The Complex of DNA Gyrase and Quinolone Drugs on DNA Forms a Barrier to the T7 DNA Polymerase Replication Complex

doi:10.1006/jmbi.2000.4266 available online at http://www.idealibrary.com on

J. Mol. Biol. (2000) 304, 779±791

The Complex of DNA Gyrase and Quinolone Drugs on DNA Forms a Barrier to the T7 DNA Polymerase Replication Complex Lois M. Wentzell and Anthony Maxwell* Department of Biochemistry University of Leicester Leicester, LE1 7RH, UK

Quinolone drugs can inhibit bacterial DNA replication, via interaction with the type II topoisomerase DNA gyrase. Using a DNA template containing a preferred site for quinolone-induced gyrase cleavage, we have demonstrated that the passage of the bacteriophage T7 replication complex is blocked in vitro by the formation of a gyrase-drug-DNA complex. The majority of the polymerase is arrested approximately 10 bp upstream of this preferred site, although other minor sites of blocking have been observed. The ability of mutant gyrase proteins to arrest DNA replication in vitro has been investigated. Gyrase containing mutations in the A subunit at either the active-site tyrosine (Tyr122) or Ser83 (a residue known to be involved in quinolone interaction) failed to halt the progress of the polymerase. A low-level, quinolone-resistant mutation in the B subunit of gyrase showed reduced blocking compared to wild-type. We have demonstrated that DNA cleavage and replication blocking occur on similar time-scales and we conclude that formation of the cleavable complex is a prerequisite for polymerase blocking. Additionally, we have shown that collision of the replication proteins with the gyrase-drug-DNA complex is not suf®cient to render this complex irreversible and that further factors must be involved in processing this stalled complex. # 2000 Academic Press

*Corresponding author

Keywords: topoisomerase; supercoiling; cipro¯oxacin

Introduction Quinolones are synthetic antibacterial agents known to target the bacterial type II topoisomerases DNA gyrase and topoisomerase IV (Drlica & Zhao, 1997). The absolute requirement for these proteins in bacteria, but their absence from eukaryotes, makes them ideal targets for antibiotics. Gyrase from Escherichia coli comprises two subunits, GyrA (97 kDa) and GyrB (90 kDa), which Present addresses: L.M. Wentzell, ICRF, Clare Hall Laboratories, South Mimms, Herts EN6 3LD, UK; A. Maxwell, Department of Biological Chemistry, John Innes Centre, Colney Lane, Norwich NR4 7UH, UK. Abbreviations used: GyrA, DNA gyrase A protein; GyrB, DNA gyrase B protein; BSA, bovine serum albumin; CFX, cipro¯oxacin; QRDR, quinolone resistance-determining region; OXO, oxolinic acid; m-AMSA, 40 (9-acidinylamino)methanesulfon-manisidide. E-mail address of the corresponding author: [email protected] 0022-2836/00/050779±13 $35.00/0

form an active A2B2 tetramer (Reece & Maxwell, 1991; Wigley, 1995). Gyrase is unique amongst topoisomerases in its ability to introduce negative supercoils into DNA using the free energy of ATP hydrolysis. Gyrase catalyses the passage of one segment of DNA through a double-strand break in another that is held open by covalent attachment of the DNA to the protein. Speci®cally, a covalent bond is formed between the 50 -phosphate group of the DNA and Tyr122 of the GyrA subunit. Each protein subunit can be divided into distinct functional domains. The breakage and reunion activity of gyrase is associated with a 64 kDa N-terminal domain of GyrA, the 33 kDa C-terminal domain being involved in DNA binding. The GyrB subunit can be divided into a 43 kDa N-terminal domain involved in ATP hydrolysis and a 47 kDa C-terminal domain, which is involved in interactions with the A subunit and DNA. The 43 kDa fragment of the B subunit has been crystallized in the presence of a non-hydrolysable ATP analogue (Wigley et al., 1991). # 2000 Academic Press

780 Quinolone-resistance mutations in GyrA ®rst implicated gyrase as a target for the quinolone drugs (Gellert et al., 1976; Sugino et al., 1977). Speci®cally, these mutations map to a portion of the N-terminal domain of GyrA known as the quinolone resistance-determining region (QRDR) (Yoshida et al., 1990); this region extends from amino acid residues 67 to 106. Most commonly, mutations occur in Ser83 or Asp87, resulting in high levels of drug resistance. The crystal structure of the 59 kDa N-terminal fragment of GyrA, which encompasses the QRDR, has been solved (Morais Cabral et al., 1997). The structure shows a dimeric Ê, protein with a central hole of approximately 30 A which is large enough to accommodate a DNA duplex. Formation of the dimeric protein creates a large concave surface at the ``top'' of the protein containing many conserved residues, which is thought to be involved in DNA binding. Mutations in GyrA resulting in quinolone resistance are located at the dimer interface. Initial models for quinolone binding suggested that drug contacts were made with single-stranded DNA revealed subsequent to DNA cleavage (Shen et al., 1989). However, it has since been shown that DNA cleavage is not a prerequisite for drug binding (Critchlow & Maxwell, 1996). Quinolone-resistance mutations have also been mapped to the GyrB subunit of gyrase (Yamagishi et al., 1986; Yoshida et al., 1991) at Asp426 and Lys447, which lie in the 47 kDa C-terminal domain of GyrB. How these residues are involved in drug interactions is unclear, although comparison of the 59 kDa gyrase structure with the 92 kDa yeast topoisomerase II structures may provide some clues (Berger et al., 1996; Fass et al., 1999). The 92 kDa yeast fragment shows signi®cant similarity to the C-terminal domain of GyrB and the N-terminal domain of GyrA. In the original structure, the analogous region to the region in GyrB where Asp426 and Lys447 lie, is far away from the residues that make up the QRDR, making it dif®cult to understand how these residues could be involved in drug binding (Berger et al., 1996). However, a more recent structure shows an alternative conformation in which the ``GyrB-like'' residues are positioned closer to the QRDR (Fass et al., 1999). Topoisomerases play important roles in transcription and replication. During replication, DNA gyrase is located just ahead of the replication fork and is responsible for removing the positive supercoils that accumulate as a result of the unwinding of the DNA helix (Cairns, 1963). Without the removal of these positive supercoils, replication would cease due to the topological constraint of the DNA. Early experiments using nalidixic acid demonstrated that the quinolones are potent inhibitors of DNA replication (Deitz et al., 1966; Goss et al., 1965). As described above, resistance mutations had demonstrated that gyrase was a target for the quinolone drugs. However, it seemed unlikely that the action of the quinolones was simply due to the inhibition of gyrase activity,

