha, the true flies: diverse species of phytophagous fruit flies cause major damage in a large variety of agricultural crops worldwide (Malacrida et al., 2007; Aluja

* Corresponding author. Tel.: þ49 6130 948315. E-mail address: [email protected] (T. Ilg). 1 Present address: Bayer Animal Health GmbH, BAH-BD-PFM, Building 6210, 51368 Leverkusen, Germany. 2 Present address: BASF SE, GVA-HC e B009, 67056 Ludwigshafen, Germany. 0965-1748/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2011.04.003

and Mangan, 2008), while in the veterinary field, flies cause significant distress in livestock species by being a nuisance, by their bloodsucking habits and due to infestation by their larvae (myiasis). Examples of pure nuisance flies are the house fly (Musca domestica), the face fly (Musca autumnalis) and the headfly (Hydrotaea irritans) (Thomas and Jespersen, 1994; Malik et al., 2007). Biting and bloodsucking flies, such as the stable fly (Stomoxys calcitrans) and the horn fly (Haematobia irritans) (Byford et al., 1999; Foil and Hogsette, 1994; Presley et al., 1996), and myiasis-causing flies, such as sheep blowflies (Lucilia cuprina, Lucilia sericata), the nasal bot fly (Oestrus ovis) and the New World screwworm fly (Cochliomyia hominivorax) (Hall and Wall, 1995; Reichard, 1999; Wall et al., 2000; Otranto, 2001; Stevens and Wallman, 2006; Stevens et al., 2006), in addition to being a nuisance, also cause significant blood loss or tissue damage in livestock animals. Furthermore, many cyclorraphan flies are mechanical vectors of bacterial diseases such as anthrax (Fasanella

T. Ilg et al. / Insect Biochemistry and Molecular Biology 41 (2011) 470e483

et al., 2010) or bovine summer mastitis (Hillerton et al., 1990), and transmit nematodes such as Thelazia eye worms (Otranto and Traversa, 2005) or Habronema species (Traversa et al., 2008). In cattle production, cyclorraphans, such as the face fly, the stable fly and the horn fly, lead to major losses in milk production, feed intake and conversion, and leather quality. These losses have been estimated to exceed $1300 million annually (Byford et al., 1992). In sheep production, infestation of the animals with L. cuprina larvae (Tellam and Bowles, 1997) leads to severely reduced feed intake and dramatic reduction of volumetric wool fiber growth (Walkden-Brown et al., 2000). Thus, this blowfly causes damages in the sheep industry of more than $160 million annually in Australia alone (Beck et al., 1985; McLeod, 1995). The impact of nuisance, bloodsucking and myiasis flies to other livestock species and pet animals has not been precisely evaluated, but is likely to be considerable. Various types of control measures to combat fly pest species of animals have been devised, including biological, physical and chemical methods. Most prevalent is the use of prophylactic or therapeutic insecticides that are applied in a variety of ways, including oral applications, injections, powders, pour-ons, dips, baits, implants, dustbags, backrubber, neckbands, eartags, and others. Market products contain predominantly substances of the pyrethroid, macrocyclic lactone, insect growth regulator as well as organophosphate (OP) and carbamate (CB) compound classes (Drummond, 1985; Titchener, 1986; Miller, 1987; Kunz, 1987; Miller and Oehler, 1988; Graf, 1993; Anziani et al., 2000; Guglielmone et al., 2004; Wardhaugh, 2005; Peter et al., 2005; Broughan and Wall, 2006; Foil and Younger, 2006). The molecular target of the OP and CB insecticides is acetylcholinesterase (AChE), a serine hydrolase which controls cholinergic signal transmission in the nervous system of animals, and which is inhibited by these compounds (Taylor and Radi c, 1994). In most insects, two AChE genes, ace1 and ace2, are present. Insect ace1 seems to encode the synaptic enzyme in most species (Ilg et al., 2010), while the function of ace2 remains unclear. However, cyclorraphan flies appear to have lost the ace1 locus, and ace2 has taken over its function in cholinergic synapses in this insect group (Huchard et al., 2006). Fly control by OP and CB inhibitors of AChE (Fukuto, 1990) is a preferred option due to the desirable rapid knockdown effect of these agents. The use of OPs and CBs against flies is endangered by target site insensitivity mutations (Knipling and McDuffie, 1957; Devonshire, 1975; Devonshire and Moores, 1984; Fournier et al., 1992; Mutero et al., 1994; Barros et al., 2001; Kozaki et al., 2001; Walsh et al., 2001; Kim et al., 2003; Kristensen et al., 2006; Chen et al., 2007; Temeyer et al., 2008; Oyarzún et al., 2008; Kozaki et al., 2009), by gain-of-function mutations in degradative esterase genes (Newcomb et al., 1997; Hartley et al., 2006) and by biotransformation mechanisms (Syvanen et al., 1996; Feyereisen, 1999; Scott, 1999; Kristensen et al., 2000; Kristensen, 2005; Li et al., 2007). For the blowfly L. cuprina, AChE target site insensitivity to OPs and CBs has not yet been reported in field strains, but Chen et al. (2001) have introduced relative OP resistance in this enzyme by single and multiple point mutations. Given the fact that several fly species have also developed resistance to other insecticide classes (e.g. Soderlund, 2008; Oyarzún et al., 2008; Kristensen and Jespersen, 2008; Markussen and Kristensen, 2010), this situation creates the need for the development of new, effective, non-toxic and resistance-breaking antifly agents. One strategy for the identification of such compounds is high throughput screening (HTS) on pest organisms directly (Pridgeon et al., 2009), or on validated molecular targets of pest species (Tietjen et al., 2005; Gassel et al., 2009), such as insect AChE.

471

In the quest for novel anti-fly agents, we have investigated the suitability of L. cuprina AChE as a molecular target for an HTS campaign. To assess the potential for selectivity, recombinant and native L. cuprina AChE was compared with human AChE with respect to pseudosubstrate acceptance as well as interference by known OP, CB and non-covalent inhibitors. An HTS-compatible screening setup was developed, more than 100,000 compounds were screened, and inhibitors of known and novel classes were identified that inhibited the insect enzyme in the nanomolar range, while being more than 2 orders of magnitude less potent on the human enzyme. 2. Materials and methods 2.1. Bacterial strains, plasmids, chemicals, column materials and insects Bacterial cultures were grown in LuriaeBertani (LB) medium modified with supplements as required by the bacterial background and the introduced resistance genes. The mammalian expression vector pcDNA3.1 was from Invitrogen. HEK293 cells were from ATCC. Organophosphate and carbamate AChE inhibitors were from CHMSRV-PM or from Dr. Ehrenstorfer GmbH. Acetylthiocholine (AcTC), propionylthiocholine (PropTC), butyrylthiocholine (ButTC), 1,2,3,4-tetrahydroacridin-9-amine (tacrine), heptylene-bis-tacrine, hydroxytacrine, thioflavin T, propidium iodide, galanthamine, Bacillus (B.) cereus glycosyl-phosphatidylinositol-specific phospholipase C (GPI-PLC), 3-[(3-cholamidopropyl)dimethylammonio]-1propanesulfonate (CHAPS) and 5,50 -dithio-bis(2-nitrobenzoic acid) (DTNB) were from Sigma. L. cuprina flies used in this study were collected from long term cultures maintained at Intervet Innovation GmbH, Schwabenheim, Germany, and displayed no known resistance to OP or CB insecticides. 2.2. Identification, isolation and phylogenetic analysis of the L. cuprina acetylcholinesterase genes Total RNA was extracted from adult L. cuprina flies by a modification of the guanidinium thiocyanate/phenol extraction method (Chomczynski and Sacchi, 1987; Trizol, Sigma). Polyadenylated mRNA was isolated from total RNA using Oligotex mRNA spin columns (Qiagen). Other molecular biology techniques were performed essentially as described by Sambrook and Russell (2001). Reverse transcription (RT-) PCR was performed using the Titan one tube RTPCR system (Roche) with total RNA (0.5 mg/50 ml) or mRNA (50 ng/ 50 ml) as template. The cDNA sequence of the L. cuprina AChE (lcace) was obtained by RT-PCR with the specific primer pair TCCGGATCCATGGCTCGTTTTATAACAACATCATCATCACCAACA/GGGCCCGGGTTAT TGAAAAATGCATGTGACCATTATTGTGAGCA. The restriction enzyme sites introduced by the primer are underlined. Polymerase chain reaction (PCR) products were cloned into pCR2.1-Topo and introduced into E. coli Top10 cells (Invitrogen), or into pGEM-T (Promega) and in E. coli JM109. The cloned PCR products were sequenced. A consensus sequence devoid of PCR errors was identified by sequencing of 3 independent plasmid-cloned PCR fragments 3 and by performing ClustalW alignments with the translated DNA sequences. ClustalW multiple sequence alignments of L. cuprina acetylcholinesterases and other insect enzymes, the generation of phylogenetic trees and bootstrap analyses were done within the DNAStar Lasergene software package. 2.3. Analytical methods A standard acetylcholinesterase assay (Ellman et al., 1961) was performed at 22  C in 1 ml volumes of 10 mM Na2HPO4/NaH2PO4 pH 7.4, 137 mM NaCl, 2.7 mM KCl (PBS) containing 0.5 mM DTNB.

