The comparison of genotyping, antibiogram, and antimicrobial resistance genes between carbapenem-susceptible and -resistant Acinetobacter baumannii

Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 339–346

Contents lists available at ScienceDirect

Comparative Immunology, Microbiology and Infectious Diseases journal homepage: www.elsevier.com/locate/cimid

The comparison of genotyping, antibiogram, and antimicrobial resistance genes between carbapenem-susceptible and -resistant Acinetobacter baumannii Chih-Ming Chen a,b , Se-Chin Ke c , Chia-Ru Li d , Chao-Chin Chang b,∗ a b c d

Division of Infectious Disease, Department of Internal Medicine, Tungs’ Taichung MetroHarbor Hospital, Taichung, Taiwan Graduate Institute of Microbiology and Public Health, National Chung Hsing University, Taichung, Taiwan Infection Control Office, Tungs’ Taichung MetroHarbor Hospital, Taichung, Taiwan Department of Medical Research, Tungs’ Taichung MetroHarbor Hospital, Taichung, Taiwan

a r t i c l e

i n f o

Article history: Received 1 July 2014 Received in revised form 3 October 2014 Accepted 7 October 2014 Keywords: Carbapenem-resistant Carbapenem-susceptible Acinetobacter baumannii MLST PFGE

a b s t r a c t This study was conducted to explore the epidemiological and molecular differences between carbapenem-susceptible Acinetobacter baumannii (CSAB) and carbapenemresistant A. baumannii (CRAB) isolates. Thirty-two CSAB and 55 CRAB isolates were collected in 2010. By multilocus sequence typing analysis, 31 (56%) CRAB isolates and 11 (34%) CSAB isolates belonged to ST2. Twenty-one (38%) CRAB isolates, and 4 (13%) CSAB isolates belonged to a new type, ST129. The blaIMP , blaVIM , and blaOXA-58-like were not detected in our study isolates. blaOXA-23 and blaOXA-24/40-like were not detected in all CSAB isolates. On the contrary, blaOXA-23 was detected in 51 (93%) CRAB isolates. Class 1 integron was detected in 19 (35%) CRAB isolates and 8 (25%) CSAB isolates (p > 0.05). In conclusion, the ST2 and ST129 were the major sequence types in both CSAB and CRAB isolates. The blaOXA-23 is the primary carbapenem-resistance gene in CRAB isolates from hospitalized patients and the specimens collected from hospital environment. © 2014 Elsevier Ltd. All rights reserved.

1. Introduction Carbapenems are important antibiotics to treat Acinetobacter baumannii infections. Carbapenem-resistant A. baumannii (CRAB) related infections were first reported in 1991 in the USA [1], and then the global spread of CRAB becomes a big threat to healthcare workers worldwide, including Taiwan. The percentage of CRAB in A. baumannii isolates of hospital-acquired infections increased to 46%

∗ Corresponding author. Graduate Institute of Microbiology and Public Health, National Chung Hsing University, 250 Kuo-Kuang Road, Taichung 402, Taiwan. Tel.: +886 4 22840894x706; fax: +886 4 22852186. E-mail address: [email protected] (C.-C. Chang). http://dx.doi.org/10.1016/j.cimid.2014.10.002 0147-9571/© 2014 Elsevier Ltd. All rights reserved.

in 2008 from 14% in 2003 in Taiwan [2]. A. baumannii has surpassed Pseudomonas aeruginosa and become the most common pathogen of nosocomial infections in Taiwan since 2008 [3]. The number of CRAB isolates has also significantly increased in our hospital since 2006 [4]. Carbapenem resistance of A. baumannii can result from porin loss, penicillin-binding protein modifications, and carriage of metallo-beta-lactamases (VIM, IMP, SIM) or carbapenem-hydrolysing class D beta-lactamases (CHDLs) [5]. The global spread of CRAB was found to be associated with carriage of CHDLs in recent years [6]. Genes encoding CHDLs can be located in chromosomes or plasmids. Six subgroups of CHDLs have been identified in A. baumannii, including OXA-23-like, OXA-24/40-like, OXA-51-like, OXA-58-like, OXA-143-like, and OXA-235 [5,7,8].

