- Email: [email protected]
The cloning and characterization of a DEAD-Box RNA helicase from stress-responsive wheat
Physiological and Molecular Plant Pathology 88 (2014) 36e42
Contents lists available at ScienceDirect
Physiological and Molecular Plant Pathology journal homepage: www.elsevier.com/locate/pmpp
The cloning and characterization of a DEAD-Box RNA helicase from stress-responsive wheat Xin-mei Zhang a, Xiao-qiong Zhao a, Chuan-xin Feng a, Na Liu a, Hao Feng b, Xiao-jie Wang b, Xiao-qian Mu a, Li-li Huang b, Zhen-sheng Kang b, * a
College of Life Science, Northwest A&F University, Yangling 712100, Shaanxi, People's Republic of China State Key Laboratory of Crop Stress Biology for Arid Areas and College of Plant Protection, Northwest A&F University, Yangling 712100, Shaanxi, People's Republic of China b
a r t i c l e i n f o
a b s t r a c t
Article history: Accepted 28 July 2014 Available online 2 September 2014
DEAD-box RNA helicases play important roles in all types of processes in RNA metabolism. This report characterizes a stress-responsive transcript termed TaRH1 (Triticum aestivum RNA helicase) that encodes a putative ATP-dependent RNA helicase and is a member of the DEAD-box family. Quantitative real-time PCR (qRT-PCR) analysis indicated that the TaRH1 gene was differentially expressed under both biotic and several abiotic stresses. The characteristics are given of the TaRH1-catalysed unwinding of duplex RNA following TaRH1 expression in Escherichia coli BL 21. These results suggest that the TaRH1 gene may participate in the plant stress response. © 2014 Elsevier Ltd. All rights reserved.
Keywords: Wheat DEAD-Box RNA helicase Stress response Puccinia striiformis f. sp. tritici
Introduction Adaptation is a way of life for sessile and poikilothermic land plants which must withstand environmental stressors including those caused by low/high temperatures, water deficits, and salinity. These abiotic stresses not only limit the geographical distribution of plants but also reduce the global productivity and quality of important agricultural crops [1]. Plants, unlike animals, are sessile during their growth and development and are unable to avoid unfavourable environmental conditions. Plants have developed a complex, accurately regulated defence network to combat pathogens and, more broadly, to adapt to a variety of abiotic and biotic stresses in unfavourable environments. Plants rely on the innate immunity of each cell and on systemic signals emanating from infection sites because of their lack of mobile defender cells or a somatic adaptive immune system [2]. In particular, plant responses to invading pathogens involve a complex network of defence mechanisms in which thousands of
Abbreviation: DEAD-box, Asp-Glu-Ala-Asp box; qRT-PCR, quantitative reverse transcriptase PCR or quantitative real-time PCR; SF2, superfamily 2; dsRNA, doublestranded RNA; ssRNA, single-stranded RNA; TaRH1, Triticum aestivum RNA helicase; ETH, ethylene; SA, salicylic acid; EST, expressed sequence tag; cDNA, complementary DNA; RACE, rapid-amplification of cDNA ends; ORF, longest open reading frame. * Corresponding author. Tel.: þ86 13991886821 (mobile). E-mail address: [email protected] (Z.-s. Kang). http://dx.doi.org/10.1016/j.pmpp.2014.07.004 0885-5765/© 2014 Elsevier Ltd. All rights reserved.
genes are coordinately activated and integrated when pathogenassociated molecular patterns are recognized [3]. Plant responses to environmental stresses have been characterized by physiological and biochemical changes that result from a selective increase or decrease in the biosynthesis of a large number of distinct proteins that favour defence responses to pathogen attack. At present, some studies have demonstrated that the expression of some genes with regulatory functions such as transcription factors, protein kinases and phosphatases, RNA helicases, RNA-binding proteins, and calcium-binding proteins are altered during the defence response [4e6]. RNA helicases are molecular motors that unwind doublestranded RNA (dsRNA) thereby affecting the rearrangement of RNA secondary structure that is traditionally associated with the activation of RNA functions [7,8]. Genes that encode RNA helicases have been identified in all three kingdoms of life in addition to many viral genomes. RNA helicases are potentially associated with the entire lifespan of an RNA molecule. Nucleic acid helicases are broadly classified into six families. A large majority of RNA helicases belongs to superfamily 2 (SF2) which is comprised of five subfamilies, three of which are termed the DEAD, DEAH and DExH protein subfamilies after variations in the signature amino acid domain Asp-Glu-Ala-Asp [9e12]. The DEAD-box RNA helicases form a large family of proteins found in all eukaryotes and most prokaryotes and participate in many aspects of RNA metabolism [12,13]. For example, nearly 30 genes that encode DEAD-box RNA helicases were identified in the
X.-m. Zhang et al. / Physiological and Molecular Plant Pathology 88 (2014) 36e42
genomes of Caenorhabditis elegans and Drosophila melanogaster [14]. In Arabidopsis thaliana greater than 50 DEAD-box RNA helicases have been identified. Despite the involvement of DEAD-box RNA helicases in many diverse biological processes, their precise functions and regulation remain largely unclear. Most members of the DEAD-box family have a determined or putative ATPdependent RNA helicase activity, which modulates the RNA secondary and tertiary structure [7]. DEAD-box proteins typically act through the ATP-dependent unwinding of double-stranded RNA or by modulating RNA-protein interactions, thereby affecting the availability of RNAs for further processing [15e17]. Recent studies have provided new insights into the mechanism by which DEAD-box RNA helicases exert their biological functions [18e21]. The rice gene OsBIRH1 encodes a DEAD domain and all conserved motifs characteristic of DEAD-box RNA helicases. OsBIRH1 expression was activated in rice seedling leaves after treatment with defence-related signal chemicals. Additionally, it was up-regulated in an incompatible interaction between a resistant rice genotype and the blast fungus Magnaporthe grisea. OsBIRH1-overexpressing transgenic plants exhibited enhanced disease resistance to Alternaria brassicicola and Pseudomonas syringae pv. Tomato DC3000. The OsBIRH1 transgenic Arabidopsis plants also showed increased tolerance to oxidative stress and elevated expression levels of oxidative defence genes [2]. Increasing evidence shows that endogenous (rather than pathogenderived) sRNAs also have broad functions in regulating plant responses to various microbes [22]. One of the two Belle paralogues in yeast, called Ded1p, has been implicated in translation initiation, RNA unwinding, and the modulation of RNA-protein interactions all of which are closely connected to RNA-silencing machinery [8,23]. Additionally, a Belle's yeast orthologue was shown to localize and contribute to the formation of p-bodies and the cellular sites of mRNA degradation via RNA interference [24,25]. HVD1, a DEAD box RNA helicase, was cloned in salt-stressed barley. The HVD1 protein regulates the function of transcripts involved in salt tolerance and certain aspects of metabolism such as photosynthesis [19,26]. We report on a stress-responsive gene that was isolated from wheat which encodes a putative ATP-dependent RNA helicase that is a member of the DEAD-box family. Stripe rust, which is caused by Puccinia striiformis f. sp. Tritici (Pst), is one of the most damaging wheat diseases throughout the world [27]. In elucidating the molecular regulatory mechanisms of plant defence against Pst in wheat, we identified a gene that is a positive regulator during the defence response, which was designated as TaRH1 (KJ704992). The TaRH1 gene encodes a DEAD-box RNA helicase. In this study, we present the isolation of TaRH1's full-length cDNA sequence, molecular characterisation, expression profiles in response to Pst infection, abiotic elicitors, and ATP-dependent RNA helicase activities in vitro. Materials and methods Plant materials, inoculation, and treatments In this study, the biological materials consist of two Pst pathotypes, namely CYR23 and CYR31, and the wheat (Triticum aestivum L.) genotype Suwon 11 which contains the stripe rust resistance gene YrSu [28]. Suwon 11 is highly resistant to CYR23 (incompatible reaction) and highly susceptible to CYR31 (compatible interaction). The specific procedure under which the wheat was grown, inoculated, and harvested is described by Xia et al. [29]. Two-week-old wheat seedlings were also treated with different stress elicitors as previously described. For drought and salinity treatments roots were submerged in an aqueous solution of 20% PEG6000 and 200 mM NaCl, respectively. The hormone treatments
37
included ABA, ETH (ethylene), MeJA, and SA (salicylic acid). These procedures for various stress treatments and for sample preparation are detailed by Feng et al. [30]. Three independent biological replications were performed for each treatment. RNA extraction and cDNA synthesis The extraction of total RNA was conducted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. The quality and integrity of the total RNA were determined by running a formamide denaturing gel electrophoresis, and the quantity was tested with a NanoDrop-1000 spectrophotometer (Thermo Fisher Scientific, USA). The first-strand cDNA was synthesised with a RT-PCR system (MBI Fermentas, USA) by following the manufacturer's instructions [29,30]. Cloning TaRH1 and sequence analyses To identify the TaRH1 gene in silico cloning was performed as previously described by Zhang et al. [31]. The two ESTs were integrated into the 1867 bp section through CAP3. The longer sequence of the TaRH1 wheat gene that was retrieved from GenBank was initially used as the query probe to screen the wheat EST database in GenBank using a BLASTN analysis. Homologous wheat EST sequences were extracted and assembled, followed by the confirmation of the in silico-cloned gene using BLASTX analysis. The EST of TaRH1 has high homology with the HVD1 in barley. Therefore, the cloned DEAD helicase gene in wheat cultivar Suwon 11 was named TaRH1 (T. aestivum RNA helicase). To obtain the entire TaRH1 sequence, a pair of primers called fp (50 -ATGGAAACTCTACGTG-30 ) and rp (50 -GGCAGGCTTGACATTCGT-30 ) was used to amplify the 433 bp EST containing the 50 -terminal of the candidate TaRH1 gene. To obtain the full-length cDNA of TaRH1, the 30 RACE primer GGGATGCAGACGAGGTATCATTGGC was designed on the basis of the 30 terminus of the 1867 bp EST sequence, and PCR (30 RACE-PCR) was performed for the 30 rapid-amplification of cDNA ends using a SMART RACE cDNA Amplification Kit (Clontech, USA). The template was a mixture of the first-strand cDNA in leaf samples that were harvested at 12, 24, and 48 hpi from the incompatible combination. The 50 TaRH1 fragment was cloned through a comparative genome, and the primer was designed using the barley HVD1 sequence. The PCR products were cloned into a pGEM-T Easy Vector (Promega, Madison, WI, USA) and sequenced with an ABI PRISM 3130XL Genetic Analyzer (Applied Biosystems, USA). The protein sequence was analysed with the relevant online software from InterProScan (http://www.ebi.ac.uk/InterProScan). The deduced amino acid sequence of TaRH1 was aligned with that of other RNA helicase genes from Arabidopsis, barley, chickpea, petunia, potato, rape, rice, soybean, tobacco, and wheat, among others, using the MegAlign programme in a Lasergene software package from DNASTAR (Madison, WI, USA). A phylogenetic neighbour-joining tree was generated for these DEAD-box RNA helicase genes with MEGA software (version 5.2) according to the full-length proteins from different RNA helicase. The subcellular localization of TaRH1 was predicted with WoLF PSORT software. qRT-PCR analyses The expression profiles of TaRH1 after Pst infection were determined by qRT-PCR analyses. A 1 mg quantity of total RNA was used to synthesize the first-strand cDNA with a Maxima first-strand cDNA synthesis kit (Fermentas) as described. qRT-PCR primers (TaRH1-fp 50 -AAAGGATTTGCTTACTATGGAACTG -30 and TaRH1-rp 50 -TCGCACCACCACCTGAAAA -30 ) were used to amplify a 192 bp
38
X.-m. Zhang et al. / Physiological and Molecular Plant Pathology 88 (2014) 36e42
region, and the amplified product was confirmed by sequencing analysis. The wheat elongation factor TaEF-1a (GenBank accession number Q03033) was used as a reference gene. The TaRH1 expression levels were quantified by relative qRT-PCR. To exhibit the expression pattern clearly, we normalized to the control (0 h) for the different treatments. The concrete procedures for qRT-PCR and data processing are described by Feng et al. [30].
