- Email: [email protected]
The cloning and functional characterization of the nifH gene of Rhodospirillum rubrum
Gene, 95 (1990) 143-147 Elsevier
143
GENE 03727
The cloning and functional characterization of the nifl-I gene of Rhodospiriilum rubmm (Nitrogen fixation; ADP-ribosylation; recombinant DNA; photosynthetic bacteria)
L.J. Lehman, W.P. Fitzmauriee* and G.P. Roberts Department of Bacteriology and the Center for the Study of Nitrogen Fixation, College of Agricultural and L~fe Sciences, University of Wisconsin-Madison, Madison, WI 53 706 (U.S.A 0 Received by C.R. Hutchinson: 21 August 1989 Revised: 20 December 1989 Accepted: 11 July 1990
SUMMARY
Dinitrogenase reductase (the n/fH product) from Rhodospirglum rubrum is regulated by a post-translational modification system encoded by draTG. As demonstrated in this report, the cloning, sequencing, and functional characterization of the n/fH gene provides a basis for further analysis as well as revealinginteresting features ofgene organization. The coding regions of n0~Hand draT are separated by only 400 bp, though the genes are divergentlytranscribed and differentiallyregulated. The construction of a nOT/insertion caused a Nil- phenotype and destroyed the mutant's ability to synthesize both dinitrogenase and dinitrogenase reductase, verifying functionality and transcriptional organization of the nifHDK genes.
INTRODUCTION
RhodospirUlum rubrum is a free.living, purple, nonsulfur photosynthetic bacterium that fixes nitrogen (Kamen and Gest, 1949). It is also the first organism shown to employ a post-translational system for the regulation of this process (Ludden and Burris, 1976). The system has been found to consist of two enzymes, DRAT and DRAG, that respond to the levels of light and ammonia (Kanemoto and Ludden, 1984) sensed by the cell. The response entails the reversible
modification of Rr2, a component of the nitrogenase complex, controlling its activity. Rr2 is a dimer of identical subunits encoded by the n/fH gene whose role in nitrogen fixation is to reduce Rrl which then reduces dinitrogen to ammonia. To fullyutifize the Rr2/DRAG/DRAT system as a model for regulation by reversible ADP-ribosylation, cloning and characterization of mf/-/were necessary and the aim of the present study. Determination of the number of functional copies of the n/fH gene was also important as the related bacterium Rhodobacter capsulatus (Scolnik and Haselkorn, 1984)appears to have multiple copies based on reversion of transposon insertions.
Correspondence to: Dr. G.P. Roberts, Department of Bacteriology, University of Wisconsin, Madison, WI 53706 (U.S.A.) Tel. (608)262-3567; Fax (608)262-9865. * Present address: Department of Genetics, North Carolina State University, Raleigh, NC 27695 (U.S.A.) Tel. (919)737-2287. Abbreviations: aa, amino acid(s); ADP, adenosine 5'-diphosphate; bp, base pair(s); DRAG, dinitrogenase reduetase-activating glycohydrolase; DRAT, dinitrogenase reductase ADP-ribosyltransferase; K., Klebsiella; kb, kilobase(s) or 1000bp; Km, kanamycin; nt, nucleotide(s); R., Rhodospi~llum;Rrl,dinitrogenase from R. rubrum;Rr2,dinitrogenase reductase from R. rubrum; SDS, sodium dodecyl sulfate; Sin, streptomycin; Sp, spectinomycin; wt, wild type. 0378-1119/90/$03.50© 1990Elsevier SciencePublishers B.V.(BiomedicalDivision)
EXPERIMENTAL AND DISCUSSION
(a) Isolation of Rhodosplrillum rubrum niflt Under stringent Southern analysis conditions, R. rubrum chromosomal digestions demonstrated strong hybridization to a K. pneumoniae nifHD prob~ as previously observed by Fornari and Kaplan (1983). There appeared to be only one strongly hybridizing region by Southern analysis (Fig. 3) at high or low stringency. Another faintly
144
Southern hybridization analysis with the K. pneumoniae probes pjC362, pJCl51, and pKPl (Fig. 1), were purified. This analysis indicated that the n/fH, n/fD, and n/fK genes were located near each other. As shown in section e, the n/f//- mutant was found to synthesize neither Rr2 nor Rrl (nij'DK gene products), suggesting the genes are cotranscribed. This conclusion was further supported by the characterization of a strain, UR 145, with an insertion in the n/fD-homologous region. This strain was able to synthesize Rr2, but was unable to synthesize Rrl (Ludden et al., 1989). Similarities of the phage restriction map to that of the R. rubrum draTG genes (Fitzmaurice et al., 1989) were noted and pJC362 was used to probe a draTG-contalning phage clone. This probe detected a 3.2-kb BarnHI fragment just as was observed in the R. rubrum nifHDK clones,
hybridizing fragment was observed, but its significance is unclear, as a mutant containing an insertion in nifH does not demonstrate nitrogenase activity or revert to Nit"÷ (see section e). While in K. pneumoniae a single copy of this gene is present, R. capsulatus (Scolnik and Haselkorn, 1984) and some other diazotrophs appear to have multiple copies. We were able to detect and clone the n/f/-/ gene of R. nabrum from a 2EMBL4 R. rubrum library into E. coli DHSa (BRL, Oaithersburg, MD) using K.pneumoniae nO'liD from pJC362 (Collins and Brill, 1985) (Fig. 1). ,~EMBL4 lysates and DNA were prepared from plates as described in Maniatis et al. (1982) with the substitution of purified afar for standard afar. Three distinct overlapping phage clones, as determined by restriction mapping and
K. pneumonlae s
nifY nlfT
nifK
pJC1Sl
K
nifD
nifH
,
nifJ
pKPl
pJC362
,, ,,,
R. rubrum H
I
B ,°,
.
.
.
.
.
.
nifK
pLL102
.
.
.
.
nifD
E
B,.R
1
I/
nifH
E .
.
.
.
.
.
.
.
.
.
dra T
.
.
l
.
H .
.
.
.
]
.
draG
,, pLL101 pLL106
1 kb Fig. I. Restrictionmaps of the nO~IDKregionsof K. pneumonlaeand R. rubnamand the relevantplasmids.The Sail site in niftl erR. rubrumwas the site of the Krn cassetteinsertion(sectione). B, BamHI; E, EcoRi; H, Htndlll; K, Kpnl; and S, Sail. Severalrestrictionfragmentscontainingregions ofn0~/homologyweresulglonedinto pUCI9 (Yanisch-Perronet al., 1985),creatingpLLI01, pLLI02, and pLLI06. PlasmidspJCiSl and pjC362 are pBR322 derivativescontainingthe indicatedSail n~rfragments(Collinsand Brill, 1985).PiasmidpKPI is a pUCI9 derivativecontainingthe indicated Kpnl-EcoRl n~" fragmenL
145 GGGGATGGG/~GG_AGGG&CCGI~G~,ACCt~G&AC .........
+ .........