340

C.-M. Chen et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 339–346

Integrons with antimicrobial resistance cassettes are associated with multidrug resistance in bacteria [9]. Dissemination of multidrug-resistant A. baumannii carrying class I integrin had ever been reported in Taiwan [10]. Up to date, at least 6 different classes of integron have been reported and class 1 integron is the most common one in gram-negative bacteria [11]. Both pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) have been widely applied in genotyping of bacteria, including A. baumannii [12]. However, only one report on MLST analysis of A. baumannii in Taiwan has been published recently, and has shown that most A. baumannii isolates belonged to ST2 of international clonal complex 2 (CC2) [13]. Because most studies focused on the carbapenemresistant or multidrug-resistant A. baumannii [14,15], the different epidemiological and molecular characteristics between carbapenem-resistant and -susceptible A. baumannii were rarely explored. Therefore, this study was conducted to investigate the differences between CRABs and CSABs after the analysis of molecular typings (including MLST and PFGE), antibiogram, and carriage of class 1 integron and carbapenem resistance genes. 2. Material and methods 2.1. Collection of Acinetobacter baumannii isolates Tungs’ Taichung MetroHarbor Hospital (TTMHH), located in central Taiwan, has 1339 beds, including five ICU units with a total of 90 ICU beds. From January to December 2010, all first isolates of each nosocomial infection case caused by carbapenem-resistant Acinetobacter calcoaceticus–A. baumannii complex (Ac–Ab complex) were collected. Nosocomial infection cases determined by the United States National Nosocomial Infection Surveillance (NNIS) definitions were the patients who acquired the infection during hospitalization and occur more than 48 h after admission [16]. Using twice the number of carbapenem-resistant Ac–Ab complex isolates, carbapenem-susceptible Ac–Ab complex isolates were gathered from our clinical laboratory during the same period. Ac–Ab complex isolates from two ICUs through microbiological surveillance in a non-outbreak period were also collected in this study. All Ac–Ab complex isolates were initially identified by conventional bacteriological methods or Phoenix Automated Microbiology System (BD Diagnostic Systems, Sparks, MD). These isolates were finally confirmed to be A. baumannii by the detection of A. baumannii-specific intergenic spacer region and recA gene using a multiplex PCR method [17]. Only isolates confirmed to be A. baumannii were used in this study. 2.2. Antimicrobial susceptibility tests The minimum inhibitory concentrations (MICs) of antimicrobial agents were determined by the Phoenix Automated Microbiology System (BD Diagnostic Systems, Sparks, MD) and interpreted according to the Clinical and Laboratory Standards Institute (CLSI) criteria [18]. Tested antimicrobial agents including amikacin (8 to 32 ␮g/ml),

gentamicin (2 to 8 ␮g/ml), imipenem (1 to 8 ␮g/ml), ceftazidime (0.5 to 16 ␮g/ml), cefotaxime (2 to 16 ␮g/ml), cefepime (2 to 16 ␮g/ml), ampicillin/sulbactam (SAM, 4/2 to 16/8 ␮g/ml), piperacillin/tazobactam (TZP, 4/4 to 64/4 ␮g/ml), ciprofloxacin (0.5 to 2 ␮g/ml), levofloxacin (1 to 4 ␮g/ml), and colistin (1 to 4 ␮g/ml). Multidrug-resistant (MDR) and extensively drug-resistant (XDR) were determined according to the published criteria by Magiorakos et al. [19]. MDR was defined as non-susceptibility to one or more agents in at least 3 antimicrobial categories. XDR was defined as non-susceptibility to at least one agent in all but two or fewer antimicrobial categories.

2.3. DNA preparation and detection of carbapenem resistant genes by polymerase chain reaction (PCR) The preparation of template DNA was performed as described by Bickley and Owen [20]. Primers used in this study were shown in Table 1. PCR amplifications were performed in 50 ␮l volumes with 1X reaction buffer, 0.4 U Taq polymerase (Invitrogen, Brazil; or Genet Bio, Korea), 1 ␮l of each dNTP, 1.5 mM of MgCl2 , and 200 nM of each primer. Templates were 2 ␮l of genomic DNA prepared using the Agencourt Ampure XP kit (Beckman Coulter Genomics). PCR conditions were as follows: 94 ◦ C for 5 min; 30 cycles of 94 ◦ C for 30 s, annealing temperatures 55 ◦ C for 30 s and 72 ◦ C for 30 s; and 72 ◦ C for 7 min. The detection of carbapenem-resistance genes, including blaOXA-23 , blaOXA-24/40-like , blaOXA-51-like , blaOXA-58-like , blaIMP , and blaVIM genes, was carried out as described by Woodford et al. and Pitout et al. [21,22]. After electrophoresis at 120 V for 40 min, the 1% agarose gel was stained with 0.5 ␮g/ml ethidium bromide (Merck) for 30 min and visualized under UV.