described to convert the output data from volts to the fraction of unwound RNA. All indicated concentrations were present after mixing unless otherwise noted.
Purifying recombinant TaRH1 protein
To isolate a novel RNA helicase gene from wheat, we first conducted in silico cloning and RT-PCR to identify the candidate fragment. By using the cDNA sequence of the wheat RNA helicase gene as a query probe, a 783 bp cDNA sequence was identified in silico and used to predict an encoded DEAD-box RNA helicase protein that was highly homologous to the barley HVD1 protein. The fp/rp primer pair was used in RT-PCR to obtain a 433 bp cDNA sequence that was confirmed by analysing the sequence that contained the 50 terminus. Next, 30 RACE-PCR was performed on the basis of the 433 bp fragment, and the 1800 bp cDNA fragment was obtained. Lastly, the two sequences were assembled into a 1996 bp consensus sequence using the CAP3 program. The assembled sequence contained a poly-A signal region in the 30 UTR. DNAMAN alignment analysis revealed that the predicted protein was encoded by the longest open reading frame (ORF) of the assembled sequence, and it shared 67.62% similarity with the HVD1 protein. The clone is 1996 bp long with a 1653 bp open reading frame encoding a peptide of 551 amino acids. The predicted molecular mass of the polypeptide is 59.4 kDa. A comparison of the TaRH1 amino acid sequence with that of known proteins demonstrates homology with the ATP-dependent RNA helicase members of the DEAD-box family (Fig. 1). The TaRH1 protein has each of the eight consensus motifs that are normally found in the members of this family. TaRH1 is predicted to localize to the mitochondria accordiner to the Target P program (http://www.cbs.dtu.dk/ services/TargetP). A phylogenetic analysis suggests that TaRH1 may have a similar function to that of HVD1 (Fig. 2).
The TaRH1 coding region was released from pUCm-TaRH1 by digesting the plasmid with BamHI/HindIII and cloning it into the pGEX4T-1 vector, which was introduced into Escherichia coli strain BL21 plus (DE3) cells. The total proteins were induced by 1 mM isopropyl-D-thiogalactoside at 18 C for 6 h. TaRH1 fusion protein purification was performed with a His-Bind Kit (Nova-Gen, Madison, WI, USA) by following the manufacturer's instructions. The protein concentration was determined with a Bio-Rad protein assay kit (Bio-Rad, Hercules, CA, USA) by following the recommended method. The purified E. coli TaRH1 protein was suspended in storage buffer (25 mM TriseHCl, pH 7.4, 50 mM NaCl, 3 mM MgCl2, and 2 mM dithiothreitol) at 80 C. Preparing short double-stranded RNA substrates The RNA substrates that were used for helicase assays were prepared as described. Two double-stranded RNA molecules with different duplex sizes were synthesised in vitro by the TaKaRa Company. The nucleotide sequences of the two RNA strands were as follows: 42nt strand, 50 -GGGGAGAAAAACAAAACAAAACAAAACAAAACACCGUAAAGC-30 of which the 30 terminus was labelled with fluorescein isothiocyanate (FITC), and 10nt strand, 50 GCUUUACGGU-30 , of which the 50 terminus was labelled with 50 hexachlorofluorescein phosphoramidite (HEX) (duplex regions underlined). The underline indicates complementary sequences in the annealing process. The synthesised transcripts were annealed, resulting in a partial duplex of 10 bp. All of the synthetic oligonucleotides were purified by high-pressure liquid chromatography before storage in 10 mM TriseHCl (pH 8.0), 1 mM EDTA at 20 C. Stopped-flow kinetics measurements The RNA helicase activity was measured and modified according to a previously reported method [32,33]. RNA unwinding assays were performed in reaction buffer containing 20 mM TriseHCl, pH 8.0, 60 mM NaCl, 1 mM MgCl2, 2 mM dithiothreitol, and 15U RNasin (Invitrogen). The unwinding buffer contained 20 mM TriseHCl, pH 8.0, 60 mM NaCl, 1 mM MgCl2, 2 mM dithiothreitol, and 15U RNasin. ATP was purchased from Sigma (USA) and dissolved as a concentrated stock at pH 7.0. The ATP concentration was determined using an extinction coefficient of 1.54 104 cm1 M1 at 259 nm. All of the RNA unwinding kinetic assays were performed using a Bio-Logic SFM-400 mixer with a 1.5 mm 1.5 mm cell (FC15, Bio-Logic) and a Bio-Logic MOS450/AF-CD optical system equipped with a 150 W mercuryexenon lamp. Fluorescein was excited at 492 nm (2 nm bandwidth), and its emission was monitored at 525 nm with a high-pass filter and a 20 nm bandwidth (D525/20, Chroma Technology Co., USA). All of the stopped-flow kinetic curves are averages of at least 10 individual traces. All of the assays were performed at 37 C. The unwinding kinetic assays were measured in a two-syringe mode in which TaRH1 helicase and RNA were pre-incubated at 37 C in syringe number 3 for 5 min while the ATP was in syringe number 4. Each syringe contained unwinding reaction buffer, and the unwinding reaction was initiated by rapid mixing. Calibration experiments were performed as
Results Cloning TaRH1, a wheat gene encoding a DEAD-box RNA helicase
Expression profiles of TaRH1 in the incompatible and compatible interactions TaRH1 expression patterns were determined in wheat leaves infected with P. striiformis pathotypes CYR23 and CYR31 for incompatible and compatible interactions, respectively, using qRTPCR (Fig. 3). These results showed the TaRH1 expression after the plants were inoculated within compatible interactions. However, TaRH1 expression increased by approximately 3-fold at 24 hpi in the incompatible interaction. Until 48 hpi, the transcription level increased to nearly 6-fold that of the control. The results showed that TaRH1 may positively regulate resistance in the wheat and pst interactions. TaRH1 expression under various stresses TaRH1 expression was also induced in response to several chemical treatments, including exposure to 20% PEG6000, high salinity, low temperature, and wounding (Fig. 4). Low temperatures increased TaRH1 transcription levels by approximately 6-fold at 2 hpt, and the TaRH1 levels continued to increase and decrease from 2 to 24 hpt. The TaRH1 transcription levels peaked (over 5-fold) as early as 6 hpt under high salinity (200 mM NaCl). The TaRH1 transcription level was not significantly affected by the PEG and wounding treatments. These results suggest that TaRH1 may play an important role in salt and cold stresses. qRT-PCR was performed to determine if the TaRH1 expression in wheat seedlings was induced by well-known disease resistancerelated signal molecules, such as ABA, ETH, MeJA, and SA. As
X.-m. Zhang et al. / Physiological and Molecular Plant Pathology 88 (2014) 36e42
39
Fig. 1. The structure of the TaRH1 protein. TaRH1 alignment with wheat TaRH3 (EMS 52116), TaIF4A (P41378), barley HVD1 (BAD21122), and Arabidopsis AtRH (NP_188870). The conserved motifs are indicated by short thick lines.
presented in Fig. 5, SA treatment led to rapidly induced expression of TaRH1 within 2 h and was maintained at a relatively higher level for 2e6 h after treatment. The ETH treatment significantly increased the TaRH1 expression level, peaking at 48 hpt (approximately threefold). By contrast, MeJA and ABA treatments had no significant effect on TaRH1 expression. These results suggest that
Fig. 2. A phylogenetic tree analysis of TaRH1 with DEAD-box helicase proteins from other organisms. The phylogenetic trees were constructed using the Neighbour-Joining method, and the genetic distances were calculated with the Kimura two-parameter model. The bootstrap values from 1000 replicates were used to assess the robustness of the trees. The selected DEAD-box RNA helicase proteins were Triticum aestivum TaIf4A (P41378), Triticum urartu RH3 (EMS52116), Hordeum vulgare RH1, namely HVD1 (BAD21122), Arabidopsis thaliana RH (NP_188870), Arabidopsis thaliana LOS4 (AAP68306), Oryza sativa RH50 (Q0DVX2.2), Zea mays DRH1 (AAR29370), Zea mays RH2 (ACG27839), Theobroma cacao RH53 (Eox93041), and Brachypodium distachyon RH3 (XP_003563192).