+ .........
+ .........
t~I~GG~CG~1-x-t-t + .........
CGCCC
+ .........
÷
60
demonstrating that draTG and nifltDK are closely linked in R. rubrum.
AT]~GCI"I"f&TGACCGATCGGGGGGCC~.GGGGAAGGG C G ' [ ~ C I ~ G G C A G T A G C G G \ C C & T G .........
+ .........
GCGGATAGGG~:G~CCG ......... + .........
+ .........
+ .........
+ .........
ClWJL'I~GG~GGCGAGAGGG~ + ......... + ......... + .........
+ ..........
+
120
~ G + .........
+
180
GTI'IqICGACACCGTTGAAAAT/LACCCTACATTGCTTCTT&GATAGATTTATTCb ~-xtGAT .........
+ .........
+ .........
+ .........
÷ .........
TAAAAACGATAA-t~t~ - i C ~ U c a . ~ T C G G G C / ~ q T C A ~ C A C G .........
+ .........
+ .........
÷ .........
CG GG G I ~ & G C G I ~ G C GGIT, C~G G1"1~ CC C ~ A C G & C . . . . . . . . .
+ .........
÷ .........
+
240
CTGGGTGCATTAA + .........
+
300
CGG&TC&CG&AGA#~AG G A T f
360
+ . . . . . . . . . + . . . . . . . . . + . . . . . . . . . + . . . . . . . . . + . . . . . . . . . +
G&~[I~,&~&GGGC~GTGCGTC&G&TGGGb"I~CTACCGCAAGGGGCGT&~:GG~CG ......... + ......... + ......... + ......... + ......... + .........
+
420
NetSerAlaLauArsGluI leAlaPheTyrGlyLysGlyGlyIleGlyLysSe r ACGACGTCG~GAACACGC~GGCCGGTCTGG~G/L:~ATGGGCCAGCGGATCCI~ATfGTC ......... + ......... + ......... + ......... + ......... + ......... +
480
Th~fhl:SezGlt~qsnTh~LeuAlaAlaLeuValGluHe c G l y G l n A r g l l e L e u l l e V a l CGC'JL'G CG&TCCGAAGG CCGATTCCACCCGC CTGATCCI'GAACACCAAG CTG C'&GCACACC ......... + ......... + ......... + ......... + ......... + ......... +
$40
GlyCysAspProLysAlaAspSet~hrA~gLeulleLeuAsnThrLysLeuGlt~AspThr G I ~ G ~ r C A T C ~ G C C G G C O A G G C C G G CTCGG~CGAAGAC C T C G & C G T C G C C G & ~ T G G ~ G ......... + ......... + ......... + ......... ÷ ......... + ......... +
600
ValLeutlS s L e u A l a A l a f l u A l a f l y S e r V a l f l u A s p L e u A s p V a l A l a A s p V a l V a l AAGATCGG CTACAAGGGCATCAAGI'GCACCGAATC CGCTCGTCCC(~AGCCCGG CGTOGGC ......... + ......... + ......... + ......... + ......... + ......... +
660
LyslleGlyTyrLysGlylleLys~yeTh~OluSe~:GlyGlyProGluProClyValCly TG'I'G CCCCCCGTGCCGTG&TCAC CGCCATCAAGTTCCTTG,%COAAAACGG CC CGTACC&C ......... + ......... + ......... + ......... + ......... + ......... 4.
720
L'y~qlaGlyArgClyVal n e T h ~ : & l a I leAsnPheLeuClu01uAsuClyAtaTyr,qsP GACGTCOATI'ACCTCTCTT&GCACGTGCTG0CCCACGTGGTTTGCGGTGGCTTCCCC~.TG ......... + ......... + ......... + ......... 4. . . . . . . . . . + ......... +
780
AspLeuAspTyrValSe~:Tyr&spVatLeuflyAspValValCysGlyClyPheAlaHeC CCC&TCCG CC&GAACAAGGCTCACCAAATCTACATGCTC&TGTCCC C C C A ~ T C A T G G C C ......... + .... , . . . . 4. . . . . . . . . . + ......... + ......... + ......... +
8/*0
P r o I l ~ q r ftCluAsnLys&laC l u 0 1 u I l e T y ~ I l e V a l H e CSerClyCluHe CMeCAla GTOTA'I'OCCCCCAACAAC~TGC GC . ~ , G G C C . q i ~-~ Sx?,AAAT&CGGGCA~C C C G ~ G C C ~
......... +......... + ......... + ......... + ......... + ......... + LeuTyl:&laAl~qsnksul t e / ~ l a L y a O l y Z l e L e u L y a ~ r A l a l U s T h ~ C l y O l y V a l COTCTOOOCO~TCI~.'~'fCTOC/~.COAOCOTCAO~CTO&TAAO0~OTCC~C~ CCOAO ......... 4, . . . . . . . . . .',.. . . . . . . . . 4.. . . . . . . . . 4. . . . . . . . . . ÷ ......... ÷ A~SI~u0 l y C l y L e u I teCy~qsn0 lu&~$OlnThrAspLysGluValOluLeuAlaClu
900
960
OGCCTOOCCGGCCOTTTOGOO'I'GCGGCCTCATOr.AGT~GGTGGCGCGCG&CAAOGGCOTT
.........
÷ .........
+ .........
+ .........
+ .........
+ .........
+
(b) Sequeaee analysis The n/fH-hybridizing region was sequenced (Fig. 2) and extensive sin~larity was noted to the n/f// genes of K. pneumon/ae (Scott et al., 1981) and R. capsulatus (Jones and Haselkorn, 1988) at both the nt (75~0 and 8 3 ~ , respectively) and aa levels (71~o and 8 6 ~ , respectively). This homology allowed exact localization of the n/f//gene. The 885 bp of the ORF could code for a protein of 35.4 kDa, consistent with the pubfished 30-kDa size. On the nt level, the physical "arrangement' of the n/f// gene is similar to that of K. pneumon/ae and others. N o E. coli-type promoter was found, but a 'n/f promoter sequence (Beynon et al., 1983) is present at 71 bp and 84 bp upstream from the start codon of the gene. A characteristic A + T-rich region was found just upstream from the proposed promoter. Additionally, two examples of upstream activator sequences are located at 177bp and 207 bp upstream from the initial Met, as seen upstream from other n/f regions (Buck et al., 1986). Sequence analysis of the region downstream from n/fH placed the initial Met ofmfD 116 bp from the end of n/f//, a relatively long interval between cotranscribed genes. The niftt and draT genes are divergently transcribed, with 400 nt separating their coding regions. The implications of this arrangement of the genes coding for this reversible regulatory system and its substrate are unknown, but may provide an opportunity for some degree of co-regulation. Since the identity and location of the dra promoter is not known, it is unclear if the regulatory elements controlling draTG overlap with those of nifltDK in a manner that affects the regulation of either operon.
