The codon 55 polymorphism in the paraoxonase 1 gene is not associated with the risk of coronary heart disease in Asian Indians and Chinese

Atherosclerosis 136 (1998) 217 – 223

The codon 55 polymorphism in the paraoxonase 1 gene is not associated with the risk of coronary heart disease in Asian Indians and Chinese Dharambir K. Sanghera, Nilmani Saha, M. Ilyas Kamboh * Department of Human Genetics, Graduate School of Public Health, 130 DeSoto Street, Uni6ersity of Pittsburgh, Pittsburgh, PA 15261, USA Received 12 June 1997; received in revised form 18 August 1997; accepted 26 August 1997

Abstract Recently several but not all studies have implicated the codon 192 polymorphism in the paraoxonase 1 (PON1 ) gene with the risk of coronary heart disease (CHD). These findings suggest that this polymorphism is not functional but rather may be in linkage disequilibrium with a functional mutation in the PON1 or a nearby gene. In this investigation, we have evaluated the role of another common polymorphism in the PON1 gene at codon 55 with the risk of CHD in a biracial sample of Asian Indians and Chinese. We observed a significant inter-racial variability in the allelic distribution as the frequency of the less common allele, codon 55/L, was significantly higher in Indians than Chinese (0.202 versus 0.036; PB 0.0001). However, despite this inter-racial difference the codon 55 polymorphism was neither associated with CHD risk nor with plasma lipoprotein – lipids variation in both racial groups. We also used two site haplotype data (codons 55 and 192) to assess the combined contribution of the two polymorphisms to the risk of CHD. There was a strong linkage disequilibrium between the two polymorphic sites in both racial groups (P B0.0001). While the haplotype data revealed no association with CHD in Chinese, the frequency of the BL haplotype was significantly higher (0.430 versus 0.311; P=0.004) and the frequency of the AL haplotype was significantly lower (0.368 versus 0.483; P =0.006) in Indian patients than controls. Since the B allele of the codon 192 polymorphism was shown to be an independent risk factor for CHD in Indians in our previous study, the positive association of the BL haplotype with CHD appears to be mediated by the B allele with no independent contribution from the codon 55 polymorphism. © 1998 Elsevier Science Ireland Ltd. Keywords: Paraoxonase; Genetic polymorphisms; Asian Indians; Chinese; CHD risk

1. Introduction CHD is a major cause of mortality in developed countries. A large number of genes are involved in determining inter-individual differences of biological parameters that are risk factors for CHD. For the past two decades, the major focus of most studies has been to establish the association of common polymorphisms in genes involved in lipid metabolism with plasma lipoprotein–lipid levels [1 – 3]. Recently, additional

* Corresponding author. Tel.: +1 412 6243061; fax: + 1 412 3837844; e-mail: [email protected]

genes, which do not participate in lipid metabolism but are involved in the development of atherosclerotic lesions, have been identified including, paraoxonase (PON) [4,5]. PON is an high density lipoprotein (HDL) bound enzyme and has popularly been known for its important role in providing protection against organophosphate compounds used in pesticides and nerve gases [6–8]. The association of PON with atherosclerosis appears to be due to its role in the antiatherogenic properties of HDL [9]. HDL-associated protection of low-density lipoprotein (LDL) oxidation is mediated through the catalytic action of HDL-associated enzymes such as PON which abolishes the activity

0021-9150/98/$19.00 © 1998 Elsevier Science Ireland Ltd. All rights reserved. PII S 0 0 2 1 - 9 1 5 0 ( 9 7 ) 0 0 2 0 6 - 2