2.4. Molecular typing and analysis of pulsed-field gel electrophoresis (PFGE) Genotyping of A. baumannii isolates was conducted by macrorestriction of whole bacterial DNA followed by separation of the restriction fragments using PFGE. Whole chromosomal DNA of clinical isolates embedded in agarose gel plugs was treated with proteinase K and restriction endonuclease AscI according to the manufacturer’s recommendations (New England Biolabs, MA, USA). The restriction fragments were separated by electrophoresis in a CHEF-DR III apparatus (Bio-Rad Laboratories, Hercules, CA, USA) for 24 h. Restriction fragments of Staphylococcus aureus NCTC 8325 by SmaI (New England Biolabs, MA, USA) were used as molecular size markers. PFGE was carried out according to the protocol by Gautom [23]. The running conditions were as follows: 1.0% SeaKem LE agarose, 14 ◦ C, 21 h, 6 V/cm, and 2.2- to 54.2-s linear switch ramp. PFGE patterns were compared using published standard criteria [24], and analyzed by BioNumerics software (Version 4.0, Applied Maths BVBA, Belgium). Pulsotypes differed by six fragments or less were grouped into one cluster [24]. Similarity value was calculated by Dice coefficient using parameter settings at 0.5% tolerance and 1.5% optimization.

C.-M. Chen et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 339–346

341

Table 1 Primers used in this study. Gene

Nucleotide sequence(5 –3 )

Target

Reference

P-ab-ITSF P-ab-ITSB P-rA1 P-rA2 5 -CS 3 -CS IMP-A IMP-B VIM2004A VIM2004B OXA23-F OXA23-R OXA24-F OXA24-R OXA51-F OXA51-R OXA-58-F OXA-58-R

CATTATCACGGTAATTAGTG AGAGCACTGTGCACTTAAG CCTGAATCTTCTGGTAAAAC GTTTCTGGGCTGCCAAACATTAC GGCATCCAAGCAGCAAG AAGCAGACTTGACCTGA GAAGGYGTTTATGTTCATAC GTAMGTTTCAAGAGTGATGC GTTTGGTCGCATATCGCAAC AATGCGCAGCACCAGGATAG GATCGGATTGGAGAACCAGA ATTTCTGACCGCATTTCCAT GGTTAGTTGGCCCCCTTAAA AGTTGAGCGAAAAGGGGATT TAATGCTTTGATCGGCCTTG TGGATTGCACTTCATCTTGG AAGTATTGGGGCTTGTGCTG CCCCTCTGCGCTCTACATAC

Intergenic spacer

[17]

recA

[17]

Integron

[37]

blaIMP

[22]

blaVIM

[22]

blaOXA-23

[21]

blaOXA-24-like

[21]

blaOXA-51-like

[21]

blaOXA-58-like

[21]

2.5. Multilocus sequence typing MLST was based on a sequence analysis of the internal portions of seven housekeeping genes (cpn60, fusA, gltA, pyrG, recA, rplB, and rpoB). MLST analysis was performed as previously described [25]. Details of the MLST scheme including amplification and sequencing primers, allele sequences and STs are available at Institute Pasteur’s MLST Website (www.pasteur.fr/mlst). 2.6. Statistical analysis Statistical analysis by Chi-square test or Fisher’s exact test was conducted by SPSS software version 17.0 (SPSS. Inc., Chicago, IL). The p < 0.05 was regarded as statistically significant. 2.7. Ethics This study was reviewed and approved by the Institutional Review Board (IRB) of the TTMHH. 3. Results 3.1. Collection of Acinetobacter baumannii isolates One hundred and twenty-two isolates were collected initially, including 36 carbapenem-resistant Ac–Ab complex isolates causing hospital-acquired infection, 14 environmental Ac–Ab complex isolates from ICUs, and 72 clinical carbapenem-susceptible Ac–Abcomplex isolates. The 14 ICU environmental Ac–Ab complex isolates were cultured from 14 of 327 specimens, including ventilators and breathing circuits (6/47, 12.8%), beds and beds’ surrounding (4/213, 1.9%), staff’s hands (2/27, 7.4%), telephones (1/7, 14.3%), computer mice and keyboards (1/21, 4.8%), and stethoscopes (0/12, 0%). Thirty-six isolates causing hospital-acquired infections and 14 ICU environmental isolates were further confirmed to be A. baumannii by PCR methods. Among 72 clinical carbapenem-susceptible