1020
Alal~uAtaOlyArsLeuOlyCysAql~ul IeHIs~heV~IP~o&~spAsnOIyVaI CAGCACCCC~AOCTOCOCCOCOAAACOGTO&TCCAAT&C0CCCCCOACACC~C~CCCC .........
+ .........
+ .........
+ .........
+ .........
+ .........
+
1080
G l n l l i | k l a O l u L e u a r & q r BClnTh~ValIleClnTyr&IaI~roAspSe I:LYsOI n A t a GGTC>ATCCCACCCTGCC~&CCAAG&TCC&CAACAACTOCGGCCAGGC CGTGGTCCCC .........
+ .........
+ .........
+ .........
+ .........
+ .........
+
1140
GlyCluTyl:&rsTh~:LeoAlaThrLys XleH £ sAsuAsuSe rG l y G I u C l y V a l V a l P r °
(C) Cassette mutagenesis The mfH gene on pLL106 was mutagenized by cloning a Km cassette from pUC-4K (Vieira and Messing, 1982) into the SolI site (Fig. 1). The mutagenized fragment was then cloned into the EcoRl site of pRK290 (Ditta et al.,
ACCCC0&TCAGC&TGCAACACCT00AACAOATGCTCATC~AATTCCGCATCATGAAGTCC .........
+ .........
+ .........
+ .........
+ .........
+ .........
+
1200
T h r P ~oI leThl~Me cGluAspLeuGluGlul4e cLeu~e CGluPheGlylleHeCLysSe r (~&CCAACAGGCGGTGGCOGA~CTCCAAGCCAAGOAATCCGCCGCCCCCAATTAACOCCCT ......... + ......... + ......... + ......... + ......... + ......... 4.
1260
&spCluCluAlaLeuAlaCluLeuCluAlaLysCluSer&laAlaAlaAsnEnd CGCCCTGCGACGTTCCCCCCCGCCGCCCGGTGAGGCCCACCCCCGACGGAAGC000CCAC ......... + ......... + ......... + ......... 4. . . . . . . . . . + ......... +
1320
CTCCAACAAGCCCTCTTCGC~AGGCCATACTCCATCACACGACAGGCATATOACC ......... +......... +......... + ......... + ......... + ..... 1375 NeCSer
Fig. 2. Complete nt sequence of the R. rubrum hi)71 gene and the N terminusofthe n0~ 8ene. The region with similarityto the n/~specific promoter is underlined.The two proposedupstreamactivator sequences are in boldface type and the putative Shine-Dalgarno sequences are overlined. Conserved Cys residues are in boldface type. Deletion-
containing plasmidsused for sequencingwere preparedusing the Erasea-Base kit (Promega,Madison, WI). Sequencingsubstratewas prepared according to Sadhu and Gedamu (1988). Sequencing reactions were performedwith the Sequenase Kit (U.S. Biochemicals,Cleveland, OH), the MI3 Universal and Reverse primers (Promega) and [35S]dATP (Amersham, Arlington Heights, IL). Both 6Yo linear and 4% wedge polyacrylamidegels were employed.The entire regionwas sequenced on both strands and analyzed using the University of Wisconsin Genetics Computer Group software package (Devereux et al., 1984). The identification of nt 1370 as the start of n~D was confirmed by sequencing 200 bp into the gene (data not shown). The nt sequencedata reportedin this paper will appear in the EMBL, Genbank, and DDBJ Nucleotide Sequence Databases under the accession number M33774.
146
1980), creating pLLI09. This construct was mobilized into R. rubrum UR2 by pRK2013 (Ditta et al., 1980) at a frequency approaching 100%. The incompatible plasmid, p P H I J I (Hirsch and Beringer, 1984), was then mobilized into the strains containing pLLI09, with selection for the cassette (10/~g Km/ml) and p P H I J I (15/~g Sp/ml). Mutants o f the desired phenotype were obtained at a frequency of 10 -a. The resulting strain, URI56, was analyzed by Southern hybridization and shown to contain only the mutated copy of nil/-/(Fig. 3). This mutant strain was able to grow photosynthetically (20 W/m 2, red t'dter) when ammonia was supplied, but was unable to grow without exogenously supplied ammonia. When the mutant was assayed for in vivo nitrogen fixation activity by the acetylene reduction assay, no activity was detected. The status of the n/f/-/gene product was determined by pulse-labeling derepressed cul-
tares with Trans 3aS-label (ICN Radiochemical, Irvine, CA) and subjecting the extracts to two-dimensional gel electrophoresis. The resulting autoradiograms (Fig. 4) demonstrated that neither the n/fH nor nifDK gene product (labeled as II and I, respectively) was being synthesized under derepressing conditions, implying the operon arrangement of nifl-lDK that has been found in a majority of diazotrophs. The cloning and characterization of the n/fH gene o f R. rubrum, together with the isolation and sequencing o f draTG (Fitzmaurice et al., 1989), yields a system for the study o f ADP-ribosylation in which both the substrate and
9
ql
bdl
9P,. Fig,3. Southern hybridization analysis of the Kin.cassette-containing strain (sectionc) usingpLLI01 as the probe (see Fig, I). Identicalresults were seen usingthe nlfHgeneofK. pneumontae(on pjC362)as the probe. Lane I shows the wt EcoR! pattern of 1.I-, 1.3., and 2.l-kb fragments. Lane 2 is the pattern al~erintroductionofpLLl09. A 3.6.kbfragmentdue to the mutagenizednb'H (2.1 + 1.$ kb) is present in severalcopies, yield. ing a more intense band relative to the wt, Lane 3 shows the pattern of URI$6, containingonly the mutated copy of n07/and not the wt copy. For preparation of total cellular DNA0one ml of stationary phase cells was centrifugedand resuspendedin 200 ~1orS0 mM Tris pH 8.0/20mM EDTA/100pg per ml proteinaseK/0.5~ SDS. Afterincubationfor 3-5 h at $0°C, the mixture was extracted successivelywith phenol, phenol/ chloroform,and chloroform,taking care not the shear the DNA. The aqueous layer was precipitated with ethanol, vacuum-dried,and resuspended in 50/~1 of sterile double.distilled water. Hybridizationprobes were labeledwith [~.32P]dATP(Amersham)by the oligo-labelingprotocol (Feinbergand Goldstein, 1984).The DNA was resolvedusing a 0.8% TBE (0.089M Tris-borate/0.089M boric acid/0.002M EDTA) agarose gel. Southern hybridization(42°C) and washi.'lgconditions were those specified in the GENE-TECT (Clontech, Pain Alto, CA) instructions. The most stringent wash was done at 50°C in 0.1~ SDS/0.15% SSC (i x SSC is 0.15M NaCI/0.015M Na3 .citrate pH 7.0).