218

D.K. Sanghera et al. / Atherosclerosis 136 (1998) 217–223

of toxic metabolites produced by LDL oxidation [10]. In vitro studies indicate that PON significantly reduces lipid peroxide generation by hydrolyzing biologically active LDL and thus plays a protective role by preventing the formation of fatty streaks [11]. Inactivation of PON by treating HDL with heat was also shown to reduce the ability of HDL to inhibit LDL oxidation [11,12]. There is considerable variation in serum PON activity within and between human populations [13,14] and this is believed to be under genetic control due to a common polymorphism at codon 192 in the PON1 gene which involves Gln to Arg subtitution [15,16]. The ‘A’ allele which codes for Gln is associated with lower PON activity and the ‘B’ allele which codes for Arg is associated with high PON activity. However, PON activity is also substrate specific and exihibits a wide variation with different substrates [17]. PON1 is a member of a multigene family which consists of two additional PON1 -like genes, designated PON2 and PON3, and they are all linked on human chromosome 7 [18]. However, the role of the other two PON genes in affecting PON activity is unknown. Serum PON activity has been shown to be depressed under disease states [19 – 22]. The PON activity also correlates with plasma concentrations of apolipoproteins and lipoprotein – lipids [23]. Recently, the B allele of the PON1 codon 192 polymorphic site has been shown to an independent risk for the CHD risk in some [24–26], but not in other [27,28] studies. These findings suggest that the B allele is not directly involved in the pathogenesis of CHD but it may be in linkage disequilibrium with a functional mutation in the PON1 or a nearby gene. There is another known polymorphism at codon 55 in the PON1 gene [15,16], which has recently been shown to be associated with CHD risk among diabetics [29]. To further explore the role of codon 55 polymorphism with CHD risk, we determined its distribution, relationship with plasma lipoprotein– lipid levels and CHD risk in Asian Indians and Chinese. We have also constructed two site haplotypes using the codons 55 and 192 polymorphisms and evaluated their combined effects on the risk for CHD.

2. Methods

2.1. Patients The study subjects comprised 114 unrelated Asian Indian CHD patients (101 males and 13 females) with an age range 32–83 years (mean age 54.890.9) and 119 Chinese CHD patients (117 males and two females) with an age range 35 – 81 years (mean age 58.99 0.7) residing in Singapore. All patients had undergone coronary artery bypass surgery during August 1989 to De-

cember 1992 at the Cardiothoracic Surgery Unit at Singapore General Hospital. Patients with a positive stress test (Bruce method) were evaluated for the presence of CHD by coronary angiography. Inclusion criteria were \ 50% narrowing of at least in one of the major coronary arteries. Patients with less obstruction or valvular disease were excluded. Myocardial infarctions (MI) had occurred in 48% of the Chinese and 57% of the Indian patients judged by typical ECG changes (Minnesota code 1.1 or 1.2 in the ECG) and changes in serum enzymes (AST, LDH, and CK). A detailed family history of CHD, hypertension, diabetes and smoking status was obtained from each patient.

2.2. Controls Control subjects were recruited from factories and the community as voluntary participants in the ‘Healthy Lifestyle Promotion Exercise’ sponsored by the factory authorities or community centers in Singapore. All control subjects were healthy and had no family history of any cardiovascular disease, diabetes or infection. Individuals were selected after careful physical examination, chest X-ray, ECG, urine and blood tests including, hemoglobin and glucose. These include 183 Asian Indians (163 males and 20 females) with an age range 19–81 years (mean age 43.39 1.0) and 181 Chinese (175 males and 6 females) with an age range 21–81 (mean age 45.991.0).

2.3. Clinical and metabolic estimations Recumbent blood pressure and a 12-lead ECG were recorded from each subject after a 30 min rest on a couch. The measurements for body height and weight were recorded and blood samples were collected by venipuncture after an overnight fast. Plasma was separated into three aliquots within 1 h of blood collection. One aliquote was precipitated with phosphotungstic acid–magnesium chloride and the supernatant was used to estimate HDL cholesterol on the same day. The second aliquot was used to estimate glucose, total cholesterol and triglyceride on the same day. The third aliquot was stored at −20°C to quantitate apo A-I and apo B levels. Buffy coats were separated and stored at −20°C until DNA was extracted. Plasma concentrations of total cholesterol, HDL-cholesterol and triglycerides were measured by using the manufacturer’s reagent kits using an autoanalyser while apo A-I and apo B levels were estimated using reagent kits (Roche) as described earlier [30]. LDL-cholesterol was estimated using Friedewald’s equation [31] in those samples with triglyceride levels B 400 mg/dl. Body mass index (BMI) was calculated by dividing weight (kg) by height (m2).