472

T. Ilg et al. / Insect Biochemistry and Molecular Biology 41 (2011) 470e483

After addition of the acetylcholinesterase sample, the reaction was started with 1 mM AcTC (final concentration) and the progress of the reaction was recorded by measuring generation of 5-nitro-2thio-benzoic acid via its absorption at 410 nm. For substrate specificity studies, AcTC was replaced by PropTC, ButTC and other thiocholine or homo-thiocholine derivatives (see below). To determine molar reaction rates, the absorption coefficient for 5-nitro-2-thiobenzoic acid 3410nm ¼ 13,600 M/cm was used. One unit (U) of enzymatic activity is defined as the amount of enzyme that catalyzes the conversion of 1 mmol substrate per minute reaction time. For the determination of the MichaeliseMenten constants (KM), AcTC, PropTC and ButTC concentrations were varied between 10 mM and 2 mM and the initial reaction velocity was measured. 2.4. Heterologous expression of the L. cuprina acetylcholinesterase gene in HEK293 cells For expression of lcace in the human cell line HEK293, its open reading frame was excised from the pGEM-T-cloned form by BamHI/SmaI digests. The DNA fragment was ligated into BamHI/ EcoRV-cut pcDNA3.1(þ), yielding pcDNA3.1(þ)-lcace. This plasmid was linearized by PvuI digestion and transfected into HEK293 cells using Polyfect transfection reagent (Qiagen) as outlined by the manufacturer. HEK293 cells were cultured in Dulbecco’s modified Eagle medium, 10% heat-inactivated calf serum at 37  C and 5% CO2. Selection for recombinant cells was performed by adding 600 mg/ ml G418 into the cell culture medium. The presence of the transgene was confirmed by PCR analysis using HEK293 cell genomic DNA as template. Single cell cloning was performed by the limiting dilution method. For analysis of cell-surface expression of LcAChE in recombinant HEK293 cell lines and clones, pcDNA3.1(þ)-lcacetransfected as well as control cells were seeded on 48 well plates, grown to near confluency, washed 3 with 1 ml PBS/well, and then overlayed with 1 ml PBS containing 1 mM AcTC, 0.5 mM DTNB and incubated at room temperature. After 10 min, 0.5 ml overlay solution were removed and the absorbance at 410 nm was determined. 2.5. Extraction of acetylcholinesterase from HEK293 cell cultures and from adult fleas To test for release of cell-surface-associated LcAChE from recombinant HEK293 cells, near confluent cell layers in 48 well plates were washed twice with PBS and once with 20 mM TriseHCl 150 mM NaCl (TBS). Then, 0.5 ml TBS or 0.5 ml TBS containing 50 mU/ml B. cereus GPI-PLC were added to the cell layers in each well and incubated at 37  C for 2 h. Subsequently the overlay solutions were centrifuged at 13,266g at 4  C for 5 min to remove detached cells, the centrifugation supernatants were recovered and analysed for AChE activity. For larger scale preparation of GPI-PLCreleased recombinant LcAChE, washed confluent cell layers of T75 flasks were incubated with 5 ml TBS containing 50 mU/ml B. cereus GPI-PLC at 37  C for 2 h followed by centrifugation of the overlay solution. In the investigation for the presence of L. cuprina AChE in adult flies, 30 CO2-anaesthesized flies were dissected into head, thorax and abdomen and homogenized at 4  C in 1.5 ml, 3 ml and 3 ml, respectively, of PBS containing 20% v/v glycerol and 0.5% w/v CHAPS. After centrifugation (16,000g at 4  C for 20 min), the supernatant was separated from the insoluble pellet. Aliquots of the supernatants were tested for AChE activity. Reextraction of the pellets yielded less than 10% AChE activity of the first extraction step, and was not considered further. Protein determination of the extracts was performed using the Coomassie Blue dye binding assay (Bradford, 1976) using bovine serum albumin (BSA) as a standard.

2.6. Synthesis of acylthiocholines and acetyl-homo-thiocholine The synthesis of acylthiocholines and acetyl-homo-thiocholine was performed essentially as outlined in Hussain and Schurman (1969), and Yamada et al. (1987).

2.7. High throughput inhibitor screening of L. cuprina AChE Generation of an AChE-containing L. cuprina extract e 4.09 g L. cuprina heads were homogenized in 22.6 ml 100 mM KH2PO4/ K2HPO4 pH 7.4, 1 mM EDTA using mortar and pestle. To avoid interferences with compounds, CHAPS and glycerol were omitted in preparations destined for high throughput screening, which led to lower extraction yields (approximately 40e60%). The extract was centrifuged at 16,000g for 10 min at 4  C. The supernatant was recentrifuged twice to remove traces of particles, and the pellets were discarded. Protein content was determined by the Coomassie Blue dye binding method (Bradford, 1976). The cleared supernatant was stored at 80  C until use. High throughput screening: primary screen e all assays were carried out in 384 well plates at room temperature (22  C). Test compounds were available as dimethylsulphoxide (DMSO) solutions. Dilutions were done in DMSO, except for the last 1:10 step, which was done in 100 mM KH2PO4/K2HPO4 pH 7.4 to lower the DMSO concentration in the assay. In a first step, 25 ml of a premix containing 100 mM KH2PO4/K2HPO4 pH 7.4, 80 mg/ml BSA, 0.3 mM DTNB and 150 mg/ml (protein content) L. cuprina head extract was added to each well. Then 5 ml inhibitor solution (10 mM in 100 mM KH2PO4/K2HPO4 pH 7.4, 10% DMSO) was added and the mixture was preincubated for 10 min. The reaction was started with the addition of 20 ml 0.75 mM AcTC in 100 mM KH2PO4/K2HPO4 pH 7.4. The final concentrations were 40 mg/ml BSA, 0.15 mM DTNB, 0.3 mM AcTC, 1 mM test compound, 1% v/v DMSO. The reaction was stopped after 30 min by the addition of 1 mM physostigmine (final concentration), and absorbance was measured at 405 nm using a SpectraFluorPlus (Tecan). The percentage enzyme activity was calculated with the formula (V  B)/(C  B)  100%, with V being the absorbance of the assay containing the test compound, B being the absorbance of the negative control (‘blank’) and C being the absorbance of the positive control. The theoretical hit limit for a HTS primary screen can be calculated as MEAN þ 3  STDEV from inhibitions from diverse compounds. If a normal distribution for inhibition is expected, 99.73% of inactive compounds are within this limit. In our case, based on a preliminary screen of >3000 diverse compounds, the hit limit was determined between 17.8% und 28.9% inhibition of colour development. For practical reasons, screening hit limits are normally set slightly above this limit, aiming at approximately 0.2e0.4% hits from a diverse library. Therefore, 30% inhibition of colour development at 1 mM compound concentration compared to the positive controls was considered a hit compound. Each plate contained 12 control wells comprising four positive controls (no inhibitor), 4 reagent blanks (no AcTC, negative controls) and 4 inhibitor controls (1 mM physostigmine). Z0 factors, which describe the quality of an assay, were excellent: Z0 for the AChE assay was an average of 0.94 (range 0.79e0.97). The Z0 factor is defined in terms of four parameters: the means and standard deviations of both the positive (p) and negative (n) controls (Zhang et al., 1999) :

Z0 ¼ 1  ðð3  ðSTDEVp þ STDEVnÞÞ= ðMEANp  MEANnÞÞ: Hit verification, inhibitory concentration 50% (IC50) determination and assessment of selectivity e to confirm that a hit compound was indeed an AChE inhibitor, IC50 determinations were performed

T. Ilg et al. / Insect Biochemistry and Molecular Biology 41 (2011) 470e483

473

Fig. 1. Biochemical and bioinformatics characterization of L. cuprina AChE. (A) Peptide sequence comparison of the first 90 amino acids of the LcAChE isolated from the L. cuprina strain used in this study with the database sequence U88631. (B) KyteeDoolittle hydrophobicity plot of the translated LcAChE gene isolated in this study. The positions of the ER import signal sequence (SS) and the GPI anchor addition sequence (GPI) are indicated. (C) Heterologous expression of LcAChE in HEK293 cells. The optical density (OD) at 412 nm indicates the AChE activity. The standard deviation of triplicates is indicated. (D) Release of heterologously expressed LcAChE from the surface of HEK293 cells by GPI-specific phospholipase C treatment. The rate of colour development (mOD 412 nm/min) indicates AChE activity. (E) Phylogenetic dendrogram of insect acetylcholinesterases. The dendrogram (DNAStar) was derived from ClustalW-aligned protein sequences of L. cuprina AChE (this study), Cochliomyia hominivorax AChE (FJ830868), Haematobia irritans AChE (AY466160), Musca domestica AChE (AAK69132), Drosophila melanogaster AChE (NM_057605), Anopheles gambiae AChE2 (XM_310628), Culex quincquefasciens AChE2 (XM_001842175), Ctenocephalides felis AChE2 (FN645951), Anopheles gambiae AChE1 (XM_321792), Culex quincquefasciens AChE1 (XM_001847396), Ctenocephalides felis AChE1 (FN645950), Bos taurus AChE (NM_001076220), Canis lupus AChE (XM_546946), Homo sapiens AChE (BC105062). L. cuprina esterase 7 (LCU56636) served as an outgroup. Bootstrap values (1000 replications) are shown at the branching points. The two insect AChE groups (AChE1 and AChE2) (Huchard et al., 2006) are indicated by two parentheses.

in triplicate using assay conditions as described above and 9 inhibitor concentrations ranging from 30 mM to 300 pM, depending on the inhibitor. Compound selectivity was assessed by using recombinant human AChE (Sigma, C1682) in the assay, which

required some assay modifications. The assay buffer for human AChE was 50 mM NaH2PO4/Na2HPO4 pH 8.0, 100 mg/ml BSA, 0.15 mM DTNB, 0.8 mM AcTC (final concentrations). The reaction was stopped by the addition of 10 mM physostigmine.

474

T. Ilg et al. / Insect Biochemistry and Molecular Biology 41 (2011) 470e483

Table 1 KM determination for blowfly (L. cuprina) and human AChEs with different substrates.

L. cuprina head extract L. cuprina rec. AChE (HEK293 cells, GPI-PLC) Human rec. AChE (HEK293 cells)

AcTC (mM)

PropTC (mM)

ButTC (mM)

35.5  2.8 (n ¼ 4) 38.1  3.1 (n ¼ 4) 127.5  7.5 (n ¼ 4)

21.3  1.5 (n ¼ 4) 13.9  1.1 (n ¼ 4) 156.0  28.3 (n ¼ 4)

56.8  3.3 (n ¼ 4) 72.0  4.4 (n ¼ 4) 178.5  9.8 (n ¼ 2)

The standard deviations and the number of repeats are indicated.