Gyrase-quinolone-DNA Complexes Block Replication

since under conditions where almost complete inhibition of DNA replication was observed, only low levels of inhibition of gyrase supercoiling were seen (Snyder & Drlica, 1979). Additionally, nalidixic acid was shown to inhibit bacteriophage T7 growth, although T7 replicates as a linear, doublestranded molecule and does not require gyrase for replication (Kreuzer & Cozzarelli, 1979). In an attempt to explain the above results, the ``poison'' hypothesis was proposed (Kreuzer & Cozzarelli, 1979). This hypothesis suggests that the proteindrug-DNA complex acts as a lesion and blocks the passage of the polymerase along the DNA. This hypothesis would explain why DNA replication is inhibited at very low concentrations of drug, since a single stalled replication fork would, in principle, be enough to halt replication, whereas much higher concentrations of drug would be required to completely inhibit supercoiling activity. This poisoning mode of inhibition has been supported by in vitro transcription assays, which demonstrate that the passage of T7 RNA polymerase along the DNA is blocked by the formation of a gyrase-quinolone complex (Willmott et al., 1994). However, the lethal effects of quinolones in vivo are proposed to be associated with replication, rather than with transcription. Topoisomerase IV is also thought to be important in DNA replication, although its major role is probably in resolving interlinked daughter chromosomes following replication. It is unclear whether it plays any role ahead of forks. Hiasa et al. (1996) have reconstituted oriC replication in vitro and have shown that a nor¯oxacin-topoisomerase IV-DNA complex arrests the progress of replication forks. The mechanism of inhibition described above is not unique to quinolones, it appears to explain the action of a number of anti-cancer drugs (Catapano et al., 1997; Hong & Kreuzer, 2000; Hsiang et al., 1989). In this study we have used proteins from bacteriophage T7 to reconstitute replication in vitro. T7 replication can be reconstituted with just three proteins: T7 gene 5 (exo mutant), T7 gene 4 and Escherichia coli thioredoxin (Patel et al., 1991). The T7 polymerase is a complex of the gene 5 protein (79.7 kDa) and E. coli thioredoxin (11.7 kDa), which forms a highly processive polymerase (Tabor et al., 1987). The gene 4 protein exists in two forms, a 63 kDa protein (4A) that has both helicase and primase activity, or a truncated 56 kDa protein (4B) that has only helicase activity (Patel et al., 1992); in this study we used the 4B protein. Using the T7 system, we have investigated replication blocking by a gyrase-quinolone-DNA complex in vitro.

Results Template construction We have constructed substrates to study DNA replication by T7 polymerase in the presence of DNA gyrase. Although gyrase is essentially a non-

Gyrase-quinolone-DNA Complexes Block Replication

speci®c DNA-binding protein, preferred sites of DNA cleavage can be seen in the presence of quinolone drugs, and a ``weak'' consensus sequence has been derived (Lockshon & Morris, 1985). In plasmid pBR322, such a preferred site is found centred at nucleotide 990 (Fisher et al., 1981), termed the 990 site, which has been used in many gyrase studies (Cove et al., 1997; Dobbs et al., 1992; Fisher et al., 1986; Orphanides & Maxwell, 1994).

781 Considering the replication proteins, T7 polymerase requires a free 30 -hydroxyl group and gene 4B helicase requires a region of single-stranded DNA for binding. Templates, containing the 990 site, have been constructed using PCR as outlined in Figure 1(a). Each template is created by combining PCR fragments of differing lengths to produce a partial duplex DNA molecule that contains a region of double-stranded DNA with a single-

Figure 1. (a) Generation of replication templates using PCR. The detail of the construction of one of these templates, the left hand substrate, is outlined. Using pBR322 as a template, two PCR fragments of 235 bp and 275 bp were made using the primers shown. Equimolar amounts of these two fragments were mixed, heated and allowed to anneal. The products of this annealing reaction were examined by electrophoresis through a non-denaturing 5 % polyacrylamide gel in TBE buffer. The sizes of ethidium-stained marker fragments (lane M) are shown along the left side of the gel. Lanes 1 and 2 show the puri®ed 235 bp and 275 bp PCR fragments, respectively. Lane 3 shows the products of the annealing reaction and lane 4 the gel puri®ed ``fork'' DNA. The products of heat treatment of the puri®ed fork DNA at 70  C for ®ve minutes are shown in lane 5, and the proposed structures for each of the DNA bands along the right side of the gel. In order to make the right hand substrate, a third PCR fragment of 315 bp was synthesized using primers A and B* and mixed with the 275 bp fragment. The right hand substrate was puri®ed as for the left hand substrate. (b) Processing of fork substrates by the T7 replication complex. The blue circles represent the replication complex, the continuous red line represents the complementary DNA primer and the broken red line the newly synthesized DNA. We propose that the replication complex moves in the direction shown to release two DNA molecules, a and b. A complementary primer can then anneal to molecule b and the DNA is processed as shown.