D.K. Sanghera et al. / Atherosclerosis 136 (1998) 217–223

219

Table 1 Demography and plasma lipoprotein–lipid and apolipoprotein variables in Asian Indian and Chinese patients and controls Indians

Males/females Age (years) BMI (kg/m2) Smokers (0/1/2)** LDL-cholesterol (mg/dl) HDL-cholesterol (mg/dl) Total cholesterol (mg/dl) Triglycerides (mg/dl) Apo A-I (mg/dl) Apo B (mg/dl)

Chinese

Controls (n =183)

CHD patients (n =114)

Controls (n = 181)

CHD patients (n= 119)

163/20 43.391.0 24.390.3 156/1/26 160.99 4.4 41.291.0 234.3 95.7 167.69 7.0 140.491.9 130.99 2.8

101/13 54.8 9 0.9* 25.2 9 0.3 67/21/24 153.1 9 3.9 27.2 91.0* 214.6 94.0** 173.0 9 9.5 97.8 95.4* 104.5 92.7*

175/6 45.9 9 1.0 23.6 90.2 113/13/49 159.2 9 3.9 47.9 9 1.2 244.0 9 4.3 162.1 9 13.0 139.8 9 2.4 113.5 9 2.9

117/2 58.9 90.7* 23.8 90.3 50/29/38 170.9 95.1 31.6 91.1* 233.7 95.6 156.3 97.7 91.2 92.6* 110.2 93.4

Values are mean 9S.E. ** 0 =never; 1 =ex-smoker; 2 = current smoker. * PB0.001; ** PB0.05 between controls and patients within a racial group.

2.4. Genetic screenings DNA was extracted from buffy coats as described [32] and was used to amplify the target sequences containing codons 192 and 55 polymorphic sites in the PON1 gene by the polymerase chain reaction (PCR). Primer information and PCR conditions to amplify the PON1 codon 192 region have been described previously [26]. The DNA fragment containing the codon 55 polymorphism was amplified using forward 5% GAAGAGTGATGTATAGCCCCAG 3% and reverse 5% TTTAATCCAGAGCTA ATGAAAGCC3% primers [16]. 0.5–1 mg Genomic DNA was amplified in 50 ml of reaction mixture containing 0.3 mM of each primer; 200 mM of each dNTP (Pharmacia); 5 ml of 10X reaction buffer (100 mM Tris – HCL (pH 9.0), 500 mM KCL, and 1% Triton X-100); 5% DMSO and 1.25 U Taq DNA polymerase. After denaturing DNA for 4 min at 94°C, the reaction mixture was subjected to 30 cycles of denaturating for 1 min at 94°C; 1.5 min annealing at 61°C and 1 min extension at 72°C. The codon 55 polymorphism was detected by digesting the PCR amplified product with the NlaIII restriction enzyme followed by size-fractionation in 3% nusieve (FMC corporation) agarose gel.

2.5. Statistical analyses Allele frequencies were calculated by allele counting. Hardy-Weinberg equilibrium was tested by using a x 2 goodness of fit test and comparison between cases and controls and between control samples was made using a x 2 test for a 2× k contingency table. The difference in allele frequencies between the two racial groups and between cases and controls within a group was calculated using a standard test of two binomial proportions [33].

Approximate normality of the distribution of all dependent variables were tested by using Lilliefor’s test for normality (a modified Kolmogorov-Smirnove test) separately in each racial group. Means and S.E.M. were calculated using one-way analysis of variance (ANOVA). Significant covariates for each dependent trait were identified by using Spearman’s correlation and stepwise multiple linear regression. Age and BMI were the significant covariates in all quantitative traits and ANOVA was performed on the combined sample of males and females after adjusting for sex in both racial groups. Analyses were done by excluding individuals with triglycerides ] 400 mg/dl. Assignment of haplotypes and their frequencies and linkage disequilibrium were estimated as described earlier [34]. All statistical analyses were carried out using the SPSS for Windows statistical package.

3. Results

3.1. Characteristics of patients and controls Demographical information and means of apolipoprotein and lipoprotein–lipid levels in two sets of controls and patients are summarized in Table 1. Compared to controls, the proportion of smokers or ex-smokers was higher in Indians (40 versus 15%; PB 0.001) and Chinese (57 versus 35%; PB 0.001) patients. There was no significant difference in plasma total or LDL-cholesterol levels between patients and controls in Chinese but total cholesterol values were lower in Indian patients than controls (PB 0.05). Plasma HDLcholesterol and apo A-I levels were significantly lower in both groups of patients than controls. While plasma apo B levels were similar among Chinese patients and controls, they were significantly lower in Indian patients