isolates, only 37 isolates were confirmed to be A. baumannii and enrolled in this study. 3.2. Epidemiological characteristics A total of 87 isolates of A. baumannii, including 73 clinical isolates and 14 ICU environmental isolates, were used for epidemiological analysis. These clinical isolates were obtained from 51 male and 22 female patients, and the mean age of 73 patients was 68.1 ± 19.2 years (range 1 to 92, median 73). Among 73 clinical isolates, 61 isolates were hospital-acquired and 12 isolates were communityacquired. The 73 clinical isolates were from urine (n = 27), sputum (n = 17), blood (n = 17), pus (n = 9), catheter tip (n = 1), and bile (n = 2). According to the MIC testing results, 55 out of 87 study isolates were CRAB and 32 were CSAB. Among 55 CRAB isolates, 42 were hospital-acquired clinical isolates and 13 were ICU environmental isolates. The clinical diagnoses of the 42 hospital-acquired CRAB cases were pneumonia (n = 8), urinary tract infection (UTI) (n = 21), blood stream infection (BSI) (n = 9), skin and soft tissue infection (SSTI) (n = 2), and colonization (n = 2). The 10 of 42 (29%) CRAB clinical cases, including 4 BSI, 3 UTI, 2 pneumonia, and one SSTI, died within 30 days of positive culture. Among 32 CSAB isolates, 19 and 12 isolates were obtained from hospital-acquired and community-acquired clinical isolates, respectively. One CSAB isolate was obtained from ICU environment. The diagnoses of 31 clinical CSAB cases were as follows: pneumonia, 10; colonization, 13; SSTI, 3; BSI, 4; and biliary tract infection, 1. Among 31 CSAB clinical cases, 6 (19%) cases, including 5 pneumonia and 1 BSI, died due to A. baumannii infection within 30 days of positive culture. 3.3. Antimicrobial susceptibility Antimicrobial resistance percentages of CSABs and CRABs were summarized in Table 2. CRAB isolates were more likely to be XDR or MDR, than CSAB isolates (100%, 55/55 vs. 47%, 15/32; p < 0.001). Except for colistin, there

342

C.-M. Chen et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 339–346

Table 2 The comparison of antimicrobial resistance rates, ST types, blaOXA carriage, and class 1 integron carriage between carbapenem-susceptible and -resistant Acinetobacter baumannii isolates. Carbapenem-susceptible n = 32

Carbapenem-resistant n = 55

p Value

Antimicrobial resistance Amikacin Gentamicin Ceftazidime Cefotaxime Cefepime Imipenem SAM TZP Ciprofloxacin Levofloxacin Colistin MDR/XDR

14 (44)a 16 (50) 15 (47) 24 (75) 16 (50) 0 (0) 10 (31) 15 (47) 15 (47) 15 (47) 0 (0) 15 (47)

48 (87) 54 (98) 55 (100) 55 (100) 55 (100) 55 (100) 51 (93) 55 (100) 55 (100) 55 (100) 0 (0) 55 (100)

<0.001 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 – <0.001

Source Hospital Community ICU environment

19 (59) 12 (38) 1 (3)

42 (76) 0 (0) 13 (24)

ST types ST2 ST129 Others

11 (34) 4 (13) 17 (53)

31 (56) 21 (38) 3 (5)

0 (0) 0 (0) 0 (0)

50 (91) 2 (4) 1 (2)

8 (25) 24 (75)

19 (35) 36 (65)

blaOXA carriage blaOXA-23 blaOXA-24/40-like Both Class 1 integron carriage Yes No

<0.001

<0.001

<0.001

0.472

Abbreviations: SAM, ampicillin/sulbactam; TZP, piperacillin/tazobactam; MDR, multidrug-resistant; XDR, extensive drug-resistant. a Figures shown in parentheses are percentages.

were significant differences in susceptibility to other tested antimicrobial agents between CSAB and CRAB isolates (all p < 0.001).

3.4. Genetic basis of antimicrobial resistance The blaIMP and blaVIM genes were not detected in the 87 isolates studied. The blaOXA-51 gene has been found in all CSAB and CRAB isolates. Genes of blaOXA-23 , blaOXA-24/40-like , and blaOXA-58-like were not identified in all CSAB isolates. Among 55 CRAB isolates, blaOXA-23 , blaOXA-24/40-like , and both blaOXA-23 and blaOXA-24/40-like were identified in 50 isolates (91%), 2 isolates (4%) and 1 isolate (2%), respectively. Class 1 integron was identified in 19 CRAB (19/55, 35%) and 8 CSAB (8/32, 25%) isolates (p = 0.35). Among 55 CRAB isolates, there was no significant difference in resistance to all tested antimicrobial agents between class 1 integron-positive and -negative isolates. On the contrary, among 32 CSAB isolates, there were significant differences in resistance to amikacin (88%, 7/8 vs. 29%, 7/24), gentamicin (100%, 8/8 vs. 33%, 8/24), ceftazidime (100%, 8/8 vs. 29%, 7/24), cefepime (100%, 8/8 vs. 33%, 8/24), piperacillin/tazobactam (100%, 8/8 vs. 29%, 7/24), ciprofloxacin (88%, 7/8 vs. 33%, 8/24), and levofloxacin (88%, 7/8 vs. 33%, 8/24) between class 1 integron-positive and -negative isolates (all p < 0.05).