782 stranded extension to which a primer can be annealed (Figure 1(a)). In each case, the 990 site is located approximately in the centre of the template. We have used two such constructs in our studies. One, named the left hand substrate, contains a double-stranded region of 235 bp and a single-strand extension of 40 bases at the 30 end of the bottom strand (Figure 1(a), iii). A second, named the right hand substrate, contains a doublestranded region of 275 bp and a single-strand extension of 40 bases at the 30 end of the top strand (not shown). This has allowed us to perform experiments where the replication proteins approach the gyrase binding site from either end of the DNA template. The length of the templates has been dictated by previous studies that have demonstrated that gyrase binds 128 bp of DNA (Orphanides & Maxwell, 1994). Figure 1(a) describes the construction of the left hand substrate. The right hand substrate was created by an identical method but using PCR fragments of 275 and 315 bp (not shown). Combining and annealing the two PCR fragments of different lengths will not yield 100 % of the desired partial duplex molecules; a proportion of the DNA will also anneal to reform the fully complementary starting materials. The partial duplexes can also contain the shorter DNA strand as either the ``top'' or the ``bottom'' strand of the molecule (Figure 1(a), iii and iv). When we examined the products of the annealing reaction on a polyacrylamide gel, three different bands were seen. One band corresponded to the fully double-stranded 235 bp fragment (Figure 1(a), v), and another we concluded to be a combination of the fully complementary 275 bp fragment and the two partial duplex templates (Figure 1(a), ii, iii and iv). The third band, termed the ``fork'' DNA, we suggest is the result of annealing of the two complementary single-stranded extensions of the partial duplex molecules (Figure 1(a), i). Since this DNA ran on a gel as such a discrete band, it seemed unlikely that it was just aggregated DNA. Although unexpected, this provided a fortuitous method to gel-purify the desired DNA from the starting material. Mild heat treatment (up to 70  C) of this fork DNA does not result in re-equilibration to starting material, but results in an increase in the intensity of the band designated as ii, iii and iv (Figure 1(a), track 5), suggesting the formation of the individual partial duplex templates. This supports our proposed structure of the fork DNA. A model suggesting how this fork is processed is presented in Figure 1(b). We believe that the T7 polymerase initially binds to the 30 hydroxyl group shown and moves in the direction indicated in Figure 1(b) to release two DNA molecules. One of these molecules is now fully double-stranded and the second is the desired partial duplex molecule. This partial duplex is now able to bind primer, helicase and polymerase, and the DNA is replicated as shown with displacement of the shorter DNA strand. Evidence for the above comes from

Gyrase-quinolone-DNA Complexes Block Replication

data presented in Figure 5, which is discussed later. For the replication assays, we have used the fork DNA as the template. T7 DNA polymerase arrest by a gyrasequinolone-DNA complex Using the left hand and right hand substrates described above, we have examined the ability of the T7 proteins to replicate through a gyrase-quinolone-DNA complex. We have carried out primed DNA synthesis by annealing the appropriate radiolabelled primer to the extended single-strand of the DNA template. The lengths of the labelled products synthesized have been examined by electrophoresis through a denaturing polyacrylamide gel and autoradiography. Replication of the left hand substrate produces a full-length product of 275 bases (Figure 2(a), Full) plus a series of shorter ``failure'' products. The presence of the helicase was essential for these reactions; we found that replication was greatly reduced in its absence with virtually no full-length product being formed (data not shown). In the presence of gyrase and the quinolone drug cipro¯oxacin (CFX), the passage of the replication proteins along this template is blocked as indicated by the formation of a truncated DNA product of 150 bases (Figure 2(a), Truncate). The length of this truncated product is consistent with the arrest of replication 10 bp upstream of the 990 site. In reactions containing drug alone or gyrase alone, truncated products are not observed (Figure 2(a)). A small attenuation of the amount of full-length product is seen in the presence of high concentrations of drug or gyrase alone. The same site of blocking was observed when these experiments were carried out in the presence of oxolinic acid (OXO), although approximately ten times more of this drug was required to achieve the equivalent effects seen with CFX. This difference is consistent with the different potencies of the two drugs (Wolfson & Hooper, 1985). Experiments were carried out in an identical manner using the right hand substrate as a template in which the replication proteins approach the centrally located 990 site from the opposite end of the DNA molecule. Replication of this DNA molecule produces a full-length product of 315 bases (data not shown). When these experiments were carried out in the presence of gyrase and CFX, replication arrest occurred at three different sites. The major site of arrest was at the 990 site, as indicated by the formation of a truncated product of 141 bases. However, two other minor sites of blocking were observed downstream of this site. In the presence of OXO, blocking occurs only at the 990 site. This is consistent with previous studies that have shown that OXO favours cleavage at this site (Fisher et al., 1981). Sites of replication blocking and drug-induced cleavage were mapped on the replication substrates. We found that the sites of replication arrest

783

Gyrase-quinolone-DNA Complexes Block Replication

Figure 2. (a) Autoradiograph of the products formed from the replication of the left hand substrate in which gyrase approaches the 990 site from the left side of the molecule. Reactions contained 14 nM DNA, 80 nM gyrase and the concentration of CFX shown above each lane of the gel. Replication was initiated by the addition of 80 nM T7 polymerase and 50 nM helicase, and allowed to proceed for ten minutes at 37  C. The sizes of radiolabelled marker DNA fragments (lane M) are shown along the side of the gel. The arrows marked as Full and Truncate represent the 275 base full-length product and the 150 base product, formed as a result of blocking at the 990 site, respectively. (b) A summary of the positions of replication arrest in the presence of gyrase and either cipro¯oxacin or oxolinic acid. Part of the DNA sequence of the 275 bp fragment is shown; the pBR322 990 site is indicated. The sites at which blocking occurs are represented by the black or white boxes. Black boxes represent major sites of blockage, and white boxes represent minor sites. The arrows indicate the exact positions at which the DNA is cleaved by gyrase and the numbers on the bars indicate the distance from the centre of the cleavage site.