Fig. 3. TaRH1 expression patterns in wheat leaves after inoculating with CYR23 and CYR31. The relative expression of the TaRH1 gene was calculated using the transcript levels from pathogen-infected tissues and then compared with that of mock controls across all of the time points. The data were normalised to TaEF expression levels, and the error bars represent variations between three independent biological replicates.
40
X.-m. Zhang et al. / Physiological and Molecular Plant Pathology 88 (2014) 36e42
Fig. 4. TaRH1 gene expression in wheat leaves under abiotic treatments. The environmental stimuli included 20% PEG6000, high salinity (200 mM NaCl), low temperature (4 C), and wounding. The mean values and standard errors (bar) from three independent experiments are indicated.
TaRH1 might be related to SA- and ETH- dependent defence signalling pathways. Identifying the ATP-dependent unwinding of duplex RNA in vitro In this work, we studied the RNA unwinding kinetic mechanism of the helicase TaRH1 protein using stopped-flow assays (Fig. 6). RNA helicases are a class of enzymes that use energy derived from ATP hydrolysis to unwind double-stranded RNAs. The experiment was performed with 32nt-tailed ssRNA/dsRNA. In the present study, we used fluorometric assays to study the BLM-catalysed unwinding of duplex RNA in real time under various experimental conditions. The two fluorescent molecules were in close proximity before RNA unwinding, and the fluorescein emission was low because of the FRET between the two molecules. The fluorescein emission was enhanced when unwinding was initiated because of the disruption in the FRET as the two molecules were separated. Thus, the fluorescein emission change was monitored to observe the unwinding process. The results showed a weak RNA duplex unwinding efficiency. It is possible that unwinding requires some functional interactions between the protein molecules that could enhance the RNA unwinding efficiency in vitro. These results clearly indicate that TaRH1 has ATP-dependent RNA helicase activity. Discussion Plants exhibit diverse adaptation levels to biotic and abiotic stresses to survive Most of these adaptations involve some regulation of gene expression and enzyme activities [20]. Several genes, including helicases, are induced by various stresses. RNA helicases are encoded in essentially every organism ranging from viruses to humans. They perform essential roles in potentially any cellular function involving RNA metabolism [13]. Although a number of these functions have been documented with respect to housekeeping activities, the importance of the stress-induced alteration of RNA helicase expression and activity is only now becoming evident. RNA helicases function in the cellular response to these stress stimuli through alterations in nuclear mRNA export, translation initiation, mRNA decay, rRNA processing, cell cycle progression, transcription, and helicase subcellular localization [13,34]. Therefore, RNA helicases could play an important role in regulating plant growth and development under stress conditions by regulating some stress-induced pathways. The involvement and significance of RNA helicases in response to biotic and abiotic stresses have only recently begun to emerge [35,36]. In the present study, a new gene was cloned and identified
as a DEAD box RNA helicase similar to HVD1, which was designated TaRH1. Primer sequences have indicated that TaRH1 must be an orthologue of a GenBank entry (AK335104). In the NCBI database, AK335104 is 2801 bp in length, and the longest ORF is 1851 bp (from 467 bp to 2317 bp). This gene encoded the 616 amino acid protein. The similarity between TaRH1 (551 AA) and AK335104 (616 AA) is 28.24% by DNAMAN alignment, and AK335104 (616 AA) and HVD1 (764 AA) shared 44.15% similarity. The TaRH1, which is a new DEAD-box RNA helicase gene, is different from AK335104. The TaRH1 expression profiles of incompatible and compatible interactions showed that it may positively regulate resistance in wheat and pst interactions. The rice OsBIRH1 gene encodes a DEADbox RNA helicase with ATP-dependent RNA helicase activities. Studies have shown that OsBIRH1 plays important roles in oxidative stress tolerance and disease resistance response, as revealed by its inducible expression by pathogen infection and multiple defence signal molecules [2]. The results not only extend our knowledge of the biological function of DEAD-box RNA helicases but also provide new clues to exploring the significance of RNA helicase-mediated RNA metabolism in the regulation of plant defence responses. In the four abiotic stresses tested including salt, cold, wounding and PEG, TaRH1 mRNA was accumulated from salt stress and cold stress with the same expression pattern. The results are identical to the expression pattern of HVD1, which encodes a salt-induced ATPdependent DEAD-box RNA helicase in barley [19]. HVD1 transcript accumulation was induced under salt stress, cold stress and ABA treatment. When subjected to salt stress, the intracellular salt concentration rises either by dehydration or by salt influx. In saltstressed rice, Osa-MIR414, osa-MIR164e and osa-MIR408 were experimentally validated for the first time in plants for targeting the OsABP, OsDBH and OsDSHCT genes, respectively. These genes were up-regulated, and their corresponding miRNAs were downregulated in response to salt stress. In E. coli, csdA encodes a DEAD-box RNA helicase, and its expression was induced when the culture temperature decreased from 37 C to 15 C [37]. The LOS4 gene was recently reported to encode an RNA helicase that plays an important role in regulating CBF genes in relation to chilling and freezing tolerance in plants [38]. Nevertheless, the LOS4 protein is localized to the nucleus, and the gene is not induced by salt stress [39]. In E. coli, cold shock induces a ribosomal-associated DEAD-box protein. STRS1 and STRS2 were down-regulated by multiple abiotic stresses, including salt, drought, and heat stress, but both attenuated the abiotic stress tolerance [40]. ABO6, a DEXH box RNA helicase, is involved in reactive oxygen species production in mitochondria during Arabidopsis-mediated crosstalk between abscisic acid and auxin signalling [41]. All evidence suggests that
X.-m. Zhang et al. / Physiological and Molecular Plant Pathology 88 (2014) 36e42
41
Fig. 5. TaRH1 gene expression in wheat leaves under different hormone treatments. The leaves were exogenously sprayed with the hormones SA (salicylic acid), ET (ethylene), MeJA (methyl jasmonate), and ABA (abscisic acid). The mean values and standard errors (bar) from three independent experiments are indicated.
DEAD-box proteins may be involved in adapting to various environmental stresses. We examined the expression patterns of TaRH1 after the plants were treated with these signal molecules and found that TaRH1 was induced at relatively high levels by SA and MeJA. Thus, we propose that TaRH1 may be involved in the wheat defence response to Pst infection, putatively through the SA/MeJA-dependent signal transduction pathway. In barley, DEAD helicase HVD1 transcript accumulation was induced not only by salt stress and cold stress but also by ABA treatment [19]. Although OsBIRH1 has a relatively high level of basal expression, its expression was induced not only by pathogen infection but also by several disease resistance-related signalling molecules, including SA, JA, and ACC, suggesting a role for OsBIRH1 in disease resistance signalling pathways [2]. In plants, a number of genes will change their transcription upon any challenge from biotic and abiotic stresses. In order to research the rationale of working on the DEAD-Box gene TaRH1, the interacting protein with TaRH1 may be screened through yeast two-hybrid system. The similarity of TaRH1 and HVD1 is 67.62%. Thus, it is anticipated that the TaRH1 protein regulates the function of transcripts concerned with abiotic and biotic stresses, or important metabolic processes such as photosynthesis. Although a number of DEAD-box proteins and genes have been identified from various plants, most of the proteins have not been analysed for their biochemical activity in vitro. Biochemical activities characteristic of RNA helicases, namely RNA-dependent ATPase activity and RNA unwinding, have been demonstrated for a relatively small proportion of the RNA helicase-related sequences in public databases [36]. The TaRH1 protein expressed in E. coli possesses unwinding activity, but its efficiency is quite weak. It is
likely that the transit peptide of the pre-TaRH1 protein requires processing or some other factors for its enzymatic activity [19]. Arabidopsis LOS4 has RNA-dependent ATPase activity in vitro, and AtDRH1 possesses both ATP-dependent RNA helicase and RNAdependent ATPase activities [42,43]. The CrhC helicase purified from E. coli is an ATP-independent RNA-binding protein that possesses RNA-dependent ATPase activity, and it was stimulated most efficiently by rRNA and polysome preparations. RNA helicase activity proceeds from 50 -30 but not from 30 -50 . Immunoprecipitation and far-western blotting indicated that CrhC is a component of a multi-subunit complex, interacting specifically with a 37 kDa polypeptide [44]. The OsBIRH1 gene encodes a DEAD-box RNA helicase with RNA-dependent ATPase and ATP-dependent RNA helicase activities [2]. Overall, our data indicates that TaRH1 may be an important component in the defence-signalling pathway and may play a crucial role in wheat defence responses to abiotic and biotic stresses. TaRH1 regulates gene expression at the RNA level, and it may be related to photosynthesis under biotic and abiotic stresses. However, some questions must be resolved with regards to the biological function of TaRH1 and its mechanisms of action, including how TaRH1 protein regulates the expression of defencerelated genes in plants, what role TaRH1 may play in plant growth and development, and how TaRH1 operates different stress signalling pathways in various stresses. We are currently investigating the biological function of TaRH1 in wheat defence responses to Pst using overexpression and barley stripe mosaic virus-mediated virus-induced gene silencing. In addition, it would be valuable to elucidate both the biochemical and biological functions of TaRH1 with knockout or knockdown mutants in model plants. Acknowledgements This study was supported by grants from the National Basic Research Program of China (2013CB127700), the China Postdoctoral Science Foundation (2012M512035), Dr. Startup Funds (Z109021121) and the 111 Project from the Ministry of Education of China (B07049). We are grateful to Brice E. Floyd (Iowa State University) for critical modifying of the manuscript. References
Fig. 6. The dependence of RNA unwinding on [ATP] under multiple turnover conditions. The typical kinetic time-courses of TaRH1 unwinding at 1 or 0 mM ATP.