2.8. High throughput inhibitor screening of Ctenocephalides felis AChE Generation of an AChE-containing C. felis extract was mainly performed as described for L. cuprina AChE. 1.8 g C. felis adult fleas were homogenized in 8 ml 100 mM KH2PO4/K2HPO4 pH 7.4, 1 mM EDTA using mortar and pestle. To avoid loss of material, the mortar was rinsed with additional 4 ml of phosphate buffer. The extract

was centrifuged and stored as mentioned above, with a modification of centrifugation settings (13,800g for 15 min, repeated twice). The assay procedure for C. felis AChE was a modification of the one described for AChE from L. cuprina: 0.05 M sodium phosphate buffer, pH 8, was used instead of potassium phosphate buffer. AcTC substrate concentration was set to 0.5 mM, and 100 mg/ml C. felis raw extract in the premix was used. Physostigmine, a known AChE inhibitor, was used as standard inhibitor in a concentration of 10 mM, which led to a complete inhibition of the reaction. The reaction was stopped after an incubation time of 25 min by physostigmine (final concentration 10 mM). 3. Results 3.1. Isolation, bioinformatics analysis and heterologous expression of the L. cuprina acetylcholinesterase gene lcace The open reading frame encoding L. cuprina AChE was amplified by RT-PCR using imago poly-RNA isolated from our in-house fly strain, based on primer sequences derived from the database

Fig. 2. Chemical structures and substrate properties of acylthiocholine and acylthio-homo-choline derivatives. (A) Chemical structures. 1: acetylTC; 2: acetyl-homo-TC; 3: propionylTC; 4: butyrylTC; 5: 2-methoxyacetylTC; 6: isobutyrylTC; 7: 3-methylbutyrylTC; 8: pivaloylTC; 9: pentanoylTC; 10: hexanoylTC, 11: cyclopropanoylTC; 12: cyclopentanoylTC; 13: phenylacetylTC; 14. benzoylTC. (B) Activity of substrates 1-14 with GPI-PLC-released HEK293 cell-expressed LcAChE. The activity of acetylTC has been set as 100%. The standard deviation of triplicate determinations is indicated. (C) Activity of substrates 1e14 with HEK293 cell-expressed human AChE. The activity of acetylTC has been set as 100%. The standard deviation of triplicate determinations is indicated.

T. Ilg et al. / Insect Biochemistry and Molecular Biology 41 (2011) 470e483

sequence U88631 (Chen et al., 2001). DNA sequencing showed that, while the major part of the deduced protein sequence from several independent clones was identical to that predicted by U88631 (submitted to Genbank under the accession number JF776371), there were 4 amino acid deletions and 3 amino acid exchanges in the N-terminal part (Fig. 1A). Analysis of the deduced protein sequence by the GPI anchor prediction program GPI-SOM suggested the presence of a GPI anchor addition sequence at the C-terminus, which is also visible as a markedly hydrophobic region in KyteeDoolittle hydrophobicity plots (Fig. 1B). The prediction of an endoplasmic reticulum (ER) import sequence using SignalP failed initially. However, inspection of the hydrophobicity plot (Fig. 1B) identified a hydrophobic region around amino acids 80e100 reminiscent of a signal sequence. When the S/T-rich region leading up to amino acid 80 was removed before SignalP analysis, a signal peptide with a cleavage site between G103 and I104 was predicted with a probability of 0.897 (Fig. 1B). The functionality of both the ER import signal sequence and the GPI anchor addition sequence was tested by heterologous expression of LcAChE in HEK293 cells. Incubation of stably transfected cultures with colorimetric AChE substrates led to a rapid colour development by intact cells, suggesting cell-surface exposure of expressed LcAChE (Fig. 1C). This enzymatic activity could be released into the incubation medium by GPI-PLC treatment (Fig. 1D), which suggested that recombinant LcAChE was present on the HEK293 cell surface in a GPI-anchored form. These results were in agreement with the bioinformatics predictions of GPI-SOM and modified SignalP. Phylogenetic analysis of the LcAChE protein sequence showed high identity to C. hominivorax AChE (92.9%), M. domestica AChE

475

(86.8%), H. irritans AChE (86.6%), Drosophila melanogaster AChE (82.5%), Culex quinquefasciens AChE2 (65.7%), Anopheles gambiae AChE2 (65.1%) and C. felis AChE2 (63.3%), while homology to the AChE1 enzymes of the latter three insect species was low (35.0%, 35.9%, and 34.7%, respectively). This result demonstrates that LcAChE belongs to the insect AChE2 family (Fig. 1E). Amino acid sequence identity of LcAChE to human, bovine and canine AChE was low (35.4%, 35.5%, and 35.8%, respectively), which suggests that the fly and the mammalian enzymes may exhibit different biochemical and structural properties. 3.2. Enzymological characterization of recombinant and native L. cuprina acetylcholinesterase and comparison with the human enzyme Recombinant LcAChE released from HEK293 cells by GPI-PLC treatment was used to determine the MichaeliseMenten constants (KM) of the commercially available pseudosubstrates, acetylthiocholine (AcTC), propionylthiocholine (PropTC) and butyrylthiocholine (ButTC), which were 38.1 mM, 13.9 mM and 72 mM, respectively (Table 1). Furthermore, small amounts (mg range) of 11 additional acylthiocholines (acylTCs) were synthesized (compounds 2 and 5e14 in Fig. 2A), and their substrate properties at 1 mM concentration were compared with those of AcTC, PropTC and ButTC (Fig. 2B). In addition to the three commercial acylTCs, whose activity ranking was AcTC > PropTC > ButTC, 2-methoxyacetylTC and isobutyrylTC proved to be good substrates for LcAChE. The derivatives n-pentanoylTC and cyclopropanoylTC were fair substrates and phenylacetylTC a poor substrate, while acetyl-homo-thiocholine,

Fig. 3. Acetylcholinesterase (AChE) activity in extracts of L. cuprina adult flies. (A) Relative enzyme activity distribution in extracts of fly heads, thoraces and abdomina. The total activity (mU) of 30 dissected flies is indicated. (B) Specific AChE activity (mU/mg protein) in extracts of fly heads, thoraces and abdomina. (C) Comparison of Vmax for acetylTC (AcTC) propionylTC (PropTC) and butyrylTC (ButTC) for GPI-PLC-released HEK293 cell-expressed LcAChE (rec. L. cuprina AChE), for AChE in L. cuprina head extract and human recombinant AChE (rec. human AChE). The activities of the substrate AcTC were set at 100%, respectively. The standard deviation of triplicate determinations is indicated.

476

T. Ilg et al. / Insect Biochemistry and Molecular Biology 41 (2011) 470e483

acylTCs were also analysed with HEK293-expressed recombinant human AChE. Here, only AcTC and PropTC were good substrates and 2-methoxyacetylTC was a fair substrate (Fig. 2C). In addition, ButTC, isobutyrylTC, n-pentanoylTC, n-hexanoylTC, cyclopropanoylTC and phenylacetylTC showed weak substrate properties, while acetylhomo-thiocholine, 3-methylbutyrylTC, pivaloylTC, n-hexanoylTC, cyclopentanoylTC and benzoylTC were virtually no substrates (<2% of AcTC activity) (Fig. 2C). Major differences between the two enzymes were visible with the compounds ButTC, isobutyrylTC and methoxyacetylTC, which were much better substrates for the blowfly enzyme compared to the human enzyme (Fig. 2B and C). Furthermore, determination of KM values of AcTC, PropTC and ButTC for the human enzyme revealed 2.5e11-fold higher values than those determined for the blowfly enzyme (Table 1). Taken together, comparative analysis of pseudosubstrate specificities suggested marked differences between recombinant L. cuprina and human AChE. A relatively high activity towards ButTC (Vmax ButTC: Vmax AcTC y 0.5) appears to be a hallmark of cyclorraphan AChE, as this has been found also for D. melanogaster AChE (Gnagey et al., 1987, our unpublished results), M. domestica AChE (Krupka and Hellenbrand, 1974), and S. calcitrans AChE (our unpublished results). By contrast the products of insect ace1 genes appear to be poor converters of this substrate (e.g. C. felis: Ilg et al., 2010; Schizaphis graminum: Zhao et al., 2010; Aedes aegypti: our unpublished results). Since HEK293 cell-expressed LcAChE is an expensive source of enzyme for high throughput screening (HTS) purposes, we investigated adult flies as a potential non-recombinant source of this enzyme activity. Detergent extraction of dissected flies led to >90% solubilization of AChE activity, which was found predominantly in the head (w80%) (Fig. 3A). Most of the residual activity was present in the thorax (18%), while only 2% of LcAChE was found in the

Table 2 IC50 determination for organophosphate oxons: blowfly (L. cuprina) and human AChE. Compound

Human AChE, IC50 [nM]

L. cuprina AChE, IC50 [nM]

Organophosphate inhibitors Fospirate (15) Azamethiphos (16) Tetraethylpyrophosphate (TEPP) (17) Coumaphos-oxon (18) Crotoxyphos (19) Dichlorvos (20) Metrifonate (21) Bromchlophos (Naled) (22) Paraoxon (23) Chlorfenvinphos (24) Mevinphos (25) Tetrachlorvinphos (26) Famphur-O (27) Heptenophos (28) Oxydemeton methyl (29) Demeton-S-methyl (30) Phosphamidon (31) Profenofos (32) Omethoate (33) Dicrotophos (34) Monocrotophos (35)

0.5  0.06 1  0.04 4  0.8

Selectivity factor

1521  229 4559  5 4811

6  0.4 9  0.7 16  0,5 23  4 29  2 40  4 68  4 113  2 119  22 177  0.5 464  42 651  12 745  2 757  2 967  11 1156  171 2421  7 6814  121

3042 4559 1203

1430  31 6978  109 >30,000 2946  12 1928  482 217  9 15,739  1312 4501  267 >30,000 >30,000 >30,000 >30,000 >30,000 >30,000 15,086  1952 >30,000 >30,000 >30,000

238 775 >1875 128 66 5 231 40 >252 >169 >65 >46 >40 >40 16 >26 12 >4

The standard deviations for triplicate determinations are indicated.