correlate with the patterns of DNA cleavage observed in the presence of drug (data not shown). Sites of cleavage are revealed by treatment of the gyrase-drug-DNA complex with SDS and proteinase K. It has not been possible to precisely map the position of cleavage for one of the minor gyrase binding sites due to the low level of cleavage observed at this site. A summary of the positions of blocking for the two templates is shown in Figure 2(b). At each site, blocking occurs 10 bp to 14 bp upstream of the actual point of cleavage, probably because of steric hindrance between the bound gyrase and the approaching replication proteins. These results are consistent with previous experiments presented for RNA polymerase (Willmott et al., 1994). As with previous work, we did not ®nd any evidence for blocking further from the cleavage sites, suggesting that the DNA

wrapped around the gyrase complex does not present a signi®cant barrier for polymerases. Mutant gyrase proteins The nature of the gyrase-drug complex on DNA has been further investigated by examining replication in the presence of mutant GyrA and GyrB proteins. The quinolone-resistance mutation Ser83 to Trp in the GyrA subunit confers high-level resistance to quinolone drugs (Cullen et al., 1989; Willmott & Maxwell, 1993; Yoshida et al., 1988). Using the left hand substrate as a template, we have examined the ability of this mutant protein to arrest replication in the presence of CFX. Under conditions where approximately 50 % blocking occurred for wild-type protein, as estimated by the relative amounts of the full-length and truncated 150 base product, blocking was not observed for

784

Figure 3. Autoradiograph of the products formed from the replication of the left hand substrate in the presence of mutant gyrase proteins. (a) Mutations at residues 83 and 122 of GyrA are represented as trp and ser, respectively, and wild-type protein is represented as wt. (b) Mutations at residues 426 and 447 of GyrB are represented as asn and glu, respectively. Reactions contained 14 nM DNA, 80 nM wt or mutant gyrase and the concentration of CFX shown above each lane of the gel. Replication was initiated by the addition of 80 nM T7 polymerase and 50 nM helicase and allowed to proceed for ten minutes at 37  C. In each case, the sizes of radiolabelled marker DNA fragments (lane M) are shown along the left side of the gel. The arrow marked as Full represents the 275 base full-length product and the arrow marked as Truncate represents the 150 base truncated product formed as a result of blocking at the 990 site.

Gyrase-quinolone-DNA Complexes Block Replication

the quinolone-resistant protein (Figure 3(a)). Even when the drug concentration was increased to 200 mM, we were unable to see any blocking (Figure 3(a)). This result is consistent with previous studies demonstrating that gyrase proteins carrying this mutation show virtually no drug binding (Willmott & Maxwell, 1993). Further experiments have investigated the ability of an active-site mutant, in which Tyr122 of GyrA is mutated to Ser, to arrest replication. No blocking was observed at low or high drug concentrations (Figure 3(a)), even though this mutant exhibits levels of DNA and drug binding similar to wildtype (Critchlow & Maxwell, 1996). This suggests that the DNA cleavage activity of gyrase is an essential factor for the formation of a complex that is able to arrest replication. As already described, mutations conferring quinolone-resistance have been mapped to the B subunit of gyrase (Yamagishi et al., 1986). One of these mutations in which Asp426 is mutated to Asn, results in low-level resistance to quinolone drugs. The mutation of Lys447 to Glu is a second mutation commonly found in GyrB. Interestingly, early studies suggested that this mutation conferred resistance to acidic quinolones such as OXO and sensitivity to amphoteric quinolones such as CFX (Yamagishi et al., 1986). We have examined the ability of these mutant proteins to block the progress of the replication proteins, using the left hand substrate as a template in the presence of CFX (Figure 3(b)). Gyrase proteins carrying a mutation at residue 426 in GyrB arrest replication as indicated by the formation of a truncated DNA product characteristic of a block at the 990 site. However, higher concentrations of drug are required to achieve the same levels of blocking seen with wild-type protein (Figure 3(b)). For wildtype protein, 8 mM CFX is suf®cient to produce 50 % blocking, compared with a concentration of 200 mM CFX required to produce the same percentage of blocking by the 426 mutant. These results are consistent with the idea that this mutation confers resistance to quinolones, and reduced drug binding has been demonstrated for this protein (Heddle et al., 2000). However, the level of resistance is low compared to the Ser83 to Trp mutation of GyrA, which gives such high levels of resistance that we were unable to observe any blocking (Figure 3(a)). This is not surprising, since the GyrA(Trp83) and GyrB(Asn426) mutations are classi®ed as high-level and low-level resistant, respectively. We have demonstrated that proteins carrying a mutation at residue 447 of GyrB are able to block replication (Figure 3(b)). In the presence of CFX, we had expected that this mutant would produce at least equivalent levels of blocking to wildtype. However, the amount of blocked product observed was equivalent to, if not less than, the levels seen for the 426 mutant (see Discussion).

785

Gyrase-quinolone-DNA Complexes Block Replication

Correlation of polymerase blocking with DNA cleavage

Figure 4. (a) Autoradiograph of the products formed from the replication of the left hand substrate. Timecourse reactions contained 80 nM gyrase, 160 nM T7 polymerase and 100 nM helicase in the presence or absence of 40 mM CFX (as indicated at the top of the gel). Samples were taken from the reaction at the times shown (minutes), stopped with EDTA and the products examined by electrophoresis through a denaturing polyacrylamide gel. The sizes of radiolabelled marker DNA fragments (lane M) are shown along the left side of the gel and the arrow marks the position of the truncated DNA product formed as a result of replication blocking at the 990 site. (b) Autoradiograph of products formed from the cleavage of the fully complementary 275 bp DNA. Time-course reactions contained 14 nM DNA, 80 nM gyrase and 40 mM CFX. Samples were taken from the reaction at the times shown (minutes) above the gel and stopped with SDS and proteinase K. The sizes of labelled marker fragments are shown along the left side of the gel and the arrows indicate the two products formed from cleavage at the 990 site. (c) The amount of product formed as a result of blocking at the 990 site (white circles) and the amount of DNA cleaved (black circles) at the 990 site is shown for each time-point taken.