[1] Guan Q, Wu J, Zhang Y, Jiang C, Liu R, Chai C, et al. A DEAD box RNA helicase is critical for Pre-mRNA splicing, cold-responsive gene regulation, and cold tolerance in Arabidopsis. Plant Cell 2013;25:342e56. [2] Li D, Liu H, Zhang H, Wang X, Song F. OsBIRH1, a DEAD-box RNA helicase with functions in modulating defence responses against pathogen infection and oxidative stress. J Exp Bot 2008;59(8):2133e46. [3] Takken FL, Albrecht M, Tameling WI. Resistance proteins: molecular switches of plant defence. Curr Opin Plant Biol 2006;9:383e90.
42
X.-m. Zhang et al. / Physiological and Molecular Plant Pathology 88 (2014) 36e42
[4] Zhu J. Salt and drought stress signal transduction in plants. Annu Rev Plant Biol 2002;53:247e73. [5] Shinozaki K, Yamaguchi-Shinozaki K, Seki M. Regulatory network of gene expression in the drought and cold stress responses. Curr Opin Plant Biol 2003;6:410e7. [6] Yamaguchi-Shinozaki K, Shinozaki K. Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annu Rev Plant Biol 2006;57:781e803. [7] Chamot D, Colvin KR, Kujat-Choy SL, Owttrim GW. RNA structural rearrangement via unwinding and annealing by the cyanobacterial RNA helicase, CrhR. J Biol Chem 2005;280(3):2036e44. [8] Bleichert F, Baserga SJ. The long unwinding road of RNA helicases. Mol Cell 2007;27:339e52. [9] Linder P, Lasko PF, Ashburner M, Leroy P, Nielsen PJ, Nishi K, et al. Birth of the D-E-A-D box. Nature 1989;337:121e2. [10] Gustafson EA, Wessel GM. DEAD-box helicases: posttranslational regulation and function. Biochem Biophys Res Commun 2010;395:1e6. [11] Jankowsky E, Fairman ME. RNA helicases-one fold for many functions. Curr Opin Struct Biol 2007;17:316e24. [12] Cordin O, Banroques J, Tanner NK, Linder P. The DEAD-box protein family of RNA helicases. Gene 2006;367:17e37. [13] Rocak S, Linder P. DEAD-box proteins: the driving forces behind RNA metabolism. Nat Rev Mol Cell Biol 2004;5:232e41. [14] Boudet N, Aubourg S, Toffano-Nioche C, Kreis M, Lecharny A. Evolution of intron/exon structure of DEAD helicase family genes in Arabidopsis, Caenorhabditis, and Drosophila. Genome Res 2001;11:2101e14. [15] Jacobs Anderson JS, Parker R. RNA turnover: the helicase story unwinds. Curr Biol 1996;6(7):780e2. [16] Jankowsky E, Bowers H. Remodeling of ribonucleoprotein complexes with DExH/D RNA helicases. Nucleic Acids Res 2006;34(15):4181e8. [17] Singleton MR, Dillingham MS, Wigley DB. Structure and mechanism of helicases and nucleic acid translocases. Annu Rev Biochem 2007;76:23e50. [18] Chinnusamy V, Zhu J, Zhu J. Cold stress regulation of gene expression in plants. Trends Plant Sci 2007;12(10):444e51. [19] Nakamura T, Muramoto Y, Yokota S, Ueda A, Takabe T. Structural and transcriptional characterization of a salt-responsive gene encoding putative ATPdependent RNA helicase in barley. Plant Sci 2004;167:63e70. [20] Linder P, Owttrim GW. Plant RNA helicase: linking aberrant and silencing RNA. Trends Plant Sci 2009;14(6):344e52. €met M. RNA silencing in the antiviral innate immune [21] Ulvila J, Hultmark D, Ra defence- role of DEAD-box RNA helicases. Scand J Immunol 2010;71(3): 146e58. [22] Ruiz-Ferrer V, Voinnet O. Roles of plant small RNAs in biotic stress responses. Annu Rev Plant Biol 2009;60:485e510. [23] Chuang RY, Weaver PL, Liu Z, Chang T. Requirement of the DEAD-Box protein ded1p for messenger RNA translation. Science 1997;275:1468e71. [24] Iost I, Dreyfus M, Linder P. Ded1p, a DEAD-box protein required for translation initiation in Saccharomyces cerevisiae, is an RNA helicase. J Biol Chem 1999;274:17677e83. [25] Beckham C, Hilliker A, Cziko AM, Noueiry A, Ramaswami M, Parker R. The DEAD-box RNA helicase Ded1p affects and accumulates in Saccharomyces cerevisiae P-bodies. Mol Biol Cell 2008;19:984e93.
[26] Matsumoto T, Tanaka T, Sakai H, Amano N, Kanamori H, Kurita K, et al. Comprehensive sequence analysis of 24,783 barley full-length cDNAs derived from 12 clone libraries. Plant Physiol 2011;156:20e8. [27] Chen X. Epidemiology and control of stripe rust [Puccinia striiformis f. sp. tritici] on wheat. Can J Plant Pathol 2005;27:314e37. [28] Kang Z, Li Z. Discovery of a normal T. type new pathogenic strain to Lovrin10. J Northwest Agric For Univ Nat Sci Ed 1984;4:18e28. [29] Xia N, Zhang G, Sun Y, Zhu L, Xu L, Chen X, et al. TaNAC8, a novel NAC transcription factor gene in wheat, responds to stripe rust pathogen infection and abiotic stresses. Physiol Mol Plant Pathol 2010;74:394e402. [30] Feng H, Liu W, Zhang Q, Wang X, Wang X, Duan X, et al. TaMDHAR4, a monodehydroascorbate reductase gene participates in the interactions between wheat and Puccinia striiformis f. sp. Tritici. Plant Physiol Biochem 2014;76:7e16. [31] Zhang G, Dong Y, Zhang Y, Li Y, Wang X, Han Q, et al. Cloning and characterization of a novel hypersensitive-induced reaction gene from wheat infected by stripe rust pathogen. J Phytopathol 2009;157:722e8. [32] Yang Y, Dou S, Ren H, Wang P, Zhang X, Qian M, et al. Evidence for a functional dimeric form of the PcrA helicase in DNA unwinding. Nucleic Acids Res 2008;36(6):1976e89. [33] Yang Y, Dou S, Xu Y, Bazeille N, Wang P, Rigolet P, et al. Kinetic mechanism of DNA unwinding by the BLM helicase core and molecular basis for its low processivity. Biochemistry 2010;49:656e68. [34] Tanner NK, Linder P. DExD/H box RNA helicases: from generic motors to specific dissociation functions. Mol Cell 2001;8:251e62. [35] Vashisht AA, Tuteja N. Stress responsive DEAD-box helicases: a new pathway to engineer plant stress tolerance. J Photochem Photobiol B 2006;84:150e60. [36] Owttrim GW. RNA helicases and abiotic stress. Nucleic Acids Res 2006;34: 3220e30. [37] Turner AMW, Love CF, Alexander RW, Jones PG. Mutational analysis of the Escherichia coli DEAD box protein CsdA. J Bacteriol April 2007;189(7): 2769e76. [38] Gong Z, Lee H, Xiong L, Jagendorf A, Stevenson B, Zhu J. RNA helicase-like protein as an early regulator of transcription factors for plant chilling and freezing tolerance. Proc Natl Acad Sci U S A 2002;99:11507e12. [39] Py B, Higgins CF, Krisch HM, Carpousis AJ. A DEAD-box RNA helicase in the Escherichia coli RNA degradosome. Nature 1996;381:169e72. [40] Kant P, Kant S, Gordon M, Shaked R, Barak S. STRS1and STRS2, two DEAD-box RNA helicases that attenuate Arabidopsis responses to multiple abiotic stresses. Plant Physiol 2007;145:814e30. [41] He J, Duan Y, Hua D, Fan G, Wang L, Liu Y, et al. DEXH box RNA helicasemediated mitochondrial reactive oxygen species production in Arabidopsis mediates crosstalk between abscisic acid and auxin signaling. Plant Cell 2012;24(5):1815e33. [42] Okanami M, Meshi T, Iwabuchi M. Characterization of a DEAD box ATPase/ RNA helicase protein of Arabidopsis thaliana. Nucleic Acids Res 1998;26: 2638e43. [43] Gong Z, Dong CH, Lee H, Zhu J, Xiong L, Gong D, et al. A DEAD box RNA helicase is essential for mRNA export and important for development and stress responses in Arabidopsis. Plant Cell 2005;17:256e67. [44] Yu E, Owttrim GW. Characterization of the cold stress-induced cyanobacterial DEAD-box protein CrhC as an RNA helicase. Nucleic Acids Res 2000;28: 3926e34.