3.5. Pulsed-field gel electrophoresis A total of 66 PFGE pulsotypes were identified. According to the published criteria [24], these pulsotypes were grouped into 37 PFGE groups (A to Z, and AA to AK). Fiftyfive CRAB isolates had 38 PFGE pulsotypes and belonged to 18 PFGE groups. Thirty-two CSAB isolates had 31 pulsotypes and belonged to 26 PFGE groups. CSABs were more diverse than CRABs in PFGE patterns. PFGE groups K, Z, and AC were predominant groups, which contained 32 isolates (10, 9, and 13 isolates, respectively). These 32 isolates were carbapenem-resistant and 31 isolates were hospitalacquired. The result of PFGE analysis was shown in Fig. 1. 3.6. Multilocus sequence typing A total of 19 MLST types were found among the 87 isolates studied. The predominant MLST type ST2 was identified in 42 isolates and a new type-ST129 (cpn60-3, fusA-2, gltA-3, pyrG-2, recA-2, rplB-2, and rpoB-2) was found in 25 isolates. Compared with ST2, ST129 has only one different nucleotide in cpn60 (nt213: A → T) and gltA (nt339: C → T). Both ST2 and ST129 were grouped into international clonal complex 2 (CC2). Other 17 MLST types were equal to or less than 3 isolates. Thirty-one (56%) CRAB isolates and 11 (34%) CSAB isolates belonged to ST2. Twenty-one (38%) CRAB isolates and 4 (13%) CSAB isolates belonged to

C.-M. Chen et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 339–346

343

Fig. 1. The results of pulsed-field gel electrophoresis of AscI-digested chromosomal DNAs, multilocus-sequence typing, carriage of blaOXA and class 1 integron, and hospital- or community-acquired infection of 87 Acinetobacter baumannii isolates.

344

C.-M. Chen et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 339–346

Table 3 The comparison of antimicrobial resistance rates among different ST types. ST2 n = 42

ST129 n = 25

Others ST types n = 20

p-Value

Antimicrobial agents Amikacin Gentamicin Imipenem Ceftazidime Cefotaxime Cefepime SAM TZP Ciprofloxacin Levofloxacin Colistin

41 (97)a 42 (100) 31 (74) 42 (100) 42 (100) 42 (100) 36 (86) 42 (100) 42 (100) 42 (100) 0 (0)

18 (72) 24 (96) 21 (84) 25 (100) 25 (100) 25 (100) 22 (88) 25 (100) 24 (96) 24 (96) 0 (0)

3 (15) 4 (20) 3 (15) 3 (15) 12 (60) 4 (20) 3 (15) 3 (15) 4 (20) 4 (20) 0 (0)

<0.001 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 –

blaOXA carriage blaOXA-23 blaOXA-24/40-like Both blaOXA-51 blaOXA-58-like

26 (62) 2 (5) 1 (2) 42 (100) 0 (0)

21 (84) 0 (0) 0 (0) 25 (100) 0 (0)

3 (15)b 0 (0) 0 (0) 20 (100) 0 (0)

Class 1 integron presence Yes No

22 (52) 20 (48)

5 (20) 20 (80)

0 (0) 20 (100)

<0.001

<0.001

Abbreviations: SAM, ampicillin/sulbactam; TZP, piperacillin/tazobactam. a Figures shown in parentheses are percentages. b Three carbapenem-resistant Acinetobacter baumannii isolates, including ST135, ST136, and ST143, each with one isolate.

a new type ST129. CSABs were significantly more diverse than CRABs in MLST type distribution (p < 0.001). Compared with isolates of other ST types, ST2 and ST129 isolates were more likely to carry class 1 integron and blaOXA-23 , and were significantly associated with higher resistance rates to all tested antimicrobial agents except for colistin (Table 3). All integron-positive isolates were ST2 or ST129. Furthermore, higher prevalence of class 1 integron positivity (22/42, 52% vs. 5/25, 20%; p = 0.009) and higher percentage of amikacin resistance (41/42, 97% vs. 18/25, 72%, p = 0.002) were identified in ST2 isolates than in ST129 isolates. The comparison between ST2 and ST129 isolates showed no significant difference with regard to patient’s gender, specimens for isolation, carriage of blaOXA-23 , and percentages of resistance to other antimicrobial agents. 4. Discussions Although most A. baumannii infections events were hospital-acquired, previous report revealed that about 4% healthy adults were colonized with A. baumannii [26], and community-acquired A. baumannii infection, especially with pneumonia, had been reported in many articles [27,28]. In our study, among 31 clinical CSAB isolates, 12 (39%) were obtained from community-acquired cases, and 5 (four pneumonia cases and one case with blood stream infection) of them died within 30 days after bacterial cultures had been obtained. The high mortality rate of community-acquired CSAB pneumonia is consistent with previous reports [27,28] and cannot be ignored. In contrast, only one of 19 nosocomial CSAB cases died due to pneumonia within 30 days after CSAB isolation (p = 0.01). The CSABs from these six death cases belonged to 6 MLST types and