It has been shown that the inhibition of supercoiling and the induction of DNA cleavage are distinct steps of the interaction of quinolones with the gyrase-DNA complex (Kampranis & Maxwell, 1998a,b; Willmott, 1993). We wanted to establish whether replication blocking correlates with supercoiling inhibition or induction of cleavage. In order to investigate this, we examined the kinetics of blocked-product formation as a result of arrest at the 990 site and the rate of double-strand DNA cleavage at this site (Figure 4). Replication assays were carried out using the left hand substrate and in the presence of 40 mM CFX. Reactions were initiated by the simultaneous addition of polymerase and CFX. Samples were removed from the reaction at timed intervals and stopped with EDTA. The products formed were then examined by electrophoresis through a denaturing polyacrylamide gel (Figure 4(a)). Background product levels, determined from replication reactions in the absence of drug, were subtracted from reactions in the presence of drug. (Background is de®ned as any product of 150 bases seen in the absence of drug due to random termination of replication.) Cleavage assays were performed using the fully complementary 275 bp DNA as a template. This DNA is essentially the same as the left hand substrate in terms of the 990 site and surrounding sequence. The only difference is that the left hand substrate contains a region of single-stranded DNA at one end of the molecule to allow primer annealing. Cleavage reactions were initiated by the addition of CFX. At timed intervals, samples were removed from the reaction and stopped by the addition of SDS and proteinase K. The cleavage products were examined by electrophoresis through a non-denaturing polyacrylamide gel (Figure 4(b)). The rate of formation of the truncated product (150 bases) does not exceed that for DNA cleavage at the 990 site (Figure 4(c)). In both cases, the reactions start to plateau at approximately ten minutes, indicating that blocking and cleavage occur on similar time-scales. In both reactions, there will be an equilibrium between drug-free and drug-bound complexes. For the cleavage reaction, this will not affect the ®nal end-point of the reaction. However, since the template used in the blocking assay can be replicated only once, a portion of the DNA will be utilised before the formation of the cleavable complex and the end-point of this reaction will never reach the same point as the cleavage reaction; hence the lower amplitude seen for blocking. Thus, the results in Figure 4 are consistent with replication blocking and DNA cleavage following similar kinetics. We therefore conclude that blocking correlates with DNA cleavage, consistent with the observation that the active-site mutant is unable to block the progress of the replication proteins. It is possible that cleavage of a single strand

786

Gyrase-quinolone-DNA Complexes Block Replication

of the DNA is suf®cient to cause blocking and we have not ruled out this possibility. However, if this were the case, it might be expected that the rate of formation of the blocked product would be greater than the rate of formation of the DNA cut in both strands, but this is not observed. Collision is not sufficient to render the gyrase-drug-DNA complex irreversible The inhibition of replication by quinolone drugs is apparently a reversible event (Drlica & Zhao, 1997). Therefore, additional events must occur in the cell that result in the formation of an irreversible lesion on the DNA and eventually the release of double-strand breaks causing cell death. One possibility is that the collision of the replication fork with the gyrase-drug-DNA complex is suf®cient to result in the above events. We have investigated this possibility using the left hand substrate. Rather than using a radiolabelled primer and looking at product formation, as previously, we labelled the template DNA and have examined the fate of this DNA following replication fork collision. Replication reactions contained gyrase alone, CFX alone, or gyrase and CFX, and were allowed to proceed for ten minutes. One set of reactions was stopped with EDTA and the other set with SDS and proteinase K (Figure 5); control reactions lacking the replication proteins are shown. In the reactions containing gyrase or drug alone, no DNA cleavage was observed under any conditions, as expected. In the presence of gyrase and CFX ( replication proteins), DNA cleavage was revealed by the addition of SDS and proteinase K. When the reactions were stopped with EDTA, a small amount of cleavage was observed. However, this amount was the same in both the absence and the presence of the polymerase and helicase proteins, showing that the cleaved product was not formed as a result of fork collision. The lack of cleaved product in the reactions terminated with EDTA suggests that all the gyrase-drug-DNA complexes remain reversible following replication fork collision. In each of the reactions that contained the polymerase and helicase proteins, we noted depletion of the lower labelled 235 base strand of the template. This observation will be discussed later based on the proposal shown in Figure 1(b), outlining how these fork templates are replicated. The reactions described above were all carried out in the presence of 8 mM CFX. Similar assays have been performed in the presence of 40 mM and 80 mM CFX, and in the presence of 200 mM OXO (data not shown). The results for these assays were comparable to those described above.

Discussion It is well established that the principal target for the quinolone drugs in E. coli, and many other bacteria, is DNA gyrase (Maxwell, 1997). However, in

Figure 5. Collision experiments using the left hand substrate. Reactions contained 14 nM labelled DNA, in the presence of 80 nM gyrase alone, 8 mM CFX alone or gyrase and CFX as indicated at the top of the gel. These reactions were carried out in either the presence (‡) or absence ( ) of the T7 polymerase (80 nM) and helicase (50 nM). One set of reactions was terminated by the addition of EDTA (E) and the other set by the addition of SDS and proteinase K (S). The arrows marked 990 indicate the fragments formed due to cleavage at the 990 site; the arrows marked 275 and 235 indicate the 275 and 235 base fragments, respectively. The sizes of marker DNA fragments are shown along the left side of the gel.