D.K. Sanghera et al. / Atherosclerosis 136 (1998) 217–223

220

Table 2 Distribution of the PON1 codon 55 polymorphism in Asian Indian and Chinese controls and patients Indians

Genotype LL LM MM Allele Frequency L M

Chinese

Controls (n= 183)

Patients (n =114)

Controls (n = 181)

Patients (n = 119)

119 (65.0)a 54 (29.5) 10 (5.5)

71 (62.3) 40 (35.1) 3 (2.6)

168 (92.8) 13 (7.2) 0 (0.0)

111 (93.3) 8 (6.7) 0 (0.0)

0.798 0.202

0.798 0.202

0.964* 0.036*

0.966 0.034

a

Figures in parentheses are percentage values. * Significant difference in allele frequency between Indian and Chinese controls (PB0.0001).

than controls (P B 0.001). The lower levels of total cholesterol and apo B levels in Indian patients than controls may be due to controlled diet and use of lipid lowering medications in CHD patients.

3.2. Distribution of the codon 55 polymorphism in cases and controls The distribution of the PON1 polymorphism at codon 55 is presented in Table 2. Three different genotypes (LL, LM and MM) due to the presence of the L (Leu) and M (Meth) alleles were observed. The genotype distribution was in Hardy-Weinberg equilibrium in all groups. The overall distribution pattern of genotype and allele frequencies varied significantly between the two racial groups. Compared to the Chinese controls, Indians had significantly lower frequency of the LL genotype (65.0 versus 92.8%; P B0.0001) and higher frequency of the LM genotype (29.5 versus 7.2%; PB 0. 0001). While 5.5% of the Indians were homozygous for the MM genotype, no Chinese subject with this genotype was observed. Consequently, the frequency of the codon 55/L allele was significantly higher in Indians than Chinese (0.202 versus 0.036; P B 0.0001). Despite this significant inter-racial difference, however, the distribution of the codon 55 polymorphism was comparable between cases and controls in both racial groups, indicating that this polymorphism does not play an etiologic role in CHD.

3.3. Haplotype analysis of the codons 55 and 192 polymorphisms Genotype data for the codon 55 polymorphism was used in conjunction with the codon 192 genotype data reported earlier by us [26] to construct two site haplotypes. For linkage disequilibrium estimation between the two polymorphic sites, data from patients and controls within each racial group were combined and haplotypes were constructed. Since no BM/BM ho-

mozygotes or AM/BM and BL/BM heterozygotes were observed, we assumed that the BM haplotype does not exist or is relatively rare in these populations. Random combination of the A and the B alleles at codon 192 and the L and the M alleles at codon 55 is expected to give rise to four haplotypes (AL, BL, AM and BM). However, only three haplotypes (AL, BL and AM) were observed. Formal statistical analysis showed a strong linkage disequilibrium between the two polymorphic sites in both Indians and Chinese (Table 3). Due to this linkage disequilibrium, only six of the expected ten genotypes were observed and their distribution in patients and controls is shown in Table 4. While comparable frequencies were observed between Chinese patients and controls, several differences were noted between Indian patients and controls. Indian patients had lower frequencies of the AL/AL (14.0 versus 23.4%; PB0.05) and the AL/AM (9.7 versus 18.3%; PB 0.05) genotypes, and higher frequency of the AM/BL genotype (25.4 versus 10.3%; P B0.0001) than controls. Consequently, Indian patients had a higher frequency of the BL haplotype (0.430 versus 0.311; P = 0.004) and correspondingly lower frequency of the AL haplotype (0.368 versus 0.483; P = 0.006) than controls.

3.4. Association with quantitati6e traits Our analyses of association between the codon 55 polymorphism and plasma lipoprotein–lipids showed no significant association (data not shown). Additional analyses combining the codon 55 and codon 192 genotypes also showed no significant impact on any lipid traits examined (data not shown).