Contents lists available at ScienceDirect
Physiological and Molecular Plant Pathology journal homepage: www.elsevier.com/locate/pmpp
The cloning and characterization of a DEAD-Box RNA helicase from stress-responsive wheat Xin-mei Zhang a, Xiao-qiong Zhao a, Chuan-xin Feng a, Na Liu a, Hao Feng b, Xiao-jie Wang b, Xiao-qian Mu a, Li-li Huang b, Zhen-sheng Kang b, * a
College of Life Science, Northwest A&F University, Yangling 712100, Shaanxi, People's Republic of China State Key Laboratory of Crop Stress Biology for Arid Areas and College of Plant Protection, Northwest A&F University, Yangling 712100, Shaanxi, People's Republic of China b
a r t i c l e i n f o
a b s t r a c t
Article history: Accepted 28 July 2014 Available online 2 September 2014
DEAD-box RNA helicases play important roles in all types of processes in RNA metabolism. This report characterizes a stress-responsive transcript termed TaRH1 (Triticum aestivum RNA helicase) that encodes a putative ATP-dependent RNA helicase and is a member of the DEAD-box family. Quantitative real-time PCR (qRT-PCR) analysis indicated that the TaRH1 gene was differentially expressed under both biotic and several abiotic stresses. The characteristics are given of the TaRH1-catalysed unwinding of duplex RNA following TaRH1 expression in Escherichia coli BL 21. These results suggest that the TaRH1 gene may participate in the plant stress response. © 2014 Elsevier Ltd. All rights reserved.
Keywords: Wheat DEAD-Box RNA helicase Stress response Puccinia striiformis f. sp. tritici
Introduction Adaptation is a way of life for sessile and poikilothermic land plants which must withstand environmental stressors including those caused by low/high temperatures, water deficits, and salinity. These abiotic stresses not only limit the geographical distribution of plants but also reduce the global productivity and quality of important agricultural crops [1]. Plants, unlike animals, are sessile during their growth and development and are unable to avoid unfavourable environmental conditions. Plants have developed a complex, accurately regulated defence network to combat pathogens and, more broadly, to adapt to a variety of abiotic and biotic stresses in unfavourable environments. Plants rely on the innate immunity of each cell and on systemic signals emanating from infection sites because of their lack of mobile defender cells or a somatic adaptive immune system [2]. In particular, plant responses to invading pathogens involve a complex network of defence mechanisms in which thousands of
Abbreviation: DEAD-box, Asp-Glu-Ala-Asp box; qRT-PCR, quantitative reverse transcriptase PCR or quantitative real-time PCR; SF2, superfamily 2; dsRNA, doublestranded RNA; ssRNA, single-stranded RNA; TaRH1, Triticum aestivum RNA helicase; ETH, ethylene; SA, salicylic acid; EST, expressed sequence tag; cDNA, complementary DNA; RACE, rapid-amplification of cDNA ends; ORF, longest open reading frame. * Corresponding author. Tel.: þ86 13991886821 (mobile). E-mail address: [email protected] (Z.-s. Kang). http://dx.doi.org/10.1016/j.pmpp.2014.07.004 0885-5765/© 2014 Elsevier Ltd. All rights reserved.
genes are coordinately activated and integrated when pathogenassociated molecular patterns are recognized [3]. Plant responses to environmental stresses have been characterized by physiological and biochemical changes that result from a selective increase or decrease in the biosynthesis of a large number of distinct proteins that favour defence responses to pathogen attack. At present, some studies have demonstrated that the expression of some genes with regulatory functions such as transcription factors, protein kinases and phosphatases, RNA helicases, RNA-binding proteins, and calcium-binding proteins are altered during the defence response [4e6]. RNA helicases are molecular motors that unwind doublestranded RNA (dsRNA) thereby affecting the rearrangement of RNA secondary structure that is traditionally associated with the activation of RNA functions [7,8]. Genes that encode RNA helicases have been identified in all three kingdoms of life in addition to many viral genomes. RNA helicases are potentially associated with the entire lifespan of an RNA molecule. Nucleic acid helicases are broadly classified into six families. A large majority of RNA helicases belongs to superfamily 2 (SF2) which is comprised of five subfamilies, three of which are termed the DEAD, DEAH and DExH protein subfamilies after variations in the signature amino acid domain Asp-Glu-Ala-Asp [9e12]. The DEAD-box RNA helicases form a large family of proteins found in all eukaryotes and most prokaryotes and participate in many aspects of RNA metabolism [12,13]. For example, nearly 30 genes that encode DEAD-box RNA helicases were identified in the
X.-m. Zhang et al. / Physiological and Molecular Plant Pathology 88 (2014) 36e42
genomes of Caenorhabditis elegans and Drosophila melanogaster [14]. In Arabidopsis thaliana greater than 50 DEAD-box RNA helicases have been identified. Despite the involvement of DEAD-box RNA helicases in many diverse biological processes, their precise functions and regulation remain largely unclear. Most members of the DEAD-box family have a determined or putative ATPdependent RNA helicase activity, which modulates the RNA secondary and tertiary structure [7]. DEAD-box proteins typically act through the ATP-dependent unwinding of double-stranded RNA or by modulating RNA-protein interactions, thereby affecting the availability of RNAs for further processing [15e17]. Recent studies have provided new insights into the mechanism by which DEAD-box RNA helicases exert their biological functions [18e21]. The rice gene OsBIRH1 encodes a DEAD domain and all conserved motifs characteristic of DEAD-box RNA helicases. OsBIRH1 expression was activated in rice seedling leaves after treatment with defence-related signal chemicals. Additionally, it was up-regulated in an incompatible interaction between a resistant rice genotype and the blast fungus Magnaporthe grisea. OsBIRH1-overexpressing transgenic plants exhibited enhanced disease resistance to Alternaria brassicicola and Pseudomonas syringae pv. Tomato DC3000. The OsBIRH1 transgenic Arabidopsis plants also showed increased tolerance to oxidative stress and elevated expression levels of oxidative defence genes [2]. Increasing evidence shows that endogenous (rather than pathogenderived) sRNAs also have broad functions in regulating plant responses to various microbes [22]. One of the two Belle paralogues in yeast, called Ded1p, has been implicated in translation initiation, RNA unwinding, and the modulation of RNA-protein interactions all of which are closely connected to RNA-silencing machinery [8,23]. Additionally, a Belle's yeast orthologue was shown to localize and contribute to the formation of p-bodies and the cellular sites of mRNA degradation via RNA interference [24,25]. HVD1, a DEAD box RNA helicase, was cloned in salt-stressed barley. The HVD1 protein regulates the function of transcripts involved in salt tolerance and certain aspects of metabolism such as photosynthesis [19,26]. We report on a stress-responsive gene that was isolated from wheat which encodes a putative ATP-dependent RNA helicase that is a member of the DEAD-box family. Stripe rust, which is caused by Puccinia striiformis f. sp. Tritici (Pst), is one of the most damaging wheat diseases throughout the world [27]. In elucidating the molecular regulatory mechanisms of plant defence against Pst in wheat, we identified a gene that is a positive regulator during the defence response, which was designated as TaRH1 (KJ704992). The TaRH1 gene encodes a DEAD-box RNA helicase. In this study, we present the isolation of TaRH1's full-length cDNA sequence, molecular characterisation, expression profiles in response to Pst infection, abiotic elicitors, and ATP-dependent RNA helicase activities in vitro. Materials and methods Plant materials, inoculation, and treatments In this study, the biological materials consist of two Pst pathotypes, namely CYR23 and CYR31, and the wheat (Triticum aestivum L.) genotype Suwon 11 which contains the stripe rust resistance gene YrSu [28]. Suwon 11 is highly resistant to CYR23 (incompatible reaction) and highly susceptible to CYR31 (compatible interaction). The specific procedure under which the wheat was grown, inoculated, and harvested is described by Xia et al. [29]. Two-week-old wheat seedlings were also treated with different stress elicitors as previously described. For drought and salinity treatments roots were submerged in an aqueous solution of 20% PEG6000 and 200 mM NaCl, respectively. The hormone treatments
37
included ABA, ETH (ethylene), MeJA, and SA (salicylic acid). These procedures for various stress treatments and for sample preparation are detailed by Feng et al. [30]. Three independent biological replications were performed for each treatment. RNA extraction and cDNA synthesis The extraction of total RNA was conducted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. The quality and integrity of the total RNA were determined by running a formamide denaturing gel electrophoresis, and the quantity was tested with a NanoDrop-1000 spectrophotometer (Thermo Fisher Scientific, USA). The first-strand cDNA was synthesised with a RT-PCR system (MBI Fermentas, USA) by following the manufacturer's instructions [29,30]. Cloning TaRH1 and sequence analyses To identify the TaRH1 gene in silico cloning was performed as previously described by Zhang et al. [31]. The two ESTs were integrated into the 1867 bp section through CAP3. The longer sequence of the TaRH1 wheat gene that was retrieved from GenBank was initially used as the query probe to screen the wheat EST database in GenBank using a BLASTN analysis. Homologous wheat EST sequences were extracted and assembled, followed by the confirmation of the in silico-cloned gene using BLASTX analysis. The EST of TaRH1 has high homology with the HVD1 in barley. Therefore, the cloned DEAD helicase gene in wheat cultivar Suwon 11 was named TaRH1 (T. aestivum RNA helicase). To obtain the entire TaRH1 sequence, a pair of primers called fp (50 -ATGGAAACTCTACGTG-30 ) and rp (50 -GGCAGGCTTGACATTCGT-30 ) was used to amplify the 433 bp EST containing the 50 -terminal of the candidate TaRH1 gene. To obtain the full-length cDNA of TaRH1, the 30 RACE primer GGGATGCAGACGAGGTATCATTGGC was designed on the basis of the 30 terminus of the 1867 bp EST sequence, and PCR (30 RACE-PCR) was performed for the 30 rapid-amplification of cDNA ends using a SMART RACE cDNA Amplification Kit (Clontech, USA). The template was a mixture of the first-strand cDNA in leaf samples that were harvested at 12, 24, and 48 hpi from the incompatible combination. The 50 TaRH1 fragment was cloned through a comparative genome, and the primer was designed using the barley HVD1 sequence. The PCR products were cloned into a pGEM-T Easy Vector (Promega, Madison, WI, USA) and sequenced with an ABI PRISM 3130XL Genetic Analyzer (Applied Biosystems, USA). The protein sequence was analysed with the relevant online software from InterProScan (http://www.ebi.ac.uk/InterProScan). The deduced amino acid sequence of TaRH1 was aligned with that of other RNA helicase genes from Arabidopsis, barley, chickpea, petunia, potato, rape, rice, soybean, tobacco, and wheat, among others, using the MegAlign programme in a Lasergene software package from DNASTAR (Madison, WI, USA). A phylogenetic neighbour-joining tree was generated for these DEAD-box RNA helicase genes with MEGA software (version 5.2) according to the full-length proteins from different RNA helicase. The subcellular localization of TaRH1 was predicted with WoLF PSORT software. qRT-PCR analyses The expression profiles of TaRH1 after Pst infection were determined by qRT-PCR analyses. A 1 mg quantity of total RNA was used to synthesize the first-strand cDNA with a Maxima first-strand cDNA synthesis kit (Fermentas) as described. qRT-PCR primers (TaRH1-fp 50 -AAAGGATTTGCTTACTATGGAACTG -30 and TaRH1-rp 50 -TCGCACCACCACCTGAAAA -30 ) were used to amplify a 192 bp
38
X.-m. Zhang et al. / Physiological and Molecular Plant Pathology 88 (2014) 36e42
region, and the amplified product was confirmed by sequencing analysis. The wheat elongation factor TaEF-1a (GenBank accession number Q03033) was used as a reference gene. The TaRH1 expression levels were quantified by relative qRT-PCR. To exhibit the expression pattern clearly, we normalized to the control (0 h) for the different treatments. The concrete procedures for qRT-PCR and data processing are described by Feng et al. [30].