some bacteria, particularly Gram-positive organisms, the preferred target is DNA topoisomerase IV (Drlica & Zhao, 1997). It has been clear for some time that these agents do not kill bacteria by inhibiting the enzymatic activity of the target enzyme (DNA supercoiling in the case of DNA gyrase) (Snyder & Drlica, 1979), leading to the proposal of the ``poison'' hypothesis (Kreuzer & Cozzarelli, 1979). A number of studies have investigated this proposal, the ®rst of which examined the ability of the antitumour drug camptothecin to inhibit replication in a cell-free SV40 DNA replication system (Hsiang et al., 1989). Camptothecin-mediated inhibition of replication resulted in the accumulation of linearised replication products, which were covalently attached to the topoisomerase. Camptothecin cytotoxicity was abolished by the presence of aphidicolin, an inhibitor of replicative DNA polymerases. It was concluded that topoisomerase I becomes trapped in a protein-drug-DNA cleavable

Gyrase-quinolone-DNA Complexes Block Replication

complex, resulting in arrest of the replication fork and possibly fork breakage. Following these results, Bendixen et al. (1990) demonstrated that a camptothecin-topoisomerase I-DNA complex is able to arrest transcription in vitro. Willmott et al. (1994) went on to examine the inhibition of transcription by quinolone drugs. Using an in vitro transcription assay, they demonstrated that a gyrase-quinolone complex on DNA forms a lesion that blocks the passage of T7 or E. coli RNA polymerase. Hiasa et al. (1996) have examined the ability of a topoisomerase IV-nor¯oxacin-DNA complex to arrest DNA replication. They have reconstituted oriC DNA replication and shown that such a complex blocks the passage of DNA polymerase III. DNA cleavage activity appears to be an essential factor for the formation of a complex that is able to arrest the polymerase, as evidenced by a mutant lacking this activity being unable to block replication. Some evidence has been presented to suggest that collision of the replication fork with the topoisomerase-drug-DNA complex results in the conversion of this complex to an irreversible form, but does not result in the release of double-strand DNA breaks. Hiasa et al. (1996) have therefore proposed that quinolone cytotoxicity occurs in two steps, conversion of the enzyme-drug-DNA complex to an irreversible form and processing of this complex to release the DNA breaks. Factors involved in this proposed processing have not been identi®ed. The lethal effects of nalidixic and oxolinic acid are blocked by inhibitors of protein synthesis (Chen et al., 1996; Deitz et al., 1966), providing some evidence that a protein factor is required for the release of DNA ends from the topoisomerasedrug DNA complexes. However, the above is not true for all quinolones. For the more potent ¯uoroquinolones, an alternative mode for release of DNA ends has been proposed that suggests that the ¯uoroquinolones are able to force gyrase-DNA complexes apart (Chen et al., 1996). The resulting subunit dissociation causes the release of DNA ends, although the gyrase subunits are still attached. Since helicases run ahead of polymerases during replication, it is possible that the conversion of topoisomerase-drug-DNA complexes to an irreversible form is due to an encounter with the helicase rather than the polymerase. Howard et al. (1994) have shown that the collision of E. coli helicase II with an m-AMSA-induced phage T4 topoisomerase cleavage complex results in an irreversible DNA break caused by displacement of the DNA strands from the complex. However, a subsequent report involving nor¯oxacin-topoisomerase IV complexes suggests that with other helicases or topoisomerases, collision may not be suf®cient for release of DNA breaks (Shea & Hiasa, 1999). Most recently, data investigating the consequences of UvrD collision with the ternary complex has been presented (Shea & Hiasa, 2000).

787 The ®rst direct evidence that a topoisomerasedrug-DNA complex can block replication in vivo has been presented by Hong & Kreuzer (2000). Using bacteriophage T4 as a model system, they have examined replication in the presence of mAMSA, and found that the drug-induced cleavage complex blocks the fork without revealing DNA breaks. Here, we aimed to investigate replication blocking by the DNA gyrase-quinolone complex. The ®rst clue to the action of quinolones in blocking replication came from experiments carried out by Kreuzer & Cozzarelli (1979). Therefore, we set out to reproduce these studies in vitro to provide a system whereby the consequences of collision of the T7 replication complex with the gyrase-quinolone complex on DNA could be investigated. An essential feature of this work was to synthesise DNA molecules that could be utilized as replication templates by T7 polymerase and that contained the gyrase-quinolone complex bound at a speci®c location. It is well established that, in the presence of quinolone drugs, gyrase cleaves pBR322 at a site centred at nucleotide 990. We therefore synthesized substrates containing this site and an overhanging single-stranded region for priming of the T7 replication complex. The method for generating such substrates led to the appearance of a DNA species (termed the fork substrate) formed by the annealing of the overhanging complementary ends of the two partial duplex molecules (Figure 1). A proposal for how this breaks down into the ``proper'' substrate in the presence of the T7 proteins is described in Figure 1(b). Evidence for this model comes from the data shown in Figure 5. In these reactions, the substrate DNA was radiolabelled and so we were able to examine the fate of the template DNA. Depletion of the lower 235 base band was observed in all reactions containing the T7 proteins, but not in reactions that lacked these proteins (Figure 5). If replication were to occur as described in Figure 1(b), one of the 235 base strands would be extended to 275 bases, resulting in four strands of 275 bases and one strand of 235 bases at the end of the reaction, hence the depletion of the 235 base band. Since the primer was not radiolabelled in these reactions, only three of the 275 base bands will be detected on a gel by autoradiography. Obviously, in the presence of gyrase and drug, replication of the partial duplex molecule b will be blocked at the 990 site. Using the left hand substrate, we have shown that in the absence of gyrase the expected 275 base product was synthesized (Figure 2(a)). The same product was observed in the presence of gyrase alone or quinolone alone. However, in the presence of both gyrase and quinolone, depletion of this product was observed with the appearance of a 150 base truncated product. We have demonstrated equivalent results using the right hand substrate, in which the replication proteins approach the 990 site from the opposite side. However, with this substrate we found that blocking occurred also