none of them carried class 1 integron. Between hospital- or community-acquired CSAB isolates, there were no significant differences in antimicrobial resistance rates, carriage of antimicrobial resistance genes, ST types, and age and sex of the source patients. The risk factors relevant to mortality of CSAB infection cannot be identified in this study. After PFGE analysis, 66 pulsotypes belonging to 37 main groups were identified. Fifty-five CRAB and 32 CSAB isolates distributed in 18 and 26 PFGE groups, respectively. This result indicated that both the CSAB and CRAB isolates were obtained from many different sources, especially CSAB isolates. Five isolates (1, 3, 1 of group K, Z, and AC, respectively) of the 3 major PFGE groups were carbapenem-susceptible and did not harbor blaOXA-23 . The isolates of the PFGE group K and group AC were obtained from both clinical patients (n = 14) and ICU environment (n = 9). Above results revealed that both CRAB and CSAB isolates of major PFGE groups were circulated in hospitalized patients and ICU environment, and suggested that hospitalacquired CRAB could originate from CSAB, then acquire extra antibiotic-resistant genes and was finally circulated in a hospital environment. The recent report revealed that through MLST analysis of A. baumannii in Taiwan, ST2 is the predominant type of CRAB [13]. Our study results also showed that 56% (31/55) of CRAB isolates were ST2. Furthermore, 34% (11/32) of CSAB isolates were also ST2. In addition to ST2, a new type-ST129 was found in this study; 38% (21/55) of CRABs and 13% (4/32) of CSABs were ST129. Both ST2 and ST129 belonged to international clonal complex CC2, and could be found in hospital- and community-acquired cases. Therefore, not only ST2 but also ST129 are predominant ST types of CSAB and CRAB, and distributed in communities and hospitals in Taiwan. Furthermore, combined the results by

C.-M. Chen et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 339–346

MLST and PFGE pattern analysis, 3 clonal spread events (ST2/PFGE group K, ST129/PFGE group Z, and ST129/PFGE group AC) were identified. The results indicated that the increase of CRAB infection in Taiwan could be due to the clonal spread of CC2. Plasmid harbouring blaOXA-23 genes have been spread globally in recent years [29]. ISAba1 has been documented with promoter activity and can enhance the gene expression when located at the upstream of a gene [30]. If no ISAba1 or ISAba1 is not located at the upstream of blaOXA-23 , A. baumannii will remain susceptible to carbapenems [31]. Previous studies had indicated that the ISAba1/blaOXA-23 was the major cause of carbapenem-resistance in A. baumannii in central Taiwan [4,15]. In this study, 91% (50/55) of CRAB isolates carried blaOXA-23 and none CSAB isolates harbored blaOXA-23 . In addition to blaOXA-23 , blaOXA-24/40-like was identified in 3 CRAB isolates of ST2. Although A. baumannii with blaOXA-24/40-like had been identified in a hospital in southern Taiwan [32], the observation had not been reported in central Taiwan. It is still unknown when the A. baumannii with blaOXA-24/40-like entered our hospital, and how the strain spreads in central Taiwan. Nevertheless, above results indicated that although blaOXA-23 is still the major carbapenem-resistance gene of A. baumannii, blaOXA-24/40-like encoding carbapenemase may become the emerging issue in the area. Class 1 integron has been proven to be associated with multiple antimicrobial resistances in Gram-negative bacteria, including A. baumannii [33]. In our study, there was no significant difference in the prevalence of class 1 integron between CSAB and CRAB isolates. This result is in accordance with the previous reports [10,34], and reflects the fact that blaOXA-23 and blaOXA-24/40-like might not be associated with positivity of the integron [35]. Among CSAB isolates, the carriage of class 1 integron was significantly associated with MDR. However, there was no significant difference in prevalence of antimicrobial resistance between CRAB isolates with and without carriage of class 1 integron. The fluoroquinolone resistance usually results from specific mutaions of gyrA and/or parC, and the extended-spectrum cephalopsorins resistance of A. baumannii can result from the AmpC over-expression by insertion of ISAba1 at the upstream of blaAmpC on chromosomes [36]. In addition, blaIMP and blaVIM were not detected in our study isolates. Therefore, multidrug-resistance of CRAB isolates in this study may result from spontaneous mutations under antimicrobial selective pressure, or acquired antimicrobial resistance gene not embedded in class 1 integron. Besides, all 27 integron-positive isolates belonged to CC2 (ST2, 22 isolates; ST129, 5 isolates), and ST2 has a higher prevalence than ST129 in the carriage of class 1 integron (52% vs 20%, p < 0.05). It is still unclear whether isolates with specific ST types have special gene structure in favour of harbouring class 1 integron, and thus these isolates are more likely to be multidrug-resistant. In conclusion, CSABs were significantly more diverse than CRABs on the basis of genotyping analysis of PFGE. The ST2 and ST129 were the major sequence types in both CSABs and CRABs, and both hospital- and communityacquired isolates. The blaOXA-23 is still the primary carbapenem-resistance gene in CRAB isolates in central