3-methylbutyrylTC, pivaloylTC, n-hexanoylTC, cyclopentanoylTC and benzoylTC proved to be extremely poor (<2% of AcTC activity) or no substrates for the blowfly enzyme (Fig. 2B). To compare LcAChE with a mammalian counterpart, the substrate properties of all the Cl

O P

O

O

O O

O

N

O

Cl

P

O

O

S

N

N

Cl

O

Cl

15 O O

16

O

P

O

O

Cl

19

O

P

O

O

O

O

O

Cl

O

O

S

O

N

P

Cl

O

Cl

O

Cl Br

O

P

O

Cl

O Cl

Cl

O

Br

22

O

P

O

O

Cl

O

Cl

O

O

O

O

P

O

O

Cl

O Cl

Cl

24

O

P

P

O

NO2

23

O

21

P

O

O

O

Cl

20

O

P

O

P

18

OH

O

O

O

O

O

17

O

O

O

O P O O O P O O

25 Cl

O

O O

O

P

26

Cl

S

O

S

O

O

O

S

P

S

O

OO

27 N O O

P

O

28 O Cl

Cl

S O

P

O

32

N

O

O

O

31

29

O Br

P

S O

33

O

O

O

P

30

O O

O N

34

Fig. 4. Chemical structures of organophosphate AChE inhibitors.

O O

P

O O

35

O N

T. Ilg et al. / Insect Biochemistry and Molecular Biology 41 (2011) 470e483 Table 3 IC50 determination for carbamates: blowfly (L. cuprina) and human AChE. compound Carbamate inhibitors Physostigmine (36) Neostigmine (37) Carbofuran (38) Promecarb (39) Bendiocarb (40) Propoxur (41) Mexacarbate (42) Fenobucarb (43) Carbanolate (44) Carbaryl (45) Dioxacarb (46) Methiocarb (47) Isoprocarb (48) Aminocarb (49) Ethiofencarb (50) Methomyl (51) Aldicarb-sulphone (52) Pyridostigmine (53) Pirimicarb (54) Aldicarb (55) Aldicarb-sulphoxide (56) Butocarboxim (57) Butoxycarboxim (58)

L. cuprina AChE, IC50 [nM]

Human AChE, IC50 [nM]

Selectivity factor

4  0.5 5  0.9 22  2 40  6 67  2 77  7 131  27 140  4 162  13 182  2 207  42 237  23 312  38 769  100 1285  21 1410  263 2666  240 2702  132 3596  152 10,471  53 >30,000 >30,000 >30,000

234  11 177  10 247  0.6 733  70 736  19 3562  87 6111  534 7341  300 977  109 8185  178 26,014  654 4212  207 8646  644 11,834  178 >30,000 2880  987 >30,000 3122  115 >30,000 16,885  29 >30,000 >30,000 >30,000

58 35 11 18 11 46 47 52 6 45 126 18 28 15 >23 2 11 1 >8 1 e e e

The standard deviations for triplicate determinations are indicated.

abdomen (Fig. 3A). With respect to specific activity, L. cuprina head contained a 146-fold higher activity than the abdomen and a 27-fold higher activity than the thorax (Fig. 3B). Analysis of KM values (Table 1) and relative Vmax values for AcTC, PropTC and

477

ButTC (Fig. 3C) for L. cuprina head extract AChE showed a close relationship to the recombinant LcAChE, and differences to the human enzyme. As calculations of HTS enzyme activity requirements suggested that our blowfly breeding capacity would readily be capable of providing enough starting material, it was decided to use the head extract enzyme for an evaluation and screening campaign.

3.3. Evaluation of the target potential for high throughput screening for blowfly-specific inhibitors using established organophosphate, carbamate and non-covalent inhibitors A 384 well plate AChE assay format was developed that allowed the investigation of AChE inhibitor potencies on L. cuprina AChE versus human AChE. In an initial set of experiments, 21 organophosphate (OP) compounds were tested, IC50 values were determined and selectivity factors were calculated. As expected, all compounds inhibited LcAChE activity, and 18 OPs displayed IC50s in the nM range (Table 2, Fig. 4). On human AChE, only paraoxon (19) showed a nanomolar IC50, while the other 20 OPs had IC50s in the mM range, or higher than 30 mM, the upper limit for IC50 determinations of the anti-LcAChE inhibitor assay setup applied in this part of the study. Remarkably, the most potent OP derivatives, fospirate (15) and azamethiphos (16) with IC50s of 0.5 nM and 1 nM on the blowfly enzyme (Table 2, Fig. 4), were also the most selective ones, with selectivity factors of 3042 and 4559, respectively, versus the human enzyme. Further derivatives with IC50s below 20 nM for LcAChE were TEPP (17), coumaphos-oxon (18), crotoxyphos (19) and dichlorvos (20), with high selectivity factors versus human AChE of

Fig. 5. Chemical structures of carbamate AChE inhibitors.

478

T. Ilg et al. / Insect Biochemistry and Molecular Biology 41 (2011) 470e483

Table 4 IC50 determination for non-covalent inhibitors: blowfly (L. cuprina) and human AChE. Compound Non-covalent inhibitors AH233683 (59) Heptylene-bis-tacrine (60) Thioflavin T (61) BW284C51 (62) Tacrine (63) Galanthamine (64) 9-Aminoacridine (65) Hydroxytacrine (66) Propidium iodide (67)

L. cuprina AChE, IC50 [nM]

Human AChE, IC50 [nM]

Selectivity factor

61 14  4 93  7 106  6 227  331 291  38 387  57 1557  38 1776  117

23

3.8 0.4 89 0.7 1.3 10 0.9 1.2 6.4

61 8310 75  3 295  12 2908  138 342  34 1895  124 11,321  1356

The standard deviations for triplicate determinations are indicated.

1203, 238, 775 and >1875, respectively. The other 15 OPs were also more potent on the insect enzyme than on the human enzyme, with selectivity factors between 250 and 100 for four derivatives, between 100 and 10 for nine derivatives, and as low as 5 and >4 for paraoxon (19) and monocrotophos (35), respectively (Table 2). Furthermore, 21 monomethylcarbamates and two dimethylcarbamates known to inhibit AChE were analysed (Table 3, Fig. 5). Physostigmine (36) and neostigmine (37) proved to be LcAChE inhibitors in the low nM range, while all other carbamates displayed IC50s above 20 nM. The highest potencies, generally with IC50s in the nM range, were seen for arylcarbamates, while heteroaryl-carbamates such as pyridostigmine (53) and pirimicarb (54), and particularly oxime-carbamates such as methomyl (51), aldicarb (55), aldicarb-sulphoxide (56), aldicarb-sulphone (52), butocarboxim (57) and butoxycarboxim (58) were much less active,

with IC50s well in the mM range or above 30 mM (Table 3, Fig. 5). Most carbamates showed relative selectivity for LcAChE versus the human enzyme; only pyridostigmine (53) and aldicarb (55) were unselective. The highest blowfly AChE preference was observed for dioxacarb (46), with a selectivity factor of 126. A third group of AChE inhibitors that was analysed encompassed a structurally diverse set of nine compounds that, in contrast to the OPs and carbamates, are believed to act on the enzyme via noncovalent interactions. Eight of the compounds displayed nanomolar IC50s on LcAChE, with AH233683 (59) and heptylene-bis-tacrine (60) being the most potent ones, having IC50s of 6 nM and 14 nM, respectively. The next most potent derivatives were thioflavin T (61) and BW284C51 (62) with IC50s around 100 nM, while tacrine (63), galanthamine (64), 9-aminoacridine (65), hydroxytacrine (66) and propidium (67) were weaker LcAChE inhibitors with IC50 ranges between 227 nM and 1776 nM (Table 4, Fig. 6). Eight out of nine non-covalent inhibitors showed only poor selectivity (galanthamine, propidium, AH233683), no selectivity (tacrine, hydroxytacrine, 9-aminoacridine), or even inverted selectivity (BW284C51, heptylene-bis-tacrine) towards human AChE (Table 4, Fig. 6). Only thioflavin T was a significantly better inhibitor of LcAChE compared to human AChE. The latter example suggests, however, that also for non-covalent inhibitors, selectivity for blowfly versus human AChE can be achieved. 3.4. Identification of LcAChE inhibitors by high throughput screening and characterization of their specificity A 384 well plate format assay for LcAChE was used to screen 107,893 compounds of the Intervet substance collection. A substance was considered a hit when 1 mM of the compound led to a 30%

+

N

+

N

59

NH

HN

+

N

N

S

N

N

60

61 OH NH2

+

+

N

N

O N

O

62

N

O

63

64 NH2

NH2

NH2

OH

N

H2N

N

N +

N

65

66 Fig. 6. Chemical structures of various non-covalent AChE inhibitors.

67

T. Ilg et al. / Insect Biochemistry and Molecular Biology 41 (2011) 470e483

479

Fig. 7. Chemical structures of AChE inhibitors identified in the LcAChE high throughput screening campaign.

inhibition of LcAChE activity. By this criterion, the high throughput screen yielded 433 hit compounds, which translates into an initial hit rate of 0.4%. This set of compounds was filtered for compounds not considered interesting for further development, such as organophosphates, carbamates, many quaternary ammonium compounds that were similar to the scaffolds of compounds (59) and (62), as well as tacrine-like compounds such as 9-aminoacridine and

Table 5 IC50 determination for the best selected hits of the high throughput screening campaign: blowfly (L. cuprina), human and cat flea (C. felis) AChE. Compound

L. cuprina AChE, IC50 [nM]

Human AChE, IC50 [nM]

Selectivity L. cuprina/ human AChE

C. felis AChE, IC50 [nM]

(68) (69) (70) (71) (72) (73) (74) (75) (76) (77) (78) (79) (80) (81) (82) (83) (84) (85) (86)

30  3 34  10 35  5 37  6 49  12 64  11 77  5 78  11 70  1 87  9 93  3 99  12 119  4 121  14 147  5 149  32 157  17 162  28 184  36

>10,000 >10,000 >10,000 115  16 219  177 7716  106 1252  77 2924  272 >10,000 >10,000 897  86 >10,000 1076  168 1391  134 >10,000 >10,000 >10,000 >10,000 >10,000

>335 >292 >288 3 4 119 16 38 >127 >115 10 >101 9 12 >68 >67 >64 >62 >54

>10,000 >10,000 5274  645 n. d. n. d. 2382  185 n. d. n. d. >10,000 >10,000 n. d. >10,000 n. d. n. d. >10,000 5596  317 >10,000 >10,000 >10,000

The standard deviations for triplicate determinations are indicated.