788 at two other minor sites. These minor sites of blocking were seen only in the presence of cipro¯oxacin. Oxolinic acid favoured blocking at the 990 site. We have accurately mapped all the sites of blocking and have found that these sites correlate with the position of DNA cleavage in the presence of quinolone and that replication arrest occurs 10 bp upstream of the cleavage site (Figure 2(b)). It is interesting to note how close the polymerase is able to get to the cleavage site. Since gyrase wraps 128 bp of DNA around itself, it is possible that this wrapped segment is suf®cient to block the passage of the polymerase. This does not appear to be the case, suggesting that the polymerase is able to peel the DNA away from gyrase and that blocking only occurs close to the point at which the DNA is covalently attached. Blocking of the replication proteins 10 bp upstream from the cleavage site is consistent with work carried out by Willmott et al. (1994), who obtained similar results with RNA polymerase. Using an active-site mutant, we have shown that the DNA cleavage-religation activity of gyrase is essential for arrest of the replication complex, since we were unable to demonstrate replication blocking with the mutant protein (Figure 3(a)). We have examined the ability of quinolone-resistance mutants of gyrase to arrest replication. For the GyrA mutant Ser83 to Trp, we were unable to see any polymerase blocking even at concentrations that were 25 times those required to see signi®cant blocking with wild-type. (At higher CFX concentrations, in the absence of DNA gyrase, nonspeci®c inhibition of DNA replication was observed.) This is consistent with other data demonstrating that this protein has a very high level of resistance and shows greatly reduced levels of drug binding (Cullen et al., 1989; Willmott & Maxwell, 1993; Yoshida et al., 1988). For the lowlevel resistant GyrB mutant, Asp426 to Asn, we were able to show some replication blocking but approximately 25 times more CFX was required to produce the same levels as those seen with wildtype protein (Figure 3(b)). Again these data are consistent with previously presented work demonstrating drug resistance by this mutant, but at a lower level than the GyrA mutant (Yoshida et al., 1993). The results of blocking experiments on the GyrB Lys447 to Glu mutant were not as easy to interpret. Some reports have suggested that this mutant shows hypersensitivity to amphoteric quinolones such as CFX (Yamagishi et al., 1986), but we were unable to demonstrate this hypersensitivity in our experiments. In fact, we were unable to demonstrate levels of blocking equivalent to that of the wild-type protein. Binding studies have shown reduced levels of DNA binding for this mutant compared to wild-type protein, which probably accounts for the low level of polymerase blocking (Heddle, 2000). Inspection of Figure 3 shows that in the presence of gyrase alone there is some loss of replication products for the wild-type enzyme and all mutants, except GyrB Lys447 to Glu, con-

Gyrase-quinolone-DNA Complexes Block Replication

sistent with this mutant being less able to bind DNA. Earlier work had suggested that inhibition of DNA supercoiling and induction of DNA cleavage are distinct events (Kampranis & Maxwell, 1998a,b). In order to determine whether polymerase blocking is associated with inhibition of supercoiling or the induction of cleavage, we performed reactions that compared the rate of DNA cleavage at the 990 site alongside reactions to measure the rate at which replication blocking occurs (Figure 4). From these experiments, we have shown that replication blocking correlates with the rate of doublestrand DNA cleavage. These data support the work presented for the active-site mutant, from which we conclude that DNA cleavage is necessary for replication arrest. It is possible that the activesite mutant does not go through the same conformation changes as wild-type and that blocking does not occur for this reason. However, proteolysis data have been presented that suggest that this is probably not the case (Kampranis & Maxwell, 1998a). Under the conditions used in the blocking experiment, we are working at the maximal rate of polymerization, but we cannot rule out the possibility that polymerization is rate-limiting in our reactions. It is therefore possible that the rate of polymerization (rather than the rate of DNA cleavage) limits the rate of formation of blocked products. However, all the data presented here and in other reports provide good evidence for a correlation between double-strand cleavage and polymerase blocking. Finally, we have investigated the consequences of the collision of the replication complex with the frozen gyrase-quinolone-DNA complex. We have found that fork collision is not suf®cient to render the gyrase-drug-DNA complex irreversible. Therefore, in keeping with the results of other work, it seems likely that other proteins are involved in the processing of gyrase-drug complexes on DNA. The identi®cation of these proteins is now an important priority in understanding how drugs of this type achieve their cytotoxic action.

Materials and Methods Proteins and drugs Wild-type and mutant GyrA and GyrB were puri®ed as described (Maxwell & Howells, 1999). All gyrase proteins were kind gifts from Mrs A.J. Howells, except for the mutant GyrB proteins, which were kindly provided by Dr J.G. Heddle. The T7 gene 5 (exo mutant) and the T7 gene 4 proteins were kind gifts from Dr S.S. Patel (University of Medicine and Dentistry of New Jersey, USA). E. coli thioredoxin was purchased from Promega. The T7 exo DNA polymerase was reconstituted immediately prior to use by mixing the exo gene 5 protein with thioredoxin (in 5 mM DTT) in a 1:20 molar ratio (Patel et al., 1991). The gene 5 protein was stored at 80  C in 50 mM Tris-HCl (pH 7.5), 0.1 mM EDTA, 5 mM DTT, 50 % (v/v) glycerol, 50 mM KCl and the gene 4 proteins were stored at 80  C in 50 mM Tris-