"
II ,,,J~
Fig.4. Two-dimensional gel electrophoresisof extractsfrom R, rubrum UR2 (nl/"~)(top) and URI56 (n0~/I068) (bottom). Arrows show the positions of Rrl (the products of n~fD and X~,marked I) and Rr2 (the product ofntyH,marked II) in UP,7.and demonstratethe absenceof'these proteins in UR156.R. mbrumUR2 (a SmR [100/AgSm/ml] derivativeof ATCCI 1170)and mutant cultureswere derepressedfor nitrogenfixation by first growing the strains photosyntheticallyin MN media to an ,46oo of approx. !, then anaerobicallywashing and resuspending the cells in MG at an Aeooof 0.2. Media used are described elsewhere (D. Lies, W.P.F., L.J.L, and G.P.R., submitted). The cultures were placed under photosyntheticconditionsfor 6-7 h to allowderepressian.Derepression of nitrogenfixationwas assayedin vivoby whole-cellacetylenereduction (Kanemoto and Ludden, 1984).Samples were prepared as described in Bonam et 8.1.(! 989).The gel electropboresisprotocolwas that ofRoberts et aL (1978),
147
modifying enzymes have been purified, cloned and sequenced. This will allow us to investigate ADP-ribosylation in a well-characterized model system.
ACKNOWLEDGEMENTS
We thank Haian Fu, Douglas Lies, and Paul W. Ludden for helpful discussions. This work was supported by the College of Agricultural and Life Sciences, University of Wisconsin-Madison, and by USDA grant 87-CRCR-12561 to G.P.R. and P.W. Ludden. L.J.L. was the recipient of a NSF predoctoral fellowship.
REFERENCES Beynon, J., Cannon, M., Buchanan-Wollaston, V. and Cannon, F.: The n~f promoters of KlebsieUa pneumoniae have characteristic primary structure. Cell 34 (1983) 665-671. Bonam, D., Lehman, LJ., Roberts, G.P. and Ludden, P.W.: Regulation of carbon monoxide dehydrogenase and hydrogenase in Rhodospiril. lure rubmm: the effects of CO and oxygen on synthesis and activity. J. Baoteriol. 171 (1989) 3102-3107. Buck, M., Miller, S., Drummond, M. and Dixon, R.: Upstream activator sequences are present in the promotors of nitrogen fixation genes. Nature 320 (1986) 370-378. Collins, J.C. and Brill, WJ.: Control of Klebsiella nil mRNA synthesis. J. Bacteriol. 162 (1985) 1186-1190. Devereux, J., Haeberli, P. and Smithies, O.: A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12 (1984) 387-395. Ditta, F., Stanfleld, S., Corbin, D. and Helinski, D.R.: Broad host range DNA cloning system for Gram negative bacteria: construction of a 8ene bank ofRhi:oblum mdlloll. Proc. Natl. Acad. Sci. USA 77 (1980) 7347-7351. Feinber$, A.P. and Vogelstein, B.: A technique for radiolabelin8 DNA restriction endonu¢leue fregments to high specific activity. Anal. Bioohem. 137 (1984) 266-267. Fitzmanrice, W,P., Saari, L.L., Lowery, R.G., Ludden, P.W. and Roberts, G.P.: Genes ending for the reversible ADP-ribosylation system of
dinitrogenase reductese from RAodosp'~0um rubvum. Mol. Gun. Oenet. 218 (1989) 340-347. Fornari, C.S. and Kaplan, S.: ldantification of nitrogenase and carboxylase genes in the photosynthetic bacteria and cloning of a carboxylase gene from P.hodopseudomonas sphaemades, Gene 25 (1983) 291-299. Hirsch, P.R. and Beringer,J.F-: A physicalmap of pPHIJI and pJB3JL Plasmid 12 (1984) 139-141. Jones, R. and Haselkom, R.: The DNA sequence of the RAodobac~er capsu/amsn~fH gene.Nucleic Acids Reg. 16 (1988) 8735. Kamen, M.D. and Gust, H.: Evidence for a nitrngenase system in the photosynthetic bacterium RAodospZn~umrubrum. Science 109 (1949) 560. Kanemoto, R.H. and Ludden, P.W.: Effect of ammonia, darkness, and phenazine methosulfate on wbole-ceH nitrogenase activity and Fe protein modification in RAodospmf//umrubmm.J. Bacteriol. 158 (1984) 713-720. Ludden, P.W. and Burris, R.H.: Activating factor for the iron protein of nitrogenase from RAodospirOlumrubrum. Science 194 (1976) 424-426. Ludden, P.W., Lehman, L.J. and Roberts, G.P.: Reversible ADP-ribosylation ofdinitrogenase reductase in a NifD - mutant of RAodospO~ lure rubmm. J. Bacteriol. (1989) $210-$211. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cionin~ A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. Roberts, G.P., MacNeil, T., MacNeil, D. and Brill, WJ.: Regulation and characterization of protein products coded by the n0e (nitrogen fixation) genes of Klebsiella pneumoniae. J. Bacteriol. 136 (1978) 267-279. Sadhu, C. and Gedamu,L.: A procedurefor the preparationof RNA-frce plasmid DNA. BioTechnology6 (1988) 20-21. Scolnik, P.A. and Haselkorn, R.: Activation of extra copies of genes coding for nitrogenase in Rbodopseudomonas capsulata. Nature 307 (1984) 289-292. Scott, K.F., Rolfe, B.G. and Shine, J.: Biological nitrogen fixation: primary structure of the Klebslellapneumonlaenull and nUD genes. J. Mol. AppL Genet. i (1981) 71-81. Vieira, J. and Messing, J.: The pUC plesmids, an M i 3-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19 (1982) 259-268. Yaniseh-Perron, C., Vieira, J. and Messing, J.: Improved M13 phage cloning vectors and host strains: nucleotide sequence of the MI3mpl8 and pUCI9 vectors, Gene 33 (1985) 103-119.