4. Discussion Recently, PON has emerged as an independent risk factor for cardiovascular disease. Despite the lack of information on its natural substrate, there is growing

D.K. Sanghera et al. / Atherosclerosis 136 (1998) 217–223

221

Table 3 Haplotype assignments, their observed and expected distributions at two polymorphic sites (codons 55 and 192) in the PON1 gene in the combined cases and controls samples of 289 Asian Indians and 258 Chinese Genotypes at two sites

Asian Indians/haplotype

Site 1 (codon 192)

Site 2 (codon 55)

n

AA

LL LM MM LL LMa MM LL LM MM

57 43 14 96 47 0 32 0 0

AB

BB

Observed haplotype % Expected Haplotypeb %

AL

Chinese/haplotype

AM

114 0 43 43 0 28 96 0 0 47 0 0 0 0 0 0 0 0 253 118 43.8 20.4 295.4 75.7 51.1 13.1 x 21 = 82.8; PB0.0001

BL

BM

n

0 0 0 96 47 0 64 0 0 207 35.8 164.7 28.5

0 0 0 0 0 0 0 0 0 0 0.0 42.2 7.3

36 8 0 112 11 0 91 0 0

AL

AM

72 0 8 8 0 0 112 0 11 0 0 0 0 0 0 0 0 0 192 19 37.2 3.7 203.2 7.8 39.4 1.5 x 21 =28.4; PB0.0001

BL

BM

0 0 0 112 11 0 182 0 0 305 59.1 293.7 56.9

0 0 0 0 0 0 0 0 0 0 0.0 11.3 2.2

a

In double heterozygotes it was assumed that the BM haplotype does not exist (see text for explanation). Expected haplotypes were calculated by n(2pq) where n is the total number of individuals, p is the frequency of the A or B alleles at codon 192 and q is the frequency of the L or M allele at codon 55.

b

evidence that PON is capable of destroying biologically active atherogenic lipids produced by LDL oxidation [9 – 12]. Three independent studies in caucasians have implicated the PON1 codon 192 polymorphism with CHD risk [24–26]. However, other studies on Caucasians and non-Caucasians did not confirm this association [26–28]. Based on these inconsistent findings it can be hypothesized that the PON1 codon 192 polymorphism is in linkage disequilibrium with a functional mutation present in this or a nearby gene. In our continued effort to explore how genetic variation in the PON1 gene can influence the susceptibility to CHD, we investigated the role of another common polymorphism at codon 55 in relation to CHD risk, independently and in conjunction with the codon 192 polymorphism, in two racial groups from Singapore. Our data displayed a significant inter-racial variability in the allelic distribution of the codon 55 polymorphism. Although the distribution of the less common allele, M, was significantly higher in Indians than Chinese (0.202 versus 0.036; PB0.0001), it was not associated with CHD risk in either group. Our results indicate a strong linkage disequilibrium between the PON1 codon 55 and 192 polymorphisms in both Asian Indians and Chinese (PB 0.0001). This non-random association is mainly due to complete linkage between the B allele of the codon 192 polymorphism and the L allele of codon 55 polymorphism. In the Indian sample the BL haplotype was associated with a significant risk for CHD. However, since in our previous study we identified the codon 192/B allele as a risk factor for CHD in Asian Indians [26] it is therefore, not surprising that the BL haplotype was more

frequent in patients than controls (Table 4). There was no significant interaction between the codon 55 and 192 polymorphisms in either Asian Indians (P= 0.16) or Chinese (P= 0.49) in affecting CHD risk. While this study was in progress, Blatter Garin et al. [29] reported an association of the codon 55/L allele with CHD risk in a diabetic sample from France. However, our negative findings in two genetically distinct samples indicate that the codon 55/L allele is not a risk factor for CHD. It is also possible that the reported association of the codon 55/L allele in a French diabetic sample is mediated by the B allele of codon 192 because this has previously been shown to be associated with CHD risk in the same French diabetic sample [24]. However, our subset of diabetic CHD patients did not show any significant association with the codon 55/L allele (data not shown). Blatter Garin et al. [29] have also shown that the codon 55 polymorphism is functionally related to modulate serum PON concentrations. Since serum PON activity and quantitative data were not available in our sample, we are unable to confirm this association. A possible reason of our inability to detect differences between patients and controls could be that our control group was younger than the patient group. Possibly, some of the younger controls with the codon 55/L allele may develop CHD later on. However, even when we used a subset of controls to match the mean age of patients and controls, we did not see any significant difference between patients and controls (data not shown). In summary, our results suggest that the codon 55 polymorphism has no independent association with CHD risk in this biracial sample.