345

Taiwan. A. baumannii with blaOXA-24/40-like is noted and may become an emerging problem in the area. The carriage of class 1 integron was not associated with carbapenem resistance, but was significantly related to multidrugresistance in CSAB isolates. Both CRAB and CSAB isolates of major PFGE groups circulated in hospitalized patients and ICU environment, suggested that hospital-acquired CRAB could originate from CSAB with acquired extra antibioticresistant genes, and then finally circulate in a hospital environment. Conflict of interest statement All authors declare that they have no conflicts of interest related to the material discussed in this article. Acknowledgements We thank Dr. Chien-Shun Chiou in the 3rd branch office, Centers for Diseases Control, Taiwan for his kind assistance in PFGE analysis. This study received grant support from Tungs’ Taichung MetroHarbor Hospital (TTMHH-98R0013). References [1] Go ES, Urban C, Burns J, Kreiswirth B, Eisner W, Mariano N, et al. Clinical and molecular epidemiology of acinetobacter infections sensitive only to polymyxin B and sulbactam. Lancet 1994;344:1329–32. [2] Su CH, Wang JT, Hsiung CA, Chien LJ, Chi CL, Yu HT, et al. Increase of carbapenem-resistant Acinetobacter baumannii infection in acute care hospitals in Taiwan: association with hospital antimicrobial usage. PLoS One 2012;7:e37788. [3] Tseng SH, Lee CM, Lin TY, Chang SC, Chuang YC, Yen MY, et al. Combating antimicrobial resistance: antimicrobial stewardship program in Taiwan. J Microbiol Immunol Infect 2012;45:79–89. [4] Chen CM, Liu PY, Ke SC, Wu HJ, Wu LT. Investigation of carbapenemresistant Acinetobacter baumannii isolates in a district hospital in Taiwan. Diagn Microbiol Infect Dis 2009;63:394–7. [5] Poirel L, Nordmann P. Carbapenem resistance in Acinetobacter baumannii: mechanisms and epidemiology. Clin Microbiol Infect 2006;12:826–36. [6] Higgins PG, Dammhayn C, Hackel M, Seifert H. Global spread of carbapenem-resistant Acinetobacter baumannii. J Antimicrob Chemother 2010;65:233–8. [7] Higgins PG, Poirel L, Lehmann M, Nordmann P, Seifert HOXA-143. a novel carbapenem-hydrolyzing class D beta-lactamase in Acinetobacter baumannii. Antimicrob Agents Chemother 2009;53:5035–8. [8] Higgins PG, Perez-Llarena FJ, Zander E, Fernandez A, Bou G, Seifert HOXA-235. a novel class D beta-lactamase involved in resistance to carbapenems in Acinetobacter baumannii. Antimicrob Agents Chemother 2013;57:2121–6. [9] Hall RM, Collis CM. Antibiotic resistance in gram-negative bacteria: the role of gene cassettes and integrons. Drug Resist Updat 1998;1:109–19. [10] Huang LY, Chen TL, Lu PL, Tsai CA, Cho WL, Chang FY, et al. Dissemination of multidrug-resistant, class 1 integron-carrying Acinetobacter baumannii isolates in Taiwan. Clin Microbiol Infect 2008;14:1010–9. [11] Turton JF, Kaufmann ME, Glover J, Coelho JM, Warner M, Pike R, et al. Detection and typing of integrons in epidemic strains of Acinetobacter baumannii found in the United Kingdom. J Clin Microbiol 2005;43:3074–82. [12] Bartual SG, Seifert H, Hippler C, Luzon MA, Wisplinghoff H, Rodriguez-Valera F. Development of a multilocus sequence typing scheme for characterization of clinical isolates of Acinetobacter baumannii. J Clin Microbiol 2005;43:4382–90. [13] Chuang YC, Sheng WH, Lauderdale TL, Li SY, Wang JT, Chen YC, et al. Molecular epidemiology, antimicrobial susceptibility and carbapenemase resistance determinants among Acinetobacter baumannii clinical isolates in Taiwan. J Microbiol Immunol Infect 2014;47:324–32. [14] Shen GH, Wang JL, Wen FS, Chang KM, Kuo CF, Lin CH, et al. Isolation and characterization of phikm18p, a novel lytic phage with

346

[15]

[16] [17]

[18]

[19]

[20] [21]

[22]

[23]

[24]

[25]