143
GENE 03727
The cloning and functional characterization of the nifl-I gene of Rhodospiriilum rubmm (Nitrogen fixation; ADP-ribosylation; recombinant DNA; photosynthetic bacteria)
L.J. Lehman, W.P. Fitzmauriee* and G.P. Roberts Department of Bacteriology and the Center for the Study of Nitrogen Fixation, College of Agricultural and L~fe Sciences, University of Wisconsin-Madison, Madison, WI 53 706 (U.S.A 0 Received by C.R. Hutchinson: 21 August 1989 Revised: 20 December 1989 Accepted: 11 July 1990
SUMMARY
Dinitrogenase reductase (the n/fH product) from Rhodospirglum rubrum is regulated by a post-translational modification system encoded by draTG. As demonstrated in this report, the cloning, sequencing, and functional characterization of the n/fH gene provides a basis for further analysis as well as revealinginteresting features ofgene organization. The coding regions of n0~Hand draT are separated by only 400 bp, though the genes are divergentlytranscribed and differentiallyregulated. The construction of a nOT/insertion caused a Nil- phenotype and destroyed the mutant's ability to synthesize both dinitrogenase and dinitrogenase reductase, verifying functionality and transcriptional organization of the nifHDK genes.
INTRODUCTION
RhodospirUlum rubrum is a free.living, purple, nonsulfur photosynthetic bacterium that fixes nitrogen (Kamen and Gest, 1949). It is also the first organism shown to employ a post-translational system for the regulation of this process (Ludden and Burris, 1976). The system has been found to consist of two enzymes, DRAT and DRAG, that respond to the levels of light and ammonia (Kanemoto and Ludden, 1984) sensed by the cell. The response entails the reversible
modification of Rr2, a component of the nitrogenase complex, controlling its activity. Rr2 is a dimer of identical subunits encoded by the n/fH gene whose role in nitrogen fixation is to reduce Rrl which then reduces dinitrogen to ammonia. To fullyutifize the Rr2/DRAG/DRAT system as a model for regulation by reversible ADP-ribosylation, cloning and characterization of mf/-/were necessary and the aim of the present study. Determination of the number of functional copies of the n/fH gene was also important as the related bacterium Rhodobacter capsulatus (Scolnik and Haselkorn, 1984)appears to have multiple copies based on reversion of transposon insertions.
Correspondence to: Dr. G.P. Roberts, Department of Bacteriology, University of Wisconsin, Madison, WI 53706 (U.S.A.) Tel. (608)262-3567; Fax (608)262-9865. * Present address: Department of Genetics, North Carolina State University, Raleigh, NC 27695 (U.S.A.) Tel. (919)737-2287. Abbreviations: aa, amino acid(s); ADP, adenosine 5'-diphosphate; bp, base pair(s); DRAG, dinitrogenase reduetase-activating glycohydrolase; DRAT, dinitrogenase reductase ADP-ribosyltransferase; K., Klebsiella; kb, kilobase(s) or 1000bp; Km, kanamycin; nt, nucleotide(s); R., Rhodospi~llum;Rrl,dinitrogenase from R. rubrum;Rr2,dinitrogenase reductase from R. rubrum; SDS, sodium dodecyl sulfate; Sin, streptomycin; Sp, spectinomycin; wt, wild type. 0378-1119/90/$03.50© 1990Elsevier SciencePublishers B.V.(BiomedicalDivision)
EXPERIMENTAL AND DISCUSSION
(a) Isolation of Rhodosplrillum rubrum niflt Under stringent Southern analysis conditions, R. rubrum chromosomal digestions demonstrated strong hybridization to a K. pneumoniae nifHD prob~ as previously observed by Fornari and Kaplan (1983). There appeared to be only one strongly hybridizing region by Southern analysis (Fig. 3) at high or low stringency. Another faintly
144
Southern hybridization analysis with the K. pneumoniae probes pjC362, pJCl51, and pKPl (Fig. 1), were purified. This analysis indicated that the n/fH, n/fD, and n/fK genes were located near each other. As shown in section e, the n/f//- mutant was found to synthesize neither Rr2 nor Rrl (nij'DK gene products), suggesting the genes are cotranscribed. This conclusion was further supported by the characterization of a strain, UR 145, with an insertion in the n/fD-homologous region. This strain was able to synthesize Rr2, but was unable to synthesize Rrl (Ludden et al., 1989). Similarities of the phage restriction map to that of the R. rubrum draTG genes (Fitzmaurice et al., 1989) were noted and pJC362 was used to probe a draTG-contalning phage clone. This probe detected a 3.2-kb BarnHI fragment just as was observed in the R. rubrum nifHDK clones,
hybridizing fragment was observed, but its significance is unclear, as a mutant containing an insertion in nifH does not demonstrate nitrogenase activity or revert to Nit"÷ (see section e). While in K. pneumoniae a single copy of this gene is present, R. capsulatus (Scolnik and Haselkorn, 1984) and some other diazotrophs appear to have multiple copies. We were able to detect and clone the n/f/-/ gene of R. nabrum from a 2EMBL4 R. rubrum library into E. coli DHSa (BRL, Oaithersburg, MD) using K.pneumoniae nO'liD from pJC362 (Collins and Brill, 1985) (Fig. 1). ,~EMBL4 lysates and DNA were prepared from plates as described in Maniatis et al. (1982) with the substitution of purified afar for standard afar. Three distinct overlapping phage clones, as determined by restriction mapping and
K. pneumonlae s
nifY nlfT
nifK
pJC1Sl
K
nifD
nifH
,
nifJ
pKPl
pJC362
,, ,,,
R. rubrum H
I
B ,°,
.
.
.
.
.
.
nifK
pLL102
.
.
.
.
nifD
E
B,.R
1
I/
nifH
E .
.
.
.
.
.
.
.
.
.
dra T
.
.
l
.
H .
.
.
.
]
.
draG
,, pLL101 pLL106
1 kb Fig. I. Restrictionmaps of the nO~IDKregionsof K. pneumonlaeand R. rubnamand the relevantplasmids.The Sail site in niftl erR. rubrumwas the site of the Krn cassetteinsertion(sectione). B, BamHI; E, EcoRi; H, Htndlll; K, Kpnl; and S, Sail. Severalrestrictionfragmentscontainingregions ofn0~/homologyweresulglonedinto pUCI9 (Yanisch-Perronet al., 1985),creatingpLLI01, pLLI02, and pLLI06. PlasmidspJCiSl and pjC362 are pBR322 derivativescontainingthe indicatedSail n~rfragments(Collinsand Brill, 1985).PiasmidpKPI is a pUCI9 derivativecontainingthe indicated Kpnl-EcoRl n~" fragmenL
145 GGGGATGGG/~GG_AGGG&CCGI~G~,ACCt~G&AC .........
+ .........