D.K. Sanghera et al. / Atherosclerosis 136 (1998) 217–223

222

Table 4 Distribution of combined genotypes at two polymorphic sites (codon 192 and codon 55) and haplotype frequency in the PON1 gene in Asian Indians and Chinese controls and patients Asian Indians Controls (n=175) Genotype AL/AL AM/AM AL/AM BL/BL AL/BL AM/BL Haplotype frequency AL AM BL

41 11 32 18 55 18

(23.4)a (6.3) (18.3) (10.3) (31.4) (10.3)

0.483 0.206 0.311

Chinese Patients (n =114)

Controls (n = 142)

Patients (n = 116)

16 3 11 14 41 29

22 0 5 48 61 6

14 0 3 43 51 5

(14.0)* (2.6) (9.7)* (12.3) (36.0) (25.4)**

0.368p 0.202 0.430f

(15.5) (0.0) (3.5) (33.8) (43.0) (4.2)

0.387 0.039 0.574

a Percent values are parenthesized. *, ** Significant difference (* PB0.05) (** PB0.0001) between patients and controls. p f , Significant difference in haplotype frequency between patients and controls; p (P= 0.006);

Acknowledgements This work was supported in part by National Institutes of Health grants HL 49074, HL 44672, and HL52611.

References [1] Breslow JL. Apolipoprotein genetic variation and human disease. Physiol Rev 1988;68:85–132. [2] Humphries SE. DNA polymorphisms of the apolipoprotein gene: their use in investigating the genetic component of hyperlipidemia and atherosclerosis. Atherosclerosis 1988;72:89– 108. [3] Sing CF, Moll PP. Genetics of atherosclerosis. Ann Rev Genet 1990;24:171 – 87. [4] Mackness MI, Arrol S, Abbott C, Durrington PN. Protection of low density lipoprotein against oxidative modification by high density lipoprotein associated paraoxonase. Atherosclerosis 1993;104:129 – 35. [5] Watson AD, Navab M, Hama SY, et al. Effect of platelet activating factor-acetylhydrolase on the formation and action of minimally oxidized low density lipoprotein. J Clin Invest 1995;95:774 – 82. [6] La Du BN. Human serum paraoxonase/arylesterase. In: Kalow W, editor. Pharmaco Genetics of Drug Metabolism. New York: Pergamon, 1992:51 –91. [7] Blatter Garin M-C, James RW, Messmer S, Barja F, Pometta D. Identification of high density lipoprotein subspecies defined by a lipoprotein-associated protein, k-45. Eur J Biochem 1993;211:871 – 9. [8] Kelso GJ, Stuart WD, Richter RJ, Furlong CE, Jordan-Starck TC, Harmony AK. Apolipoprotein J is associated with paraoxonase in human plasma. Biochemistry 1994;33:832–9. [9] Navab M, Berliner JA, Watson AD, et al. The yin and yang of the oxidation in the development of the fatty streak. Arterioscler Thromb Vasc Biol 1996;16:831–42. [10] Mackness MI, Durrington PN. HDL, its enzymes and and its potential to influence lipid peroxidation. Atherosclerosis 1995;115:243 – 53.

(12.1) (0.0) (2.6) (37.0) (44.0) (4.3)

0.353 0.034 0.612

f

(P= 0.004).