C.-M. Chen et al. / Comparative Immunology, Microbiology and Infectious Diseases 37 (2014) 339–346 therapeutic potential against extensively drug resistant Acinetobacter baumannii. PLoS One 2012;7:e46537. Lee MH, Chen TL, Lee YT, Huang L, Kuo SC, Yu KW, et al. Dissemination of multidrug-resistant Acinetobacter baumannii carrying Bla(OxA23) from hospitals in central Taiwan. J Microbiol Immunol Infect 2013;46:419–24. Garner JS, Jarvis WR, Emori TG, Horan TC, Hughes JM. CDC definitions for nosocomial infections, 1988. Am J Infect Control 1988;16:128–40. Chen TL, Siu LK, Wu RC, Shaio MF, Huang LY, Fung CP, et al. Comparison of one-tube multiplex PCR, automated ribotyping and intergenic spacer (ITS) sequencing for rapid identification of Acinetobacter baumannii. Clin Microbiol Infect 2007;13:801–6. CLSI. Performance standards for antimicrobial susceptibility testing, twenty first informational supplement M100-S21. Wayne, PA: Clinical and Laboratory Standards Institute; 2011. Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect 2012;18:268–81. Bickley J, Owen RJ. Preparation of bacterial genomic DNA. Methods Mol Biol 1995;46:141–7. Woodford N, Ellington MJ, Coelho JM, Turton JF, Ward ME, Brown S, et al. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents 2006;27:351–3. Pitout JD, Gregson DB, Poirel L, McClure JA, Le P, Church DL. Detection of Pseudomonas aeruginosa producing metallo-beta-lactamases in a large centralized laboratory. J Clin Microbiol 2005;43:3129–35. Gautom RK. Rapid pulsed-field gel electrophoresis protocol for typing of Escherichia coli O157:H7 and other gram-negative organisms in 1 day. J Clin Microbiol 1997;35:2977–80. Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 1995;33:2233–9. Diancourt L, Passet V, Nemec A, Dijkshoorn L, Brisse S. The population structure of Acinetobacter baumannii: expanding multiresistant clones from an ancestral susceptible genetic pool. PLoS One 2010;5:e10034.

[26] Chu YW, Leung CM, Houang ET, Ng KC, Leung CB, Leung HY, et al. Skin carriage of Acinetobacters in Hong Kong. J Clin Microbiol 1999;37:2962–7. [27] Chen MZ, Hsueh PR, Lee LN, Yu CJ, Yang PC, Luh KT. Severe community-acquired pneumonia due to Acinetobacter baumannii. Chest 2001;120:1072–7. [28] Leung WS, Chu CM, Tsang KY, Lo FH, Lo KF, Ho PL. Fulminant community-acquired Acinetobacter baumannii pneumonia as a distinct clinical syndrome. Chest 2006;129:102–9. [29] Mugnier PD, Poirel L, Naas T, Nordmann P. Worldwide dissemination of the blaOXA-23 carbapenemase gene of Acinetobacter baumannii. Emerg Infect Dis 2010;16:35–40. [30] Heritier C, Poirel L, Nordmann P. Cephalosporinase over-expression resulting from insertion of ISAba1 in Acinetobacter baumannii. Clin Microbiol Infect 2006;12:123–30. [31] Carvalho KR, Carvalho-Assef AP, Santos LG, Pereira MJ, Asensi MD. Occurrence of blaOXA-23 gene in imipenem-susceptible Acinetobacter baumannii. Mem Inst Oswaldo Cruz 2011;106:505–6. [32] Lu PL, Doumith M, Livermore DM, Chen TP, Woodford N. Diversity of carbapenem resistance mechanisms in Acinetobacter baumannii from a Taiwan hospital: spread of plasmid-borne OXA-72 carbapenemase. J Antimicrob Chemother 2009;63:641–7. [33] Wu K, Wang F, Sun J, Wang Q, Chen Q, Yu S, et al. Class 1 integron gene cassettes in multidrug-resistant Gram-negative bacteria in southern China. Int J Antimicrob Agents 2012;40:264–7. [34] Hwa WE, Subramaniam G, Navaratnam P, Sekaran SD. Detection and characterization of class 1 integrons among carbapenem-resistant isolates of Acinetobacter spp. in Malaysia. J Microbiol Immunol Infect 2009;42:54–62. [35] Poirel L, Naas T, Nordmann P. Diversity, epidemiology, and genetics of class D beta-lactamases. Antimicrob Agents Chemother 2010;54:24–38. [36] Poirel L, Bonnin RA, Nordmann P. Genetic basis of antibiotic resistance in pathogenic Acinetobacter species. IUBMB Life 2011;63:1061–7. [37] Levesque C, Piche L, Larose C, Roy PH. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother 1995;39:185–91.