4-aminoquinoline derivatives. This structure-based pre-selection led to a list of 218 compounds, called filtered hits. The hit status of these compounds was verified by IC50 determinations, whereby 23 compounds displayed IC50s above 10 mM and were excluded from further consideration. 195 compounds showed IC50s in the range of w30 nM to w9 mM and were therefore considered verified hits. The chemical structures of the best 19 hits with IC50s on LcAChE of 30 nM to <200 nM are shown in Fig. 7. Nine of the compounds carried one positive charge. Amongst these were the pyrimido[2,1-a] isoquinolin-5-ium derivative (70) and the thiazolium compound (82). Both compounds showed considerable selectivity for the blowfly enzyme (factors of >288 and >67, respectively), because their IC50s on the human enzyme were higher than 10 mM. The other seven cationic compounds carried the charge within delocalized conjugated double bond systems (substances 73, 74, 75, 76, 78, 80, 81 and 86). This compound class comprised substances with high selectivity, such as (73) and (76), but also some with poor selectivity, such as (80) and (81), which have similar inhibitor potency on the blowfly and the human enzyme. Two compounds belonged to the class of trifluoromethylarylketones (71, 72), that have been described as reversible covalent inhibitors of serine esterases (Brodbeck et al., 1979; Székács et al., 1990; Nair et al., 1994). While these compounds were highly potent on LcAChE, with IC50s of 37 nM and 57 nM, respectively, their selectivity factors versus human AChE were low (Table 5). Most remarkable was, however, a series of diverse compounds that are most likely non-covalent inhibitors. They have not previously been reported to be AChE inhibitors, but all showed pronounced selectivity for LcAChE: the two acetophenone hydrazone compounds, (68) and (69), were the most potent and selective hit compounds, with LcAChE IC50s of 30 and 34 nM, respectively, and selectivity factors towards human AChE of >335 and >292. The pyrazole compound (77) and the imidazole compound (79) were the

480

T. Ilg et al. / Insect Biochemistry and Molecular Biology 41 (2011) 470e483

next most potent, with IC50s below 100 nM and selectivity factors of around 100. The N(2-pyrimidino)-N0 (aryl)-guanidine derivatives, (83) and (85), showed very similar potency (IC50 w 150 nM) and selectivity (>w60), as did the tetrahydro-xanthene-dione (84). Finally the acylphenothiazine derivative (86) was the least potent compound to be considered in more detail, but it still had an IC50 of 184 nM on LcAChE, more than 50-fold more potent than on the human enzyme (Table 5, Fig. 7). To assess the potential of the identified LcAChE inhibitors on an enzyme from another insect species, the compounds displaying selectivity towards human AChE above a factor of 50 were investigated for their inhibitory action on AChE extracted from adult fleas. Paraoxon (23) and physostigmine (36) served as inhibitor positive controls for the C. felis enzyme, with approximate EC50s of 100 nM and 10 nM, respectively. None of the selected compounds had a nanomolar activity on the flea enzyme. For most substances an IC50 could not be determined with the established method due to the low level of inhibition. The only three compounds that were potent enough on C. felis AChE for IC50 determination had 36e150fold lower potency than on the LcAChE (Table 5). 4. Discussion Recent surveys confirm that AChE is still the prime target of insecticides (Casida, 2009), and a number of AChE inhibitors of the CB and the OP drug and prodrug classes are used to combat cyclorraphan veterinary pests (Drummond, 1985). In this study, we have characterized AChE of the cyclorraphan fly L. cuprina as a GPIanchored cell-surface-associated enzyme, and we have shown that its properties differ from human AChE, not only with respect to primary amino acid sequence, but also with respect to substrate preference, kinetic parameters, sensitivity to inhibitors forming covalent bonds to AChE, such as OPs and CBs (Aldridge, 1971), and sensitivity to non-covalent inhibitors. One peculiarity of LcAChE is its unusually long signal sequence, which fails to show a significant score in SignalP analysis, while a N-terminally truncated version does. A possibility could be that the ATG methionine codon proposed by Chen et al. (2001) is not the true translation initiation site. An alternative site could be a CTG codon encoding Leu64, as such codons have been shown to act sometimes as translation initiation sites (Tikole and Sankararamakrishnan, 2006). SignalP analysis from this point onwards yields a probability of 0.897. This may also explain, why all non-silent mutations observed in our sequence compared to the database sequence U88631 (Chen et al., 2001) cluster upstream of the Leu64 codon. However, this notion will require experimental proof. In the case of OPs, one strategy to improve selectivity and safety is the use of prodrug approaches, such as the formation of thiophosphates or phosphoamidates (Fukuto, 1990; Kasagami et al., 2002). These derivatives are largely inactive as AChE inhibitors and act as prodrugs. After uptake into the organism, they develop their AChE inhibitor properties by oxidative metabolic activation, which is apparently more efficient in insects than in mammals (Dauterman, 1971). Studies on M. domestica AChE have suggested that the single most important factor for potent anticholinesterase activity of OP drugs is chemical reactivity, while the hydrolysis of the phosphorylated AChE active site serine and the steric factors of the leaving group appear to be of secondary importance (Hansch and Deutsch, 1966; Fukuto, 1971, 1990). However, direct comparisons of the target selectivities of OP drugs, using AChE activities of insect pest species and of vertebrates, are rare in the literature (Fukuto, 1971). Therefore, in this study we have compared the inhibitor potency of 21 OP oxons on L. cuprina AChE and human AChE. Remarkably, some OPs exhibited more than 1000-fold selectivity for blowfly AChE compared to the human enzyme, and

with the exception of paraoxon, all OPs with high potency (IC50 < 100 nM) showed a markedly (>66-fold) higher inhibitory action on the L. cuprina AChE than on its human counterpart. It appears that these differences in OP inhibitor potencies on blowfly versus human AChE cannot be explained by OP reactivity, and likely reflect differences in fit and orientation in the respective active sites. CBs are commonly applied as active drugs and do not require metabolic activation. While on-target (M. domestica AChE) and insect in vivo structureeactivity relationships for insecticidal CBs are available for a large number of derivatives (Metcalf, 1971), only a small number of direct comparisons of CB AChE target selectivities, using enzymes from insect pest species and from vertebrates, have been published (Nishioka et al., 1977; Kamoshita et al., 1979; Carlier et al., 2008). In this study, 23 CB insecticides, most of them commercial products, were investigated for on-target selectivities. 15 CBs showed >10-fold and up to 126-fold selectivity for the blowfly AChE compared to the human AChE, while a minority of derivatives was unselective. Two CBs had IC50s below 10 nM, four others below 50 nM, and eight more below 1 mM on the blowfly enzyme. Surprising was the comparatively poor on-target potency of the oxime-carbamates, which all showed micromolar IC50s. For instance aldicarb inhibited L. cuprina AChE with an IC50 of 10.5 mM and aldicarb-sulphoxide had an IC50 exceeding 30 mM. Both derivatives showed, however, high efficacy in a L. cuprina larval feeding assay, where 10 ppm of the substances in the feed (corresponding to approximately 100 mM) were uniformly lethal (H. Williams, unpublished results). For CB insecticides it has been reported that steric effects dominate over chemical reactivity in their impact on AChE inhibitor potency (Hansch and Deutsch, 1966; Metcalf, 1971). Differences in steric fit and orientation of the CBs may also provide a straightforward explanation for the blowfly versus human AChE selectivities seen in our experiments (Table 4). Taken together, within the group of commercial OP and CB insecticide products investigated in this study, compounds with some degree of L. cuprina AChE selectivity clearly dominated, while non-selective derivatives, such as aldicarb and methomyl were rare, and inverted selectivity (i.e. higher potency on the human enzyme) was never found. This suggests that the historic OP and CB pesticide development programs have included, in addition to other factors such as insect cuticle permeation capacity, prodrug approaches, metabolic detoxification in mammals and nonsystemic application (Dauterman, 1971; Hollingworth, 1971; Dubois, 1971; Vandekar et al., 1971; Fukuto, 1990; Kasagami et al., 2002), also AChE on-target selectivity as part of the product safety profile (probably inadvertently in most cases). The results of our studies with commercial insecticides suggest that many OPs and CBs have high L. cuprina AChE on-target potency, and that some also have high selectivity in human AChE. However, as the basis of a lead optimization program to identify highly selective and resistance-breaking fly AChE inhibitors, these compound classes are clearly not ideal. For such an optimization based on the OPs, it would be necessary to ensure simultaneously a sufficient chemical reactivity of the leaving group, the stability of the resulting serine phosphoester, as well as optimizing the steric fit and orientation at the binding sites in a differential way (insect versus mammalian AChE). This would make the definition of the structure activity relationships (SAR) and the generation of a rationale for derived synthesis strategies a difficult task. Furthermore, AChE-inhibiting OPs have an inherent potential to act on other serine esterases, a property that is responsible for the induction of organophosphate-induced delayed neuropathy in humans and animals, at least by some OP derivatives (Battershill et al., 2004; Lotti and Moretto, 2005). The AChE-inhibitory efficacy of CBs appears to be predominantly influenced by steric fit