[11] Watson AD, Berlinor JA, Hama SY, et al. Protective effect of high density lipoprotein associated paraoxonase: inhibition of the biological activity of minimally oxidized low density lipoprotein. J Clin Invest 1995;96:2882 – 91. [12] Simeon V, Pavkovic E. Heat inactivation of paraoxonase and arylesterase activities in human and rabbit serum. Chem-Biol Interact 1993;87:103 – 7. [13] Diepgen TL, Geldmacher-vonMallinckrodt M. Interethnic differences in the detoxification of organophosphates: the human serum paraoxonase polymorphism. Arch Toxicol 1986;Suppl 9:154 – 8. [14] Roy AC, Saha N, Tay JSH, Ratnam SS. Serum paraoxonase polymorphism in three populations of Southeast Asia. Hum Hered 1991;141:265 – 9. [15] Adkins S, Gan KN, Mody M, La Du BN. Molecular basis for the polymorphic forms of human serum paraoxonase/ arylesterase: glutamine or arginine at position 191, for the respective A or B allozymes. Am J Hum Genet 1993;52:598–608. [16] Humbert R, Adler DA, Disteche CM, Hassett C, Omiecinski CJ, Furlong CE. The molecular basis of the human serum paraoxonase activity polymorphism. Nat Genet 1993;3:73 – 6. [17] Davies HG, Rebecca JR, Keifer M, Broomfield CA, Sowalla J, Furlong CE. The effect of the human serum paraoxonase polymorphism is reversed with diazoxon, soman and serin. Nat Genet 1996;4:334 – 6. [18] Primo-Parmo SL, Sorenson RC, Teiber J, La Du BN. The human serum paraoxonase/arylesterase gene (PON1 ) is one member of a multigene family. Genomics 1996;33:498 –507. [19] Mackness MI, Harty D, Bhatnagar D, et al. Serum paraoxonase activity in familial hypercholesterolaemia and insulin-dependent diabetes mellitus. Atherosclerosis 1991;86:193 – 9. [20] Nishigaki I, Hagihara M, Tsunekawa H, Maseki M, Yagi K. Lipid peroxide levels of serum lipoprotein fractions of diabetic patients. Biochem Med 1981;25:373 – 8. [21] Mackness MI, Walker CH, Carlson LA. Low ‘A’-esterase activity in serum of patients with fish-eye disease. Clin Chem 1987;3:587 – 8. [22] Mackness MI, Peuchant E, Dumon M-F, Walker CH, Clerc M. Absence of ‘A’-esterase activity in serum of patients with Tangier disease. Clin Biochem 1989;22:475 – 8. [23] Abbot CA, Mackness MI, Kumar S, Boulton A, Durrington PN. Activity, concentration and phenotype distribution in dia-

D.K. Sanghera et al. / Atherosclerosis 136 (1998) 217–223

[24]

[25]

[26]

[27]

[28]

betic mellitus serum paraoxonase and its relationship to serum lipids and lipoproteins. Arterioscler Thromb Vasc Biol 1995;15:1812 – 8. Ruiz JH, Blanche RW, James M-C, et al. Gln–Arg192 polymorphism of paraoxonase and coronary heart disease in type 2 diabetes. Lancet 1995;346:869–72. Serrato M, Marian AJ. A variant of human paraoxonase/ arylesterase (HUMPONA) gene is a risk factor for coronary artery disease. J Clin Invest 1995;96:3005–8. Sanghera DK, Saha N, Aston CE, Kamboh MI. Genetic polymophism of paraoxonase and the risk of coronary heart disease. Arterioscler Thromb Vasc Biol 1997;17:1067–73. Antikainen M, Murtomaki S, Syvanne M, et al. The Gln – Arg191 polymorphism of the human paraoxonase gene (HUMPONA) is not associated with the risk of the coronary artery disease in Finns. J Clin Invest 1996;98:883–5. Herrmann S-M, Blanc H, Poirier O, et al. The Gln/Arg polymorphism of the human paraoxonase (PON 192 ) is not related to myocardial infarction in the ECTIM Study. Atherosclerosis 1996;126:299 – 303.

.

223

[29] Blatter Garin M-C, James RW, Dussoix P, et al. Paraoxonase polymorphism Met – Leu 54 is associated with modified serum concentrations of the enzyme: a possible link between paraoxonase gene and increased risk of cardiovascular disease in diabetes. J Clin Invest 1997;99:62 – 6. [30] Saha N, Liu Y, Low PS, Tay JSH. Association of factor VII genotypes with plasma factor VII activity and antigen levels in healthy Indian adults and interaction with triglycerides. Arterioscler Thromb 1994;14:1923 – 7. [31] Friedewald WT, Levi RI, Fredrickson DS. Estimation of low density lipoprotein cholesterol levels in plasma without use of the preparative ultracentrifuge. Clin Chem 1972;8:499 –502. [32] Parzer S, Mannhalter CA. Rapid method for the isolation of genomic DNA from citrate whole blood. Biochem J 1991;273:229 – 31. [33] Kanji GK. 100 Statistical Tests. Newbury Park, CA: Sage Publications, 1993. [34] Kamboh MI, Hamman RF, Ferrell RE. Two polymorphisms in the APO A-IV coding gene: their evolution and linkage disequilibrium. Genet Epidemiol 1992;9:305 – 15.