+ .........
+ .........
t~I~GG~CG~1-x-t-t + .........
CGCCC
+ .........
÷
60
demonstrating that draTG and nifltDK are closely linked in R. rubrum.
AT]~GCI"I"f&TGACCGATCGGGGGGCC~.GGGGAAGGG C G ' [ ~ C I ~ G G C A G T A G C G G \ C C & T G .........
+ .........
GCGGATAGGG~:G~CCG ......... + .........
+ .........
+ .........
+ .........
ClWJL'I~GG~GGCGAGAGGG~ + ......... + ......... + .........
+ ..........
+
120
~ G + .........
+
180
GTI'IqICGACACCGTTGAAAAT/LACCCTACATTGCTTCTT&GATAGATTTATTCb ~-xtGAT .........
+ .........
+ .........
+ .........
÷ .........
TAAAAACGATAA-t~t~ - i C ~ U c a . ~ T C G G G C / ~ q T C A ~ C A C G .........
+ .........
+ .........
÷ .........
CG GG G I ~ & G C G I ~ G C GGIT, C~G G1"1~ CC C ~ A C G & C . . . . . . . . .
+ .........
÷ .........
+
240
CTGGGTGCATTAA + .........
+
300
CGG&TC&CG&AGA#~AG G A T f
360
+ . . . . . . . . . + . . . . . . . . . + . . . . . . . . . + . . . . . . . . . + . . . . . . . . . +
G&~[I~,&~&GGGC~GTGCGTC&G&TGGGb"I~CTACCGCAAGGGGCGT&~:GG~CG ......... + ......... + ......... + ......... + ......... + .........
+
420
NetSerAlaLauArsGluI leAlaPheTyrGlyLysGlyGlyIleGlyLysSe r ACGACGTCG~GAACACGC~GGCCGGTCTGG~G/L:~ATGGGCCAGCGGATCCI~ATfGTC ......... + ......... + ......... + ......... + ......... + ......... +
480
Th~fhl:SezGlt~qsnTh~LeuAlaAlaLeuValGluHe c G l y G l n A r g l l e L e u l l e V a l CGC'JL'G CG&TCCGAAGG CCGATTCCACCCGC CTGATCCI'GAACACCAAG CTG C'&GCACACC ......... + ......... + ......... + ......... + ......... + ......... +
$40
GlyCysAspProLysAlaAspSet~hrA~gLeulleLeuAsnThrLysLeuGlt~AspThr G I ~ G ~ r C A T C ~ G C C G G C O A G G C C G G CTCGG~CGAAGAC C T C G & C G T C G C C G & ~ T G G ~ G ......... + ......... + ......... + ......... ÷ ......... + ......... +
600
ValLeutlS s L e u A l a A l a f l u A l a f l y S e r V a l f l u A s p L e u A s p V a l A l a A s p V a l V a l AAGATCGG CTACAAGGGCATCAAGI'GCACCGAATC CGCTCGTCCC(~AGCCCGG CGTOGGC ......... + ......... + ......... + ......... + ......... + ......... +
660
LyslleGlyTyrLysGlylleLys~yeTh~OluSe~:GlyGlyProGluProClyValCly TG'I'G CCCCCCGTGCCGTG&TCAC CGCCATCAAGTTCCTTG,%COAAAACGG CC CGTACC&C ......... + ......... + ......... + ......... + ......... + ......... 4.
720
L'y~qlaGlyArgClyVal n e T h ~ : & l a I leAsnPheLeuClu01uAsuClyAtaTyr,qsP GACGTCOATI'ACCTCTCTT&GCACGTGCTG0CCCACGTGGTTTGCGGTGGCTTCCCC~.TG ......... + ......... + ......... + ......... 4. . . . . . . . . . + ......... +
780
AspLeuAspTyrValSe~:Tyr&spVatLeuflyAspValValCysGlyClyPheAlaHeC CCC&TCCG CC&GAACAAGGCTCACCAAATCTACATGCTC&TGTCCC C C C A ~ T C A T G G C C ......... + .... , . . . . 4. . . . . . . . . . + ......... + ......... + ......... +
8/*0
P r o I l ~ q r ftCluAsnLys&laC l u 0 1 u I l e T y ~ I l e V a l H e CSerClyCluHe CMeCAla GTOTA'I'OCCCCCAACAAC~TGC GC . ~ , G G C C . q i ~-~ Sx?,AAAT&CGGGCA~C C C G ~ G C C ~
......... +......... + ......... + ......... + ......... + ......... + LeuTyl:&laAl~qsnksul t e / ~ l a L y a O l y Z l e L e u L y a ~ r A l a l U s T h ~ C l y O l y V a l COTCTOOOCO~TCI~.'~'fCTOC/~.COAOCOTCAO~CTO&TAAO0~OTCC~C~ CCOAO ......... 4, . . . . . . . . . .',.. . . . . . . . . 4.. . . . . . . . . 4. . . . . . . . . . ÷ ......... ÷ A~SI~u0 l y C l y L e u I teCy~qsn0 lu&~$OlnThrAspLysGluValOluLeuAlaClu
900
960
OGCCTOOCCGGCCOTTTOGOO'I'GCGGCCTCATOr.AGT~GGTGGCGCGCG&CAAOGGCOTT
.........
÷ .........
+ .........
+ .........
+ .........
+ .........
+
(b) Sequeaee analysis The n/fH-hybridizing region was sequenced (Fig. 2) and extensive sin~larity was noted to the n/f// genes of K. pneumon/ae (Scott et al., 1981) and R. capsulatus (Jones and Haselkorn, 1988) at both the nt (75~0 and 8 3 ~ , respectively) and aa levels (71~o and 8 6 ~ , respectively). This homology allowed exact localization of the n/f//gene. The 885 bp of the ORF could code for a protein of 35.4 kDa, consistent with the pubfished 30-kDa size. On the nt level, the physical "arrangement' of the n/f// gene is similar to that of K. pneumon/ae and others. N o E. coli-type promoter was found, but a 'n/f promoter sequence (Beynon et al., 1983) is present at 71 bp and 84 bp upstream from the start codon of the gene. A characteristic A + T-rich region was found just upstream from the proposed promoter. Additionally, two examples of upstream activator sequences are located at 177bp and 207 bp upstream from the initial Met, as seen upstream from other n/f regions (Buck et al., 1986). Sequence analysis of the region downstream from n/fH placed the initial Met ofmfD 116 bp from the end of n/f//, a relatively long interval between cotranscribed genes. The niftt and draT genes are divergently transcribed, with 400 nt separating their coding regions. The implications of this arrangement of the genes coding for this reversible regulatory system and its substrate are unknown, but may provide an opportunity for some degree of co-regulation. Since the identity and location of the dra promoter is not known, it is unclear if the regulatory elements controlling draTG overlap with those of nifltDK in a manner that affects the regulation of either operon.