T. Ilg et al. / Insect Biochemistry and Molecular Biology 41 (2011) 470e483

(Hansch and Deutsch, 1966; Metcalf, 1971). But, as with the OPs, the structural diversity of potential derivatives is limited by the need for sufficient reactivity of the leaving group, and the need for correct drug positioning in the centre of the AChE active site. Therefore, taken together, these factors make OPs and CBs less desirable starting points for lead optimization programs for flyspecific AChE inhibitors. Non-covalent AChE inhibitors are not necessarily confined to bind in the neighbourhood of the AChE active site serine, and many more interaction points with the enzyme are conceivable compared to the OPs and CBs. Structural data have shown that this is indeed the case, and it has been demonstrated that potent inhibitors can also bind in the so-called peripheral site (Auletta et al., 2010) or in the active site gorge (Senapati et al., 2005). In evaluations of noncovalent inhibitors in our assays, seven derivatives were identified that showed nanomolar IC50s on the blowfly AChE. Amongst the tested compounds were inhibitors with poor L. cuprina AChE selectivity (AH233683, galanthamine, propidium), non-selective inhibitors (tacrine, 6-aminoacridine and hydroxytacrine), and even human AChE-selective inhibitors (heptylene-bis-tacrine and BW284C51). However, experiments with thioflavin T showed a pronounced preference for L. cuprina AChE (factor 89) versus human AChE. Collectively, these data suggest that: 1) high inhibitor potency towards L. cuprina AChE can be obtained with noncovalent inhibitors, and 2) high selectivity for L. cuprina AChE can also be achieved. Therefore we considered that a high throughput screen for novel inhibitors using a compound library biased towards non-reactive compounds would be a viable strategy. Cost of goods considerations in our high throughput screening campaign led us to choose to use L. cuprina AChE isolated from fly head extracts, which proved to be an extraordinarily rich source of the enzyme. Despite the fact that stringent hit criteria were set (30% inhibition at 1 mM compound concentration), the high throughput screen of 107,893 compounds led to 433 hit compounds, or a hit rate of 0.4%. Almost half of these hit compounds were found to be OPs, CBs, quaternary ammonium compounds, tacrine-like compounds or other unwanted structures, such as aldehydes or potential alkylating agents. But after discarding these, 218 compounds were finally chosen as ‘filtered hits’ for further consideration. Of these, 195 compounds passed the hit confirmation criterion, displaying IC50s < 10 mM, which demonstrates the high quality of the screen. The 19 best ‘filtered hits’, with IC50 values below 200 nM are, to the best of our knowledge, AChE inhibitors that have not previously been reported. These hit compounds were analysed in more detail: two compounds proved to be aryltrifluoromethylketones, which are not truly non-covalent inhibitors. This type of compound can form reversible covalent hemiketal bonds to the active site serine of serine esterases (Brodbeck et al., 1979; Székács et al., 1990; Nair et al., 1994), and the derivatives that we identified (71, 72), while potent inhibitors, proved not to be selective for the L. cuprina enzyme. Therefore, the two hit aryltrifluoromethylketones were considered poor starting points for further optimization. Two other hits from the selected 19 were cations with a pH-independent charge (70) or most likely carrying a charge at physiological pH (82). While being potent and selective (>288-fold and >68-fold, respectively), positive charges such as on the compounds 70 and 82 are generally considered to be unfavourable for permeation through hydrophobic layers such as cell membranes or insect cuticles (Gerolt, 1969; Mälkiä et al., 2004). Furthermore, compounds with charges are often excluded by or permeate poorly through the bloodebrain barrier both in vertebrates (Fischer et al., 1998; Seelig, 2007) and in insects (Carlson et al., 2000; Edwards and Meinertzhagen, 2010). Since in insects, acetylcholinesterase is largely localized to the central nervous system, this makes it questionable whether 70 and 82 as well as other charged compounds are useful starting points for lead optimization programs.

481

Seven further substances (73, 74, 75, 76, 78, 80, 81) with selectivity factors ranging from 1 to >127 also contained a positive charge, but delocalized between two nitrogens connected by a double bond system. This type of compound somewhat resembles thioflavin T (61), the anthelmintic product, dithiazanine (Aguilar, 1959), and a series of other anthelmintically active compounds (Garmaise et al., 1967, 1969). However, it also resembles carbocyanine dyes that are known to interact strongly with a variety of biological structures and macromolecules, such as lipid membranes, glycoconjugates, proteins and nucleic acids (Green, 1978; Deleers et al., 1984). Carbocyanine dyes are also known to be potent DNA-intercalating agents (Biver et al., 2005). Although these substances have not been described as potent AChE inhibitors, the sum of all information available suggests that this group of compounds should be given a low priority when choosing lead candidates. The acylphenothiazine derivative 86 is remarkable because, while phenothiazine derivatives have been described previously as cholinesterase inhibitors, their activity was primarily seen on butyrylcholinesterase (Saxena et al., 1997; Darvesh et al., 2005). This is in line with the results of the human AChE counterscreen in our study, in which 86 was only weakly active, while LcAChE was inhibited in the nM range, suggesting that this compound deserves further evaluation. The compounds 83 and 85 can be regarded as N(2-pyrimidino)N0 (aryl)-guanidine derivatives or 2,4,6-trisubstituted pyrimidine derivatives. Recently, some 2,4-disubstituted pyrimidines have been reported to be AChE inhibitors (Mohamed and Rao, 2010), but whether our hits (83 and 85) conform to the pharmacophore described in this publication is unclear. The relatively good selectivity for blowfly AChE in combination with high potency indicates that further evaluation of these compounds may be promising. Finally, the two compounds 68 and 69 exhibited outstanding potency on blowfly AChE (30 nM and 34 nM IC50, respectively) and pronounced LcAChE selectivity (factors of >335 and >292, respectively). They can both be viewed as acetophenone hydrazones, although whether they truly possess a common pharmacophore would have to be determined by further chemical derivatization and enzyme inhibition experiments. We are not aware of earlier reports describing this type of compound as AChE inhibitor and we believe that these two substances are the best candidates in the hit list for further evaluation. The 12 most LcAChE-selective hits (with selectivity factors > 50; compounds 68, 69, 70, 73, 76, 77, 79, 82, 83, 84, 85 and 86), from the highly potent inhibitors shown in Table 5 and Fig. 7, were also investigated for their inhibitory potential on cat flea (C. felis) AChE extracted from adult fleas. None of the hit compounds showed potent inhibition of cat flea AChE. Only 3 compounds (70, 73 and 83) exhibited an IC50 in the micromolar range in our standard assay. All the others performed so poorly in our inhibitor assays that IC50 determination was not possible. While at first glance this is an unexpected result, a comprehensive study by Huchard et al. (2006) has shown that cyclorrhaphan flies, L. cuprina amongst them, differ from other Diptera, and possibly also from other insects, in having lost the synaptically expressed ace1 gene. This is functionally replaced by the ace2 gene, which is only distantly related, and the function of which in other insects is unclear (Ilg et al., 2010, and references therein). In terms of protein sequence identity, L. cuprina AChE and C. felis AChE1 for instance are less closely related than human AChE and C. felis AChE1 (see also Fig. 1E). Given this background information, our results on C. felis AChE inhibition are not as surprising, as initially thought. These results also suggest that it would be difficult to develop pan-insect specific AChE inhibitors with selectivity on human AChE, based on enzyme target specificity alone. In contrast, it appears likely that the L. cuprina AChE inhibitors identified in this report would inhibit the AChE in other cyclorraphan flies that are known to utilize the corresponding

482

T. Ilg et al. / Insect Biochemistry and Molecular Biology 41 (2011) 470e483

closely related ace2 gene products as synaptic AChE (Huchard et al., 2006, see Fig. 1E). However, further experiments would be necessary to confirm this. In conclusion, the results of this study have provided potential chemical lead candidates for the development of fly-specific pesticides. Acknowledgements We would like to thank Petra Rohrwild for contributions during the early stages of the project, Jaap Kool for critically reading the manuscript, and Marina Breitmann, Edith Jeschek, Bernd Jürgens, Christina Metzger, Susanne Schmalz, Andrea Strunk, Andrea Wagner, Margaret Werr and Hartmut Zoller for expert technical assistance. References Aguilar, F.J., 1959. The polyanthelmintic action of dithiazanine iodide; verification of its effectiveness in the most common helminthiases in Guatemala. Am. J. Trop. Med. Hyg. 8, 305e306. Aluja, M., Mangan, R.L., 2008. Fruit fly (Diptera: Tephritidae) host status determination: critical conceptual, methodological, and regulatory considerations. Annu. Rev. Entomol. 53, 473e502. Aldridge, W.N., 1971. The nature of the reaction of organophosphorus compounds and carbamates with esterases. Bull. World Health Organ. 44, 25e30. Anziani, O.S., Zimmermann, G., Guglielmone, A.A., Forchieri, M., Volpogni, M.M., 2000. Evaluation of insecticide ear tags containing ethion for control of pyrethroid resistant Haematobia irritans (L.) on dairy cattle. Vet. Parasitol. 91, 147e151. Auletta, J.T., Johnson, J.L., Rosenberry, T.L., 2010. Molecular basis of inhibition of substrate hydrolysis by a ligand bound to the peripheral site of acetylcholinesterase. Chem. Biol. Interact. 187, 135e141. Barros, A.T., Ottea, J., Sanson, D., Foil, L.D., 2001. Horn fly (Diptera: Muscidae) resistance to organophosphate insecticides. Vet. Parasitol. 96, 243e256. Battershill, J.M., Edwards, P.M., Johnson, M.K., 2004. Toxicological assessment of isomeric pesticides: a strategy for testing of chiral organophosphorus (OP) compounds for delayed polyneuropathy in a regulatory setting. Food Chem. Toxicol. 42, 1279e1285. Beck, T., Moir, B., Meppem, T., 1985. The cost of parasites to the Australian sheep industry. Q. Rev. Rural Econ. 7, 336e343. Biver, T., De Biasi, A., Secco, F., Venturini, M., Yarmoluk, S., 2005. Cyanine dyes as intercalating agents: kinetic and thermodynamic studies on the DNA/Cyan40 and DNA/CCyan2 systems. Biophys. J. 89, 374e383. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248e254. Brodbeck, U., Schweikert, K., Gentinetta, R., Rottenberg, M., 1979. Fluorinated aldehydes and ketones acting as quasi-substrate inhibitors of acetylcholinesterase. Biochim. Biophys. Acta 567, 357e369. Broughan, J.M., Wall, R., 2006. Control of sheep blowfly strike using fly-traps. Vet. Parasitol. 135, 57e63. Byford, R.L., Craig, M.E., Crosby, B.L., 1992. A review of ectoparasites and their effect on cattle production. J. Anim. Sci. 70, 597e602. Byford, R.L., Craig, M.E., DeRouen, S.M., Kimball, M.D., Morrison, D.G., Wyatt, W.E., Foil, L.D., 1999. Influence of permethrin, diazinon and ivermectin treatments on insecticide resistance in the horn fly (Diptera: Muscidae). Int. J. Parasitol. 29, 125e135. Carlier, P.R., Anderson, T.D., Wong, D.M., Hsu, D.C., Hartsel, J., Ma, M., Wong, E.A., Choudhury, R., Lam, P.C., Totrov, M.M., Bloomquist, J.R., 2008. Towards a speciesselective acetylcholinesterase inhibitor to control the mosquito vector of malaria, Anopheles gambiae. Chem. Biol. Interact. 175, 368e375. Carlson, S.D., Juang, J.L., Hilgers, S.L., Garment, M.B., 2000. Blood barriers of the insect. Annu. Rev. Entomol. 45, 151e174. Casida, J.E., 2009. Pest toxicology: the primary mechanisms of pesticide action. Chem. Res. Toxicol. 22, 609e619. Chen, Z., Newcomb, R., Forbes, E., McKenzie, J., Batterham, P., 2001. The acetylcholinesterase gene and organophosphorus resistance in the Australian sheep blowfly, Lucilia cuprina. Insect Biochem. Mol. Biol. 31, 805e816. Chen, M.H., Han, Z.J., Qiao, X.F., Qu, M.J., 2007. Mutations in acetylcholinesterase genes of Rhopalosiphum padi resistant to organophosphate and carbamate insecticides. Genome 50, 172e179. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanateephenolechloroform extraction. Anal. Biochem. 162, 156e159. Dauterman, W.C., 1971. Biological and nonbiological modifications of organophosphorus compounds. Bull. World Health Organ. 44, 133e150. Darvesh, S., McDonald, R.S., Penwell, A., Conrad, S., Darvesh, K.V., Mataija, D., Gomez, G., Caines, A., Walsh, R., Martin, E., 2005. Structureeactivity

relationships for inhibition of human cholinesterases by alkyl amide phenothiazine derivatives. Bioorg. Med. Chem. 13, 211e222. Deleers, M., Servais, J.P., de Laveleye, F., Wulfert, E., 1984. Effect of lipid composition changes on carbocyanine dye fluorescent response. Biochem. Biophys. Res. Commun. 123, 178e185. Devonshire, A.L., 1975. Studies of the acetylcholinesterase from houseflies (Musca domestica L.) resistant and susceptible to organophosphorus insecticides. Biochem. J. 149, 463e469. Devonshire, A.L., Moores, G.H., 1984. Different forms of insensitive acetylcholinesterase in insecticide-resistant house flies (Musca domestica). Pestic. Biochem. Physiol. 21, 336e340. Drummond, R.O., 1985. New methods of applying drugs for the control of ectoparasites. Vet. Parasitol. 18, 111e119. Dubois, K.P., 1971. The toxicity of organophosphorus compounds to mammals. Bull. World Health Organ. 44, 233e240. Edwards, T.N., Meinertzhagen, I.A., 2010. The functional organisation of glia in the adult brain of Drosophila and other insects. Prog. Neurobiol. 90, 471e497. Ellman, G.L., Courtney, K.D., Andres Jr., V., Feather-Stone, R.M., 1961. A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol. 7, 88e95. Fasanella, A., Scasciamacchia, S., Garofolo, G., Giangaspero, A., Tarsitano, E., Adone, R., Aug 17, 2010. Evaluation of the house fly Musca domestica as a mechanical vector for an anthrax. PLoS One 5 (8), e12219. Feyereisen, R., 1999. Insect P450 enzymes. Annu. Rev. Entomol. 44, 507e533. Fischer, H., Gottschlich, R., Seelig, A., 1998. Bloodebrain barrier permeation: molecular parameters governing passive diffusion. J. Membr. Biol. 165, 201e211. Foil, L.D., Hogsette, J.A., 1994. Biology and control of tabanids, stable flies and horn flies. Rev. Sci. Tech. 13, 1125e1158. Foil, L.D., Younger, C.D., 2006. Development of treated targets for controlling stable flies (Diptera: Muscidae). Vet. Parasitol. 137, 311e315. Fournier, D., Bride, J.M., Hoffmann, F., Karch, F., 1992. Acetylcholinesterase. Two types of modifications confer resistance to insecticide. J. Biol. Chem. 267, 14270e14274. Fukuto, T.R., 1971. Relationships between the structure of organophosphorus compounds and their activity as acetylcholinesterase inhibitors. Bull. World Health Organ. 44, 31e42. Fukuto, T.R., 1990. Mechanism of action of organophosphate and carbamate insecticides. Environ. Health Perspect. 87, 245e254. Garmaise, D.L., Chambers, C.H., Komlossy, J., McCrae, R.C., 1967. Anthelmintic quaternary salts. Thiacyanines and hemithiacyanines. J. Med. Chem. 10, 897e899. Garmaise, D.L., Paris, G.Y., Komlossy, J., Chambers, C.H., McCrae, R.C., 1969. Anthelmintic quaternary salts. 3. Benzothiazolium salts. J. Med. Chem. 12, 30e36. Gassel, M., Cramer, J., Kern, C., Noack, S., Streber, W., 2009. Lessons learned from target-based lead discovery. In: Selzer, Paul M. (Ed.), Antiparasitic and Antibacterial Drug Discovery: from Molecular Targets to Drug Candidates. WileyVCH Verlag GmbH & Co KGaA, Weinheim, Germany. Gerolt, P., 1969. Mode of entry of contact insecticides. J. Insect Physiol. 15, 563e580. Gnagey, A.L., Forte, M., Rosenberry, T.L., 1987. Isolation and characterization of acetylcholinesterase from Drosophila. J. Biol. Chem. 262, 13290e13298. Graf, J.-F., 1993. The role of insect growth regulators in arthropod control. Parasitol. Today 9, 471e474. Green, M.R., 1978. Simultaneous differential staining of phosphoproteins, sialoglycoproteins, hyaluronic acid, sulfated glycosaminoglycans, proteins, and nucleic acids in human breast tissue with a cationic carbocyanine dye. J. Natl. Cancer Inst. 61, 951e960. Guglielmone, A.A., Volpogni, M.M., Quaino, O.R., Anziani, O.S., Mangold, A.J., 2004. Abundance of stable flies on heifers treated for control of horn flies with organophosphate impregnated ear tags. Med. Vet. Entomol. 18, 10e13. Hall, M., Wall, R., 1995. Myiasis of humans and domestic animals. Adv. Parasitol. 35, 257e334. Hansch, C., Deutsch, E.W., 1966. The use of substituent constants in the study of structureeactivity relationships in cholinesterase inhibitors. Biochim. Biophys. Acta 126, 117e128. Hartley, C.J., Newcomb, R.D., Russell, R.J., Yong, C.G., Stevens, J.R., Yeates, D.K., La Salle, J., Oakeshott, J.G., 2006. Amplification of DNA from preserved specimens shows blowflies were preadapted for the rapid evolution of insecticide resistance. Proc. Natl. Acad. Sci. U.S.A. 103, 8757e8762. Hillerton, J.E., Bramley, A.J., Thomas, G., 1990. The role of Hydrotaea irritans in the transmission of summer mastitis. Br. Vet. J. 146, 147e156. Hollingworth, R.M., 1971. Comparative metabolism and selectivity of organophosphate and carbamate insecticides. Bull. World Health Organ. 44, 155e170. Huchard, E., Martinez, M., Alout, H., Douzery, E.J., Lutfalla, G., Berthomieu, A., Berticat, C., Raymond, M., Weill, M., 2006. Acetylcholinesterase genes within the Diptera: takeover and loss in true flies. Proc. Biol. Sci. 273, 2595e2604. Hussain, A., Schurman, P., 1969. Thiol esters I: kinetic study of the formation of 2-dimethylaminoethanethiol propionate. J. Pharm. Sci. 58, 684e687. Ilg, T., Schmalz, S., Werr, M., Cramer, J., 2010. Acetylcholinesterases of the cat flea Ctenocephalides felis: identification of two distinct genes and biochemical characterization of recombinant and in vivo enzyme activities. Insect Biochem. Mol. Biol. 40, 153e164. Kamoshita, K., Ohno, I., Fujita, T., Nishioka, T., Nakajima, M., 1979. Quantitative structureeactivity relationships of phenyl N-methylcarbamates against house fly and its acetylcholinesterase. Pestic. Biochem. Physiol. 11, 83e102.

T. Ilg et al. / Insect Biochemistry and Molecular Biology 41 (2011) 470e483 Kasagami, T., Miyamoto, T., Yamamoto, I., 2002. Activated transformations of organophosphorus insecticides in the case of non-AChE inhibitory oxons. Pest Manag. Sci. 58, 1107e1117. Kim, C.S., Kim, W.T., Boo, K.S., Kim, S.I., 2003. Cloning, mutagenesis, and expression of the acetylcholinesterase gene from a strain of Musca domestica; the change from a drug-resistant to a sensitive enzyme. Mol. Cells 15, 208e215. Knipling, E.F., McDuffie, W.C., 1957. Controlling flies on dairy cattle and in dairy barns. Bull. World Health Organ. 16, 865e870. Kozaki, T., Shono, T., Tomita, T., Kono, Y., 2001. Fenitroxon insensitive acetylcholinesterases of the housefly, Musca domestica associated with point mutations. Insect Biochem. Mol. Biol. 31, 991e997. Kozaki, T., Brady, S.G., Scott, J.G., 2009. Frequencies and evolution of organophosphate insensitive acetylcholinesterase alleles in laboratory and field populations of the house fly Musca domestica L. Pestic. Biochem. Physiol. 95, 6e11. Kristensen, M., Knorr, M., Spencer, A.G., Jespersen, J.B., 2000. Selection and reversion of azamethipos-resistance in a field population of the housefly Musca domestica (Diptera: Muscidae), and the underlying biochemical mechanisms. J. Econ. Entomol. 93, 1788e1795. Kristensen, M., 2005. Glutathione S-transferase and insecticide resistance in laboratory strains and field populations of Musca domestica. J. Econ. Entomol. 98, 1341e1348. Kristensen, M., Huang, J., Qiao, C.L., Jespersen, J.B., 2006. Variation of Musca domestica L. acetylcholinesterase in Danish housefly populations. Pest Manag. Sci. 62, 738e745. Kristensen, M., Jespersen, J.B., 2008. Susceptibility to thiamethoxam of Musca domestica from Danish livestock farms. Pest. Manag. Sci. 64, 126e132. Krupka, R.M., Hellenbrand, K., 1974. Specific versus non-specific interactions of mammalian and insect acetylcholinesterase with substrates and reversible inhibitors. Biochim. Biophys. Acta 370, 208e215. Kunz, S.E., 1987. Integrated pest management of dipteran pests in the New World. Int. J. Parasitol. 17, 659e664. Li, A.Y., Guerrero, F.D., Pruett, J.H., 2007. Involvement of esterases in diazinon resistance and biphasic effects of piperonyl butoxide on diazinon toxicity to Haematobia irritans irritans (Diptera: Muscidae). Pestic. Biochem. Physiol. 87, 147e155. Lotti, M., Moretto, A., 2005. Organophosphate-induced delayed polyneuropathy. Toxicol. Rev. 24, 37e49. Malacrida, A.R., Gomulski, L.M., Bonizzoni, M., Bertin, S., Gasperi, G., Guglielmino, C.R., 2007. Globalization and fruitfly invasion and expansion: the medfly paradigm. Genetica 131, 1e9. Mälkiä, A., Murtomäki, L., Urtti, A., Kontturi, K., 2004. Drug permeation in biomembranes: in vitro and in silico prediction and influence of physicochemical properties. Eur. J. Pharm. Sci. 23, 13e47. Malik, A., Singh, N., Satya, S., 2007. House fly (Musca domestica): a review of control strategies for a challenging pest. J. Environ. Sci. Health B 42, 453e469. Markussen, M.D.K., Kristensen, M., 2010. Cytochrome P450 monooxygenasemediated neonicotinoid resistance in the house fly Musca domestica L. Pestic. Biochem. Physiol. 98, 50e58. McLeod, R.S., 1995. Costs of major parasites to the Australian livestock industries. Int. J. Parasitol. 25, 1363e1367. Metcalf, R.L., 1971. Structureeactivity relationships for insecticidal carbamates. Bull. World Health Organ. 44, 43e78. Miller, J.A., Oehler, D.D., 1988. A reservoir neckband system for delivery of organophosphorus insecticides to cattle. J. Control. Release 8, 73e78. Miller, J.A., 1987. New approaches to the chemical control of arthropod pests of livestock. Int. J. Parasitol. 17, 689e693. Mohamed, T., Rao, P.P., 2010. Design, synthesis and evaluation of 2,4-disubstituted pyrimidines as cholinesterase inhibitors. Bioorg. Med. Chem. Lett. 20, 3606e3609. Mutero, A., Pralavorio, M., Bride, J.M., Fournier, D., 1994. Resistance-associated point mutations in insecticide-insensitive acetylcholinesterase. Proc. Natl. Acad. Sci. U.S.A. 91, 5922e5926. Nair, H.K., Seravalli, J., Arbuckle, T., Quinn, D.M., 1994. Molecular recognition in acetylcholinesterase catalysis: free-energy correlations for substrate turnover and inhibition by trifluoro ketone transition-state analogs. Biochemistry 33, 8566e8576. Newcomb, R.D., Campbell, P.M., Ollis, D.L., Cheah, E., Russell, R.J., Oakeshott, J.G., 1997. A single amino acid substitution converts a carboxylesterase to an organophosphorus hydrolase and confers insecticide resistance on a blowfly. Proc. Natl. Acad. Sci. U.S.A. 94, 7464e7468. Nishioka, T., Fujita, T., Kamoshita, K., Nakajima, M., 1977. Mechanism of inhibition reaction of acetylcholinesterase by phenyl N-methylcarbamates. Pestic. Biochem. Physiol. 7, 107e121. Otranto, D., 2001. The immunology of myiasis: parasite survival and host defense strategies. Trends Parasitol. 17, 176e182. Otranto, D., Traversa, D., 2005. Thelazia eyeworm: an original endo- and ectoparasitic nematode. Trends Parasitol. 21, 1e4. Oyarzún, M.P., Quiroz, A., Birkett, M.A., 2008. Insecticide resistance in the horn fly: alternative control strategies. Med. Vet. Entomol. 22, 188e202.

483

Peter, R.J., Van den Bossche, P., Penzhorn, B.L., Sharp, B., 2005. Tick, fly, and mosquito control e lessons from the past, solutions for the future. Vet. Parasitol. 132, 205e215. Presley, S.M., Knapp, F.W., Boling, J.A., Burg, J.G., 1996. Effects of the horn fly (Diptera: Muscidae) on physiological and nutritional responses of beef steers: continuous fly population levels. J. Econ. Entomol. 89, 138e143. Pridgeon, J.W., Becnel, J.J., Clark, G.G., Linthicum, K.J., 2009. A high-throughput screening method to identify potential pesticides for mosquito control. J. Med. Entomol. 46, 335e341. Reichard, R., 1999. Case studies of emergency management of screwworm. Rev. Sci. Tech 18, 145e163. Sambrook, J., Russell, D.W., 2001. Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Saxena, A., Redman, A.M., Jiang, X., Lockridge, O., Doctor, B.P., 1997. Differences in active site gorge dimensions of cholinesterases revealed by binding of inhibitors to human butyrylcholinesterase. Biochemistry 36, 14642e14651. Scott, J.G., 1999. Cytochromes P450 and insecticide resistance. Insect Biochem. Mol. Biol. 29, 757e777. Seelig, A., 2007. The role of size and charge for bloodebrain barrier permeation of drugs and fatty acids. J. Mol. Neurosci. 33, 32e41. Senapati, S., Bui, J.M., McCammon, J.A., 2005. Induced fit in mouse acetylcholinesterase upon binding a femtomolar inhibitor: a molecular dynamics study. J. Med. Chem. 48, 8155e8162. Soderlund, D.M., 2008. Pyrethroids, knockdown resistance and sodium channels. Pest Manag. Sci. 64, 610e616. Stevens, J.R., Wallman, J.F., 2006. The evolution of myiasis in humans and other animals in the Old and New Worlds (part I): phylogenetic analyses. Trends Parasitol. 22, 129e136. Stevens, J.R., Wallman, J.F., Otranto, D., Wall, R., Pape, T., 2006. The evolution of myiasis in humans and other animals in the Old and New Worlds (part II): biological and life-history studies. Trends Parasitol. 22, 181e188. Syvanen, M., Zhou, Z., Wharton, J., Goldsbury, C., Clark, A., 1996. Heterogeneity of the glutathione transferase genes encoding enzymes responsible for insecticide degradation in the housefly. J. Mol. Evol. 43, 236e240. Székács, A., Halarnkar, P.P., Olmstead, M.M., Prag, K.A., Hammock, B.D., 1990. Heterocyclic derivatives of 3-substituted-1,1,1-trifluoro-2-propanones as inhibitors of esterolytic enzymes. Chem. Res. Toxicol. 3, 325e332. Taylor, P., Radi c, Z., 1994. The cholinesterases: from genes to proteins. Annu. Rev. Pharmacol. Toxicol. 34, 281e320. Tellam, R.L., Bowles, V.M., 1997. Control of blowfly strike in sheep: current strategies and future prospects. Int. J. Parasitol. 27, 261e273. Temeyer, K.B., Li, A.Y., Lohmeyer, K.H., Chen, A.C., Olafson, P.U., Sanson, D.W., Foil, L.D., 2008. Acetylcholinesterase mutation in diazinon-resistant Haematobia irritans (L.) (Diptera: Muscidae). Vet. Parasitol. 154, 300e310. Thomas, G., Jespersen, J.B., 1994. Non-biting Muscidae and control methods. Rev. Sci. Tech. 13, 1159e1173. Tietjen, K., Drewes, M., Stenzel, K., 2005. High throughput screening in agrochemical research. Comb. Chem. High Throughput Screen. 8, 589e594. Tikole, S., Sankararamakrishnan, R., 2006. A survey of mRNA sequences with a nonAUG start codon in RefSeq database. J. Biomol. Struct. Dyn. 24, 33e42. Titchener, R.N., 1986. Insecticidal ear tags control cattle ectoparasites. Parasitol. Today 2, 26e27. Traversa, D., Otranto, D., Iorio, R., Carluccio, A., Contri, A., Paoletti, B., Bartolini, R., Giangaspero, A., 2008. Identification of the intermediate hosts of Habronema microstoma and Habronema muscae under field conditions. Med. Vet. Entomol. 22, 283e287. Vandekar, M., Plestina, R., Wilhelm, K., 1971. Toxicity of carbamates for mammals. Bull. World Health Organ. 44, 241e249. Walkden-Brown, S.W., Daly, B.L., Colditz, I.G., Crook, B.J., 2000. Role of anorexia in mediating effects of blowfly strike on wool. Asian-Aus. J. Anim. Sci. 13 (Suppl. B), 76e79. Wall, R., French, N.P., Fenton, A., 2000. Sheep blowfly strike: a model approach. Res. Vet. Sci. 69, 1e9. Walsh, S.B., Dolden, T.A., Moores, G.D., Kristensen, M., Lewis, T., Devonshire, A.L., Williamson, M.S., 2001. Identification and characterization of mutations in housefly (Musca domestica) acetylcholinesterase involved in insecticide resistance. Biochem. J. 359, 175e181. Wardhaugh, K.G., 2005. Insecticidal activity of synthetic pyrethroids, organophosphates, insect growth regulators, and other livestock parasiticides: an Australian perspective. Environ. Toxicol. Chem. 24, 789e796. Yamada, M., Marui, Y., Hayashi, C., Takemura, S., 1987. Benzoylthiocholine derivatives as substrates for pseudocholinesterase: synthesis and application. Chem. Pharm. Bull. 35, 1491e1496. Zhang, J.H., Chung, T.D., Oldenburg, K.R., 1999. A simple statistical parameter for use in evaluation and validation of high throughput screening assays. J. Biomol. Screen. 4, 67e73. Zhao, P., Zhu, K.Y., Jiang, H., 2010. Heterologous expression, purification, and biochemical characterization of a greenbug (Schizaphis graminum) acetylcholinesterase encoded by a paralogous gene (ace-1). J. Biochem. Mol. Toxicol 24, 51e59.