described to convert the output data from volts to the fraction of unwound RNA. All indicated concentrations were present after mixing unless otherwise noted.
Purifying recombinant TaRH1 protein
To isolate a novel RNA helicase gene from wheat, we first conducted in silico cloning and RT-PCR to identify the candidate fragment. By using the cDNA sequence of the wheat RNA helicase gene as a query probe, a 783 bp cDNA sequence was identified in silico and used to predict an encoded DEAD-box RNA helicase protein that was highly homologous to the barley HVD1 protein. The fp/rp primer pair was used in RT-PCR to obtain a 433 bp cDNA sequence that was confirmed by analysing the sequence that contained the 50 terminus. Next, 30 RACE-PCR was performed on the basis of the 433 bp fragment, and the 1800 bp cDNA fragment was obtained. Lastly, the two sequences were assembled into a 1996 bp consensus sequence using the CAP3 program. The assembled sequence contained a poly-A signal region in the 30 UTR. DNAMAN alignment analysis revealed that the predicted protein was encoded by the longest open reading frame (ORF) of the assembled sequence, and it shared 67.62% similarity with the HVD1 protein. The clone is 1996 bp long with a 1653 bp open reading frame encoding a peptide of 551 amino acids. The predicted molecular mass of the polypeptide is 59.4 kDa. A comparison of the TaRH1 amino acid sequence with that of known proteins demonstrates homology with the ATP-dependent RNA helicase members of the DEAD-box family (Fig. 1). The TaRH1 protein has each of the eight consensus motifs that are normally found in the members of this family. TaRH1 is predicted to localize to the mitochondria accordiner to the Target P program (http://www.cbs.dtu.dk/ services/TargetP). A phylogenetic analysis suggests that TaRH1 may have a similar function to that of HVD1 (Fig. 2).
The TaRH1 coding region was released from pUCm-TaRH1 by digesting the plasmid with BamHI/HindIII and cloning it into the pGEX4T-1 vector, which was introduced into Escherichia coli strain BL21 plus (DE3) cells. The total proteins were induced by 1 mM isopropyl-D-thiogalactoside at 18 C for 6 h. TaRH1 fusion protein purification was performed with a His-Bind Kit (Nova-Gen, Madison, WI, USA) by following the manufacturer's instructions. The protein concentration was determined with a Bio-Rad protein assay kit (Bio-Rad, Hercules, CA, USA) by following the recommended method. The purified E. coli TaRH1 protein was suspended in storage buffer (25 mM TriseHCl, pH 7.4, 50 mM NaCl, 3 mM MgCl2, and 2 mM dithiothreitol) at 80 C. Preparing short double-stranded RNA substrates The RNA substrates that were used for helicase assays were prepared as described. Two double-stranded RNA molecules with different duplex sizes were synthesised in vitro by the TaKaRa Company. The nucleotide sequences of the two RNA strands were as follows: 42nt strand, 50 -GGGGAGAAAAACAAAACAAAACAAAACAAAACACCGUAAAGC-30 of which the 30 terminus was labelled with fluorescein isothiocyanate (FITC), and 10nt strand, 50 GCUUUACGGU-30 , of which the 50 terminus was labelled with 50 hexachlorofluorescein phosphoramidite (HEX) (duplex regions underlined). The underline indicates complementary sequences in the annealing process. The synthesised transcripts were annealed, resulting in a partial duplex of 10 bp. All of the synthetic oligonucleotides were purified by high-pressure liquid chromatography before storage in 10 mM TriseHCl (pH 8.0), 1 mM EDTA at 20 C. Stopped-flow kinetics measurements The RNA helicase activity was measured and modified according to a previously reported method [32,33]. RNA unwinding assays were performed in reaction buffer containing 20 mM TriseHCl, pH 8.0, 60 mM NaCl, 1 mM MgCl2, 2 mM dithiothreitol, and 15U RNasin (Invitrogen). The unwinding buffer contained 20 mM TriseHCl, pH 8.0, 60 mM NaCl, 1 mM MgCl2, 2 mM dithiothreitol, and 15U RNasin. ATP was purchased from Sigma (USA) and dissolved as a concentrated stock at pH 7.0. The ATP concentration was determined using an extinction coefficient of 1.54 104 cm1 M1 at 259 nm. All of the RNA unwinding kinetic assays were performed using a Bio-Logic SFM-400 mixer with a 1.5 mm 1.5 mm cell (FC15, Bio-Logic) and a Bio-Logic MOS450/AF-CD optical system equipped with a 150 W mercuryexenon lamp. Fluorescein was excited at 492 nm (2 nm bandwidth), and its emission was monitored at 525 nm with a high-pass filter and a 20 nm bandwidth (D525/20, Chroma Technology Co., USA). All of the stopped-flow kinetic curves are averages of at least 10 individual traces. All of the assays were performed at 37 C. The unwinding kinetic assays were measured in a two-syringe mode in which TaRH1 helicase and RNA were pre-incubated at 37 C in syringe number 3 for 5 min while the ATP was in syringe number 4. Each syringe contained unwinding reaction buffer, and the unwinding reaction was initiated by rapid mixing. Calibration experiments were performed as
Results Cloning TaRH1, a wheat gene encoding a DEAD-box RNA helicase
Expression profiles of TaRH1 in the incompatible and compatible interactions TaRH1 expression patterns were determined in wheat leaves infected with P. striiformis pathotypes CYR23 and CYR31 for incompatible and compatible interactions, respectively, using qRTPCR (Fig. 3). These results showed the TaRH1 expression after the plants were inoculated within compatible interactions. However, TaRH1 expression increased by approximately 3-fold at 24 hpi in the incompatible interaction. Until 48 hpi, the transcription level increased to nearly 6-fold that of the control. The results showed that TaRH1 may positively regulate resistance in the wheat and pst interactions. TaRH1 expression under various stresses TaRH1 expression was also induced in response to several chemical treatments, including exposure to 20% PEG6000, high salinity, low temperature, and wounding (Fig. 4). Low temperatures increased TaRH1 transcription levels by approximately 6-fold at 2 hpt, and the TaRH1 levels continued to increase and decrease from 2 to 24 hpt. The TaRH1 transcription levels peaked (over 5-fold) as early as 6 hpt under high salinity (200 mM NaCl). The TaRH1 transcription level was not significantly affected by the PEG and wounding treatments. These results suggest that TaRH1 may play an important role in salt and cold stresses. qRT-PCR was performed to determine if the TaRH1 expression in wheat seedlings was induced by well-known disease resistancerelated signal molecules, such as ABA, ETH, MeJA, and SA. As
X.-m. Zhang et al. / Physiological and Molecular Plant Pathology 88 (2014) 36e42
39
Fig. 1. The structure of the TaRH1 protein. TaRH1 alignment with wheat TaRH3 (EMS 52116), TaIF4A (P41378), barley HVD1 (BAD21122), and Arabidopsis AtRH (NP_188870). The conserved motifs are indicated by short thick lines.
presented in Fig. 5, SA treatment led to rapidly induced expression of TaRH1 within 2 h and was maintained at a relatively higher level for 2e6 h after treatment. The ETH treatment significantly increased the TaRH1 expression level, peaking at 48 hpt (approximately threefold). By contrast, MeJA and ABA treatments had no significant effect on TaRH1 expression. These results suggest that
Fig. 2. A phylogenetic tree analysis of TaRH1 with DEAD-box helicase proteins from other organisms. The phylogenetic trees were constructed using the Neighbour-Joining method, and the genetic distances were calculated with the Kimura two-parameter model. The bootstrap values from 1000 replicates were used to assess the robustness of the trees. The selected DEAD-box RNA helicase proteins were Triticum aestivum TaIf4A (P41378), Triticum urartu RH3 (EMS52116), Hordeum vulgare RH1, namely HVD1 (BAD21122), Arabidopsis thaliana RH (NP_188870), Arabidopsis thaliana LOS4 (AAP68306), Oryza sativa RH50 (Q0DVX2.2), Zea mays DRH1 (AAR29370), Zea mays RH2 (ACG27839), Theobroma cacao RH53 (Eox93041), and Brachypodium distachyon RH3 (XP_003563192).