789

Gyrase-quinolone-DNA Complexes Block Replication HCl (pH 7.5), 0.1 mM EDTA, 1 mM DTT, 50 % (v/v) glycerol. Both proteins were diluted to the required concentration in 40 mM Tris-HCl (pH 7.5), 1 mM DTT, 0.1 mM EDTA, 100 mg/ml bovine serum albumin (BSA). PCR reactions were performed using Pfu DNA polymerase from Stratagene. Oxolinic acid was purchased from Sigma and cipro¯oxacin was a gift from Bayer. DNA PCR fragments were produced using a Perkin Elmer GeneAMP 9600 and were puri®ed using a Qiagen QIAquick PCR puri®cation kit. The primers used in the PCR reactions were: A, GCCTGTCGCTTGCGGTATTC; A*, TCAAGCCTTCGTCACTGGTC; B, GAGCGATCCTTGAAGCTGTC; B*, TCAGCGGTCCAGTGATCGAA. Replication templates were prepared as described in Results. Equimolar amounts of the PCR fragments were heated to 94  C for ®ve minutes, in the presence of 50 mM NaCl and 5 mM MgCl2, followed by rapid cooling on ice to allow annealing. The desired DNA was puri®ed by electrophoresis through a non-denaturing, TBE (100 mM Tris, 83 mM boric acid, 1 mM EDTA) 5 % (w/v) polyacrylamide gel. The DNA was eluted from the gel by crushing the gel and soaking it overnight at 15  C in buffer containing 500 mM ammonium acetate, 10 mM magnesium acetate and 1 mM EDTA (Sambrook et al., 1989). Following centrifugation in a microfuge at 12,000 rpm for one minute at 4  C, the supernatant was ®ltered through siliconised glass-wool. The DNA was precipitated with ethanol and resuspended in 10 mM Tris-HCl (pH 7.5), 0.1 mM EDTA. DNA concentrations were determined by measuring absorbance at 260 nm or by comparison with marker fragments. Concentrations for the replication templates are quoted in terms of the partial duplex DNA molecules. Radiolabelling of the 50 ends of the DNA was performed using T4 polynucleotide kinase (GibcoBRL) and [g-32P]ATP (ICN) using the method described by Sambrook et al. (1989). Replication assays Replication reactions (30 ml) were carried out in 40 mM Tris-HCl (pH 7.5), 50 mM NaCl, 10 mM MgCl2, 2 mM DTT, 0.1 mM EDTA, 100 mg/ml BSA. For standard reactions, the template DNA (14 nM) was pre-incubated with buffer, a twofold molar excess of the appropriate primer, DNA gyrase and quinolone for one hour at 25  C. This was followed by the addition of 200 mM each dATP, dCTP, dTTP and dGTP, 80 nM T7 DNA polymerase and 50 nM T7 4B helicase, and incubation at 37  C for ten minutes. Reactions were stopped with 20 mM EDTA (pH 8.0) and the DNA was precipitated using ethanol. Samples were resuspended in 98 % (v/v) formamide, 10 mM EDTA (pH 8.0), 0.025 % (w/v) xylene cyanol FF, 0.025 % (w/v) bromophenol blue and examined by electrophoresis through a 30 cm  40 cm, denaturing 6 % polyacrylamide (19:1 (w/w) acrylamide/ bis-acrylamide) gel that contained 7 M urea and 30 % (v/v) formamide in TBE buffer. Gels were dried and subjected to autoradiography overnight. For the replication time-courses, the template DNA was pre-incubated with primer and gyrase in replication buffer for one hour at 25  C. This was followed by the addition of each of the dNTPs (as above) and 100 nM T7 4B helicase. A zero time-point was taken from the mix before initiating the reactions by the simultaneous addition of 160 nM T7 DNA polymerase and 40 mM

CFX. Samples were taken from the reaction at timed intervals, stopped in 50 mM EDTA and treated as described above. These gels were analysed quantitatively using a Molecular Dynamics Phosphorimager. The collision experiments were carried out as for the standard replication assays, except that samples were stopped in either 30 mM EDTA (pH 8.0) or 0.2 % (w/v) SDS, 0.1 mg/ml proteinase K as indicated. The latter samples were heated to 37  C for 30 minutes, followed by precipitation of the DNA samples with ethanol. To map sites of blocking and quinolone-induced cleavage, a sequencing ladder was generated from the PCR fragments using the Amersham Thermosequence cycle sequencing kit. DNA cleavage assays DNA cleavage reactions (Figure 4) were carried out in the replication buffer described above and using the 275 bp fully complementary DNA as a template. The DNA (14 nM) was pre-incubated with buffer and gyrase for one hour at 25  C and the reactions were initiated by the addition of CFX. Samples were removed from the reaction and stopped with 0.2 % (w/v) SDS, 0.1 mg/ml proteinase K, as described above, followed by 30 minutes incubation at 37  C. Chloroform/isoamyl alcohol (24:1, v/v) and loading dye were then added to the reactions, the samples were vortex mixed, spun for one minute at 12,000 rpm and loaded onto a non-denaturing, 5 % TBE polyacrylamide gel. Gels were dried and analysed using a Molecular Dynamics Phosphorimager. For the mapping experiments described in Figure 2(b), cleavage reactions contained the components described above, but were incubated at 37  C for two hours and stopped with SDS and proteinase K as above. Samples were run on a 30 cm  40 cm denaturing 6 % polyacrylamide gel containing urea and formamide in order to determine the size of the cleavage products accurately.

Acknowledgements We thank Faye Barnard, Jonathan Heddle and Chris Willmott for comments on the manuscript, and Symon Erskine for useful discussions. We thank Dr S.S. Patel for gifts of T7 replication proteins. Support for this work was provided by a grant from the Wellcome Trust.

References Bendixen, C., Thomsen, B., Alsner, J. & Westergaard, O. (1990). Camptothecin-stabilized topoisomerase I-DNA adducts cause premature termination of transcription. Biochemistry, 29, 5613-5619. Berger, J. M., Gamblin, S. J., Harrison, S. C. & Wang, Ê resolution of a 92 K J. C. (1996). Structure at 2.7 A yeast DNA topoisomerase II fragment. Nature, 379, 225-232. Cairns, J. (1963). The bacterial chromosome and its manner of replication as seen by autoradiography. J. Mol. Biol. 6, 208-213. Catapano, C. V., Carbone, G. M. R., Pisani, F., Qiu, J. & Fernandes, D. J. (1997