1020
Alal~uAtaOlyArsLeuOlyCysAql~ul IeHIs~heV~IP~o&~spAsnOIyVaI CAGCACCCC~AOCTOCOCCOCOAAACOGTO&TCCAAT&C0CCCCCOACACC~C~CCCC .........
+ .........
+ .........
+ .........
+ .........
+ .........
+
1080
G l n l l i | k l a O l u L e u a r & q r BClnTh~ValIleClnTyr&IaI~roAspSe I:LYsOI n A t a GGTC>ATCCCACCCTGCC~&CCAAG&TCC&CAACAACTOCGGCCAGGC CGTGGTCCCC .........
+ .........
+ .........
+ .........
+ .........
+ .........
+
1140
GlyCluTyl:&rsTh~:LeoAlaThrLys XleH £ sAsuAsuSe rG l y G I u C l y V a l V a l P r °
(C) Cassette mutagenesis The mfH gene on pLL106 was mutagenized by cloning a Km cassette from pUC-4K (Vieira and Messing, 1982) into the SolI site (Fig. 1). The mutagenized fragment was then cloned into the EcoRl site of pRK290 (Ditta et al.,
ACCCC0&TCAGC&TGCAACACCT00AACAOATGCTCATC~AATTCCGCATCATGAAGTCC .........
+ .........
+ .........
+ .........
+ .........
+ .........
+
1200
T h r P ~oI leThl~Me cGluAspLeuGluGlul4e cLeu~e CGluPheGlylleHeCLysSe r (~&CCAACAGGCGGTGGCOGA~CTCCAAGCCAAGOAATCCGCCGCCCCCAATTAACOCCCT ......... + ......... + ......... + ......... + ......... + ......... 4.
1260
&spCluCluAlaLeuAlaCluLeuCluAlaLysCluSer&laAlaAlaAsnEnd CGCCCTGCGACGTTCCCCCCCGCCGCCCGGTGAGGCCCACCCCCGACGGAAGC000CCAC ......... + ......... + ......... + ......... 4. . . . . . . . . . + ......... +
1320
CTCCAACAAGCCCTCTTCGC~AGGCCATACTCCATCACACGACAGGCATATOACC ......... +......... +......... + ......... + ......... + ..... 1375 NeCSer
Fig. 2. Complete nt sequence of the R. rubrum hi)71 gene and the N terminusofthe n0~ 8ene. The region with similarityto the n/~specific promoter is underlined.The two proposedupstreamactivator sequences are in boldface type and the putative Shine-Dalgarno sequences are overlined. Conserved Cys residues are in boldface type. Deletion-
containing plasmidsused for sequencingwere preparedusing the Erasea-Base kit (Promega,Madison, WI). Sequencingsubstratewas prepared according to Sadhu and Gedamu (1988). Sequencing reactions were performedwith the Sequenase Kit (U.S. Biochemicals,Cleveland, OH), the MI3 Universal and Reverse primers (Promega) and [35S]dATP (Amersham, Arlington Heights, IL). Both 6Yo linear and 4% wedge polyacrylamidegels were employed.The entire regionwas sequenced on both strands and analyzed using the University of Wisconsin Genetics Computer Group software package (Devereux et al., 1984). The identification of nt 1370 as the start of n~D was confirmed by sequencing 200 bp into the gene (data not shown). The nt sequencedata reportedin this paper will appear in the EMBL, Genbank, and DDBJ Nucleotide Sequence Databases under the accession number M33774.
146
1980), creating pLLI09. This construct was mobilized into R. rubrum UR2 by pRK2013 (Ditta et al., 1980) at a frequency approaching 100%. The incompatible plasmid, p P H I J I (Hirsch and Beringer, 1984), was then mobilized into the strains containing pLLI09, with selection for the cassette (10/~g Km/ml) and p P H I J I (15/~g Sp/ml). Mutants o f the desired phenotype were obtained at a frequency of 10 -a. The resulting strain, URI56, was analyzed by Southern hybridization and shown to contain only the mutated copy of nil/-/(Fig. 3). This mutant strain was able to grow photosynthetically (20 W/m 2, red t'dter) when ammonia was supplied, but was unable to grow without exogenously supplied ammonia. When the mutant was assayed for in vivo nitrogen fixation activity by the acetylene reduction assay, no activity was detected. The status of the n/f/-/gene product was determined by pulse-labeling derepressed cul-
tares with Trans 3aS-label (ICN Radiochemical, Irvine, CA) and subjecting the extracts to two-dimensional gel electrophoresis. The resulting autoradiograms (Fig. 4) demonstrated that neither the n/fH nor nifDK gene product (labeled as II and I, respectively) was being synthesized under derepressing conditions, implying the operon arrangement of nifl-lDK that has been found in a majority of diazotrophs. The cloning and characterization of the n/fH gene o f R. rubrum, together with the isolation and sequencing o f draTG (Fitzmaurice et al., 1989), yields a system for the study o f ADP-ribosylation in which both the substrate and
9
ql
bdl
9P,. Fig,3. Southern hybridization analysis of the Kin.cassette-containing strain (sectionc) usingpLLI01 as the probe (see Fig, I). Identicalresults were seen usingthe nlfHgeneofK. pneumontae(on pjC362)as the probe. Lane I shows the wt EcoR! pattern of 1.I-, 1.3., and 2.l-kb fragments. Lane 2 is the pattern al~erintroductionofpLLl09. A 3.6.kbfragmentdue to the mutagenizednb'H (2.1 + 1.$ kb) is present in severalcopies, yield. ing a more intense band relative to the wt, Lane 3 shows the pattern of URI$6, containingonly the mutated copy of n07/and not the wt copy. For preparation of total cellular DNA0one ml of stationary phase cells was centrifugedand resuspendedin 200 ~1orS0 mM Tris pH 8.0/20mM EDTA/100pg per ml proteinaseK/0.5~ SDS. Afterincubationfor 3-5 h at $0°C, the mixture was extracted successivelywith phenol, phenol/ chloroform,and chloroform,taking care not the shear the DNA. The aqueous layer was precipitated with ethanol, vacuum-dried,and resuspended in 50/~1 of sterile double.distilled water. Hybridizationprobes were labeledwith [~.32P]dATP(Amersham)by the oligo-labelingprotocol (Feinbergand Goldstein, 1984).The DNA was resolvedusing a 0.8% TBE (0.089M Tris-borate/0.089M boric acid/0.002M EDTA) agarose gel. Southern hybridization(42°C) and washi.'lgconditions were those specified in the GENE-TECT (Clontech, Pain Alto, CA) instructions. The most stringent wash was done at 50°C in 0.1~ SDS/0.15% SSC (i x SSC is 0.15M NaCI/0.015M Na3 .citrate pH 7.0).
"
II ,,,J~
Fig.4. Two-dimensional gel electrophoresisof extractsfrom R, rubrum UR2 (nl/"~)(top) and URI56 (n0~/I068) (bottom). Arrows show the positions of Rrl (the products of n~fD and X~,marked I) and Rr2 (the product ofntyH,marked II) in UP,7.and demonstratethe absenceof'these proteins in UR156.R. mbrumUR2 (a SmR [100/AgSm/ml] derivativeof ATCCI 1170)and mutant cultureswere derepressedfor nitrogenfixation by first growing the strains photosyntheticallyin MN media to an ,46oo of approx. !, then anaerobicallywashing and resuspending the cells in MG at an Aeooof 0.2. Media used are described elsewhere (D. Lies, W.P.F., L.J.L, and G.P.R., submitted). The cultures were placed under photosyntheticconditionsfor 6-7 h to allowderepressian.Derepression of nitrogenfixationwas assayedin vivoby whole-cellacetylenereduction (Kanemoto and Ludden, 1984).Samples were prepared as described in Bonam et 8.1.(! 989).The gel electropboresisprotocolwas that ofRoberts et aL (1978),
147
modifying enzymes have been purified, cloned and sequenced. This will allow us to investigate ADP-ribosylation in a well-characterized model system.
ACKNOWLEDGEMENTS
We thank Haian Fu, Douglas Lies, and Paul W. Ludden for helpful discussions. This work was supported by the College of Agricultural and Life Sciences, University of Wisconsin-Madison, and by USDA grant 87-CRCR-12561 to G.P.R. and P.W. Ludden. L.J.L. was the recipient of a NSF predoctoral fellowship.
REFERENCES Beynon, J., Cannon, M., Buchanan-Wollaston, V. and Cannon, F.: The n~f promoters of KlebsieUa pneumoniae have characteristic primary structure. Cell 34 (1983) 665-671. Bonam, D., Lehman, LJ., Roberts, G.P. and Ludden, P.W.: Regulation of carbon monoxide dehydrogenase and hydrogenase in Rhodospiril. lure rubmm: the effects of CO and oxygen on synthesis and activity. J. Baoteriol. 171 (1989) 3102-3107. Buck, M., Miller, S., Drummond, M. and Dixon, R.: Upstream activator sequences are present in the promotors of nitrogen fixation genes. Nature 320 (1986) 370-378. Collins, J.C. and Brill, WJ.: Control of Klebsiella nil mRNA synthesis. J. Bacteriol. 162 (1985) 1186-1190. Devereux, J., Haeberli, P. and Smithies, O.: A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12 (1984) 387-395. Ditta, F., Stanfleld, S., Corbin, D. and Helinski, D.R.: Broad host range DNA cloning system for Gram negative bacteria: construction of a 8ene bank ofRhi:oblum mdlloll. Proc. Natl. Acad. Sci. USA 77 (1980) 7347-7351. Feinber$, A.P. and Vogelstein, B.: A technique for radiolabelin8 DNA restriction endonu¢leue fregments to high specific activity. Anal. Bioohem. 137 (1984) 266-267. Fitzmanrice, W,P., Saari, L.L., Lowery, R.G., Ludden, P.W. and Roberts, G.P.: Genes ending for the reversible ADP-ribosylation system of
dinitrogenase reductese from RAodosp'~0um rubvum. Mol. Gun. Oenet. 218 (1989) 340-347. Fornari, C.S. and Kaplan, S.: ldantification of nitrogenase and carboxylase genes in the photosynthetic bacteria and cloning of a carboxylase gene from P.hodopseudomonas sphaemades, Gene 25 (1983) 291-299. Hirsch, P.R. and Beringer,J.F-: A physicalmap of pPHIJI and pJB3JL Plasmid 12 (1984) 139-141. Jones, R. and Haselkom, R.: The DNA sequence of the RAodobac~er capsu/amsn~fH gene.Nucleic Acids Reg. 16 (1988) 8735. Kamen, M.D. and Gust, H.: Evidence for a nitrngenase system in the photosynthetic bacterium RAodospZn~umrubrum. Science 109 (1949) 560. Kanemoto, R.H. and Ludden, P.W.: Effect of ammonia, darkness, and phenazine methosulfate on wbole-ceH nitrogenase activity and Fe protein modification in RAodospmf//umrubmm.J. Bacteriol. 158 (1984) 713-720. Ludden, P.W. and Burris, R.H.: Activating factor for the iron protein of nitrogenase from RAodospirOlumrubrum. Science 194 (1976) 424-426. Ludden, P.W., Lehman, L.J. and Roberts, G.P.: Reversible ADP-ribosylation ofdinitrogenase reductase in a NifD - mutant of RAodospO~ lure rubmm. J. Bacteriol. (1989) $210-$211. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cionin~ A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. Roberts, G.P., MacNeil, T., MacNeil, D. and Brill, WJ.: Regulation and characterization of protein products coded by the n0e (nitrogen fixation) genes of Klebsiella pneumoniae. J. Bacteriol. 136 (1978) 267-279. Sadhu, C. and Gedamu,L.: A procedurefor the preparationof RNA-frce plasmid DNA. BioTechnology6 (1988) 20-21. Scolnik, P.A. and Haselkorn, R.: Activation of extra copies of genes coding for nitrogenase in Rbodopseudomonas capsulata. Nature 307 (1984) 289-292. Scott, K.F., Rolfe, B.G. and Shine, J.: Biological nitrogen fixation: primary structure of the Klebslellapneumonlaenull and nUD genes. J. Mol. AppL Genet. i (1981) 71-81. Vieira, J. and Messing, J.: The pUC plesmids, an M i 3-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19 (1982) 259-268. Yaniseh-Perron, C., Vieira, J. and Messing, J.: Improved M13 phage cloning vectors and host strains: nucleotide sequence of the MI3mpl8 and pUCI9 vectors, Gene 33 (1985) 103-119.