Fig. 3. TaRH1 expression patterns in wheat leaves after inoculating with CYR23 and CYR31. The relative expression of the TaRH1 gene was calculated using the transcript levels from pathogen-infected tissues and then compared with that of mock controls across all of the time points. The data were normalised to TaEF expression levels, and the error bars represent variations between three independent biological replicates.
40
X.-m. Zhang et al. / Physiological and Molecular Plant Pathology 88 (2014) 36e42
Fig. 4. TaRH1 gene expression in wheat leaves under abiotic treatments. The environmental stimuli included 20% PEG6000, high salinity (200 mM NaCl), low temperature (4 C), and wounding. The mean values and standard errors (bar) from three independent experiments are indicated.
TaRH1 might be related to SA- and ETH- dependent defence signalling pathways. Identifying the ATP-dependent unwinding of duplex RNA in vitro In this work, we studied the RNA unwinding kinetic mechanism of the helicase TaRH1 protein using stopped-flow assays (Fig. 6). RNA helicases are a class of enzymes that use energy derived from ATP hydrolysis to unwind double-stranded RNAs. The experiment was performed with 32nt-tailed ssRNA/dsRNA. In the present study, we used fluorometric assays to study the BLM-catalysed unwinding of duplex RNA in real time under various experimental conditions. The two fluorescent molecules were in close proximity before RNA unwinding, and the fluorescein emission was low because of the FRET between the two molecules. The fluorescein emission was enhanced when unwinding was initiated because of the disruption in the FRET as the two molecules were separated. Thus, the fluorescein emission change was monitored to observe the unwinding process. The results showed a weak RNA duplex unwinding efficiency. It is possible that unwinding requires some functional interactions between the protein molecules that could enhance the RNA unwinding efficiency in vitro. These results clearly indicate that TaRH1 has ATP-dependent RNA helicase activity. Discussion Plants exhibit diverse adaptation levels to biotic and abiotic stresses to survive Most of these adaptations involve some regulation of gene expression and enzyme activities [20]. Several genes, including helicases, are induced by various stresses. RNA helicases are encoded in essentially every organism ranging from viruses to humans. They perform essential roles in potentially any cellular function involving RNA metabolism [13]. Although a number of these functions have been documented with respect to housekeeping activities, the importance of the stress-induced alteration of RNA helicase expression and activity is only now becoming evident. RNA helicases function in the cellular response to these stress stimuli through alterations in nuclear mRNA export, translation initiation, mRNA decay, rRNA processing, cell cycle progression, transcription, and helicase subcellular localization [13,34]. Therefore, RNA helicases could play an important role in regulating plant growth and development under stress conditions by regulating some stress-induced pathways. The involvement and significance of RNA helicases in response to biotic and abiotic stresses have only recently begun to emerge [35,36]. In the present study, a new gene was cloned and identified
as a DEAD box RNA helicase similar to HVD1, which was designated TaRH1. Primer sequences have indicated that TaRH1 must be an orthologue of a GenBank entry (AK335104). In the NCBI database, AK335104 is 2801 bp in length, and the longest ORF is 1851 bp (from 467 bp to 2317 bp). This gene encoded the 616 amino acid protein. The similarity between TaRH1 (551 AA) and AK335104 (616 AA) is 28.24% by DNAMAN alignment, and AK335104 (616 AA) and HVD1 (764 AA) shared 44.15% similarity. The TaRH1, which is a new DEAD-box RNA helicase gene, is different from AK335104. The TaRH1 expression profiles of incompatible and compatible interactions showed that it may positively regulate resistance in wheat and pst interactions. The rice OsBIRH1 gene encodes a DEADbox RNA helicase with ATP-dependent RNA helicase activities. Studies have shown that OsBIRH1 plays important roles in oxidative stress tolerance and disease resistance response, as revealed by its inducible expression by pathogen infection and multiple defence signal molecules [2]. The results not only extend our knowledge of the biological function of DEAD-box RNA helicases but also provide new clues to exploring the significance of RNA helicase-mediated RNA metabolism in the regulation of plant defence responses. In the four abiotic stresses tested including salt, cold, wounding and PEG, TaRH1 mRNA was accumulated from salt stress and cold stress with the same expression pattern. The results are identical to the expression pattern of HVD1, which encodes a salt-induced ATPdependent DEAD-box RNA helicase in barley [19]. HVD1 transcript accumulation was induced under salt stress, cold stress and ABA treatment. When subjected to salt stress, the intracellular salt concentration rises either by dehydration or by salt influx. In saltstressed rice, Osa-MIR414, osa-MIR164e and osa-MIR408 were experimentally validated for the first time in plants for targeting the OsABP, OsDBH and OsDSHCT genes, respectively. These genes were up-regulated, and their corresponding miRNAs were downregulated in response to salt stress. In E. coli, csdA encodes a DEAD-box RNA helicase, and its expression was induced when the culture temperature decreased from 37 C to 15 C [37]. The LOS4 gene was recently reported to encode an RNA helicase that plays an important role in regulating CBF genes in relation to chilling and freezing tolerance in plants [38]. Nevertheless, the LOS4 protein is localized to the nucleus, and the gene is not induced by salt stress [39]. In E. coli, cold shock induces a ribosomal-associated DEAD-box protein. STRS1 and STRS2 were down-regulated by multiple abiotic stresses, including salt, drought, and heat stress, but both attenuated the abiotic stress tolerance [40]. ABO6, a DEXH box RNA helicase, is involved in reactive oxygen species production in mitochondria during Arabidopsis-mediated crosstalk between abscisic acid and auxin signalling [41]. All evidence suggests that
X.-m. Zhang et al. / Physiological and Molecular Plant Pathology 88 (2014) 36e42
41
Fig. 5. TaRH1 gene expression in wheat leaves under different hormone treatments. The leaves were exogenously sprayed with the hormones SA (salicylic acid), ET (ethylene), MeJA (methyl jasmonate), and ABA (abscisic acid). The mean values and standard errors (bar) from three independent experiments are indicated.
DEAD-box proteins may be involved in adapting to various environmental stresses. We examined the expression patterns of TaRH1 after the plants were treated with these signal molecules and found that TaRH1 was induced at relatively high levels by SA and MeJA. Thus, we propose that TaRH1 may be involved in the wheat defence response to Pst infection, putatively through the SA/MeJA-dependent signal transduction pathway. In barley, DEAD helicase HVD1 transcript accumulation was induced not only by salt stress and cold stress but also by ABA treatment [19]. Although OsBIRH1 has a relatively high level of basal expression, its expression was induced not only by pathogen infection but also by several disease resistance-related signalling molecules, including SA, JA, and ACC, suggesting a role for OsBIRH1 in disease resistance signalling pathways [2]. In plants, a number of genes will change their transcription upon any challenge from biotic and abiotic stresses. In order to research the rationale of working on the DEAD-Box gene TaRH1, the interacting protein with TaRH1 may be screened through yeast two-hybrid system. The similarity of TaRH1 and HVD1 is 67.62%. Thus, it is anticipated that the TaRH1 protein regulates the function of transcripts concerned with abiotic and biotic stresses, or important metabolic processes such as photosynthesis. Although a number of DEAD-box proteins and genes have been identified from various plants, most of the proteins have not been analysed for their biochemical activity in vitro. Biochemical activities characteristic of RNA helicases, namely RNA-dependent ATPase activity and RNA unwinding, have been demonstrated for a relatively small proportion of the RNA helicase-related sequences in public databases [36]. The TaRH1 protein expressed in E. coli possesses unwinding activity, but its efficiency is quite weak. It is
likely that the transit peptide of the pre-TaRH1 protein requires processing or some other factors for its enzymatic activity [19]. Arabidopsis LOS4 has RNA-dependent ATPase activity in vitro, and AtDRH1 possesses both ATP-dependent RNA helicase and RNAdependent ATPase activities [42,43]. The CrhC helicase purified from E. coli is an ATP-independent RNA-binding protein that possesses RNA-dependent ATPase activity, and it was stimulated most efficiently by rRNA and polysome preparations. RNA helicase activity proceeds from 50 -30 but not from 30 -50 . Immunoprecipitation and far-western blotting indicated that CrhC is a component of a multi-subunit complex, interacting specifically with a 37 kDa polypeptide [44]. The OsBIRH1 gene encodes a DEAD-box RNA helicase with RNA-dependent ATPase and ATP-dependent RNA helicase activities [2]. Overall, our data indicates that TaRH1 may be an important component in the defence-signalling pathway and may play a crucial role in wheat defence responses to abiotic and biotic stresses. TaRH1 regulates gene expression at the RNA level, and it may be related to photosynthesis under biotic and abiotic stresses. However, some questions must be resolved with regards to the biological function of TaRH1 and its mechanisms of action, including how TaRH1 protein regulates the expression of defencerelated genes in plants, what role TaRH1 may play in plant growth and development, and how TaRH1 operates different stress signalling pathways in various stresses. We are currently investigating the biological function of TaRH1 in wheat defence responses to Pst using overexpression and barley stripe mosaic virus-mediated virus-induced gene silencing. In addition, it would be valuable to elucidate both the biochemical and biological functions of TaRH1 with knockout or knockdown mutants in model plants. Acknowledgements This study was supported by grants from the National Basic Research Program of China (2013CB127700), the China Postdoctoral Science Foundation (2012M512035), Dr. Startup Funds (Z109021121) and the 111 Project from the Ministry of Education of China (B07049). We are grateful to Brice E. Floyd (Iowa State University) for critical modifying of the manuscript. References
Fig. 6. The dependence of RNA unwinding on [ATP] under multiple turnover conditions. The typical kinetic time-courses of TaRH1 unwinding at 1 or 0 mM ATP.
[1] Guan Q, Wu J, Zhang Y, Jiang C, Liu R, Chai C, et al. A DEAD box RNA helicase is critical for Pre-mRNA splicing, cold-responsive gene regulation, and cold tolerance in Arabidopsis. Plant Cell 2013;25:342e56. [2] Li D, Liu H, Zhang H, Wang X, Song F. OsBIRH1, a DEAD-box RNA helicase with functions in modulating defence responses against pathogen infection and oxidative stress. J Exp Bot 2008;59(8):2133e46. [3] Takken FL, Albrecht M, Tameling WI. Resistance proteins: molecular switches of plant defence. Curr Opin Plant Biol 2006;9:383e90.
42
X.-m. Zhang et al. / Physiological and Molecular Plant Pathology 88 (2014) 36e42
[4] Zhu J. Salt and drought stress signal transduction in plants. Annu Rev Plant Biol 2002;53:247e73. [5] Shinozaki K, Yamaguchi-Shinozaki K, Seki M. Regulatory network of gene expression in the drought and cold stress responses. Curr Opin Plant Biol 2003;6:410e7. [6] Yamaguchi-Shinozaki K, Shinozaki K. Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annu Rev Plant Biol 2006;57:781e803. [7] Chamot D, Colvin KR, Kujat-Choy SL, Owttrim GW. RNA structural rearrangement via unwinding and annealing by the cyanobacterial RNA helicase, CrhR. J Biol Chem 2005;280(3):2036e44. [8] Bleichert F, Baserga SJ. The long unwinding road of RNA helicases. Mol Cell 2007;27:339e52. [9] Linder P, Lasko PF, Ashburner M, Leroy P, Nielsen PJ, Nishi K, et al. Birth of the D-E-A-D box. Nature 1989;337:121e2. [10] Gustafson EA, Wessel GM. DEAD-box helicases: posttranslational regulation and function. Biochem Biophys Res Commun 2010;395:1e6. [11] Jankowsky E, Fairman ME. RNA helicases-one fold for many functions. Curr Opin Struct Biol 2007;17:316e24. [12] Cordin O, Banroques J, Tanner NK, Linder P. The DEAD-box protein family of RNA helicases. Gene 2006;367:17e37. [13] Rocak S, Linder P. DEAD-box proteins: the driving forces behind RNA metabolism. Nat Rev Mol Cell Biol 2004;5:232e41. [14] Boudet N, Aubourg S, Toffano-Nioche C, Kreis M, Lecharny A. Evolution of intron/exon structure of DEAD helicase family genes in Arabidopsis, Caenorhabditis, and Drosophila. Genome Res 2001;11:2101e14. [15] Jacobs Anderson JS, Parker R. RNA turnover: the helicase story unwinds. Curr Biol 1996;6(7):780e2. [16] Jankowsky E, Bowers H. Remodeling of ribonucleoprotein complexes with DExH/D RNA helicases. Nucleic Acids Res 2006;34(15):4181e8. [17] Singleton MR, Dillingham MS, Wigley DB. Structure and mechanism of helicases and nucleic acid translocases. Annu Rev Biochem 2007;76:23e50. [18] Chinnusamy V, Zhu J, Zhu J. Cold stress regulation of gene expression in plants. Trends Plant Sci 2007;12(10):444e51. [19] Nakamura T, Muramoto Y, Yokota S, Ueda A, Takabe T. Structural and transcriptional characterization of a salt-responsive gene encoding putative ATPdependent RNA helicase in barley. Plant Sci 2004;167:63e70. [20] Linder P, Owttrim GW. Plant RNA helicase: linking aberrant and silencing RNA. Trends Plant Sci 2009;14(6):344e52. €met M. RNA silencing in the antiviral innate immune [21] Ulvila J, Hultmark D, Ra defence- role of DEAD-box RNA helicases. Scand J Immunol 2010;71(3): 146e58. [22] Ruiz-Ferrer V, Voinnet O. Roles of plant small RNAs in biotic stress responses. Annu Rev Plant Biol 2009;60:485e510. [23] Chuang RY, Weaver PL, Liu Z, Chang T. Requirement of the DEAD-Box protein ded1p for messenger RNA translation. Science 1997;275:1468e71. [24] Iost I, Dreyfus M, Linder P. Ded1p, a DEAD-box protein required for translation initiation in Saccharomyces cerevisiae, is an RNA helicase. J Biol Chem 1999;274:17677e83. [25] Beckham C, Hilliker A, Cziko AM, Noueiry A, Ramaswami M, Parker R. The DEAD-box RNA helicase Ded1p affects and accumulates in Saccharomyces cerevisiae P-bodies. Mol Biol Cell 2008;19:984e93.
[26] Matsumoto T, Tanaka T, Sakai H, Amano N, Kanamori H, Kurita K, et al. Comprehensive sequence analysis of 24,783 barley full-length cDNAs derived from 12 clone libraries. Plant Physiol 2011;156:20e8. [27] Chen X. Epidemiology and control of stripe rust [Puccinia striiformis f. sp. tritici] on wheat. Can J Plant Pathol 2005;27:314e37. [28] Kang Z, Li Z. Discovery of a normal T. type new pathogenic strain to Lovrin10. J Northwest Agric For Univ Nat Sci Ed 1984;4:18e28. [29] Xia N, Zhang G, Sun Y, Zhu L, Xu L, Chen X, et al. TaNAC8, a novel NAC transcription factor gene in wheat, responds to stripe rust pathogen infection and abiotic stresses. Physiol Mol Plant Pathol 2010;74:394e402. [30] Feng H, Liu W, Zhang Q, Wang X, Wang X, Duan X, et al. TaMDHAR4, a monodehydroascorbate reductase gene participates in the interactions between wheat and Puccinia striiformis f. sp. Tritici. Plant Physiol Biochem 2014;76:7e16. [31] Zhang G, Dong Y, Zhang Y, Li Y, Wang X, Han Q, et al. Cloning and characterization of a novel hypersensitive-induced reaction gene from wheat infected by stripe rust pathogen. J Phytopathol 2009;157:722e8. [32] Yang Y, Dou S, Ren H, Wang P, Zhang X, Qian M, et al. Evidence for a functional dimeric form of the PcrA helicase in DNA unwinding. Nucleic Acids Res 2008;36(6):1976e89. [33] Yang Y, Dou S, Xu Y, Bazeille N, Wang P, Rigolet P, et al. Kinetic mechanism of DNA unwinding by the BLM helicase core and molecular basis for its low processivity. Biochemistry 2010;49:656e68. [34] Tanner NK, Linder P. DExD/H box RNA helicases: from generic motors to specific dissociation functions. Mol Cell 2001;8:251e62. [35] Vashisht AA, Tuteja N. Stress responsive DEAD-box helicases: a new pathway to engineer plant stress tolerance. J Photochem Photobiol B 2006;84:150e60. [36] Owttrim GW. RNA helicases and abiotic stress. Nucleic Acids Res 2006;34: 3220e30. [37] Turner AMW, Love CF, Alexander RW, Jones PG. Mutational analysis of the Escherichia coli DEAD box protein CsdA. J Bacteriol April 2007;189(7): 2769e76. [38] Gong Z, Lee H, Xiong L, Jagendorf A, Stevenson B, Zhu J. RNA helicase-like protein as an early regulator of transcription factors for plant chilling and freezing tolerance. Proc Natl Acad Sci U S A 2002;99:11507e12. [39] Py B, Higgins CF, Krisch HM, Carpousis AJ. A DEAD-box RNA helicase in the Escherichia coli RNA degradosome. Nature 1996;381:169e72. [40] Kant P, Kant S, Gordon M, Shaked R, Barak S. STRS1and STRS2, two DEAD-box RNA helicases that attenuate Arabidopsis responses to multiple abiotic stresses. Plant Physiol 2007;145:814e30. [41] He J, Duan Y, Hua D, Fan G, Wang L, Liu Y, et al. DEXH box RNA helicasemediated mitochondrial reactive oxygen species production in Arabidopsis mediates crosstalk between abscisic acid and auxin signaling. Plant Cell 2012;24(5):1815e33. [42] Okanami M, Meshi T, Iwabuchi M. Characterization of a DEAD box ATPase/ RNA helicase protein of Arabidopsis thaliana. Nucleic Acids Res 1998;26: 2638e43. [43] Gong Z, Dong CH, Lee H, Zhu J, Xiong L, Gong D, et al. A DEAD box RNA helicase is essential for mRNA export and important for development and stress responses in Arabidopsis. Plant Cell 2005;17:256e67. [44] Yu E, Owttrim GW. Characterization of the cold stress-induced cyanobacterial DEAD-box protein CrhC as an RNA helicase. Nucleic Acids Res 2000;28: 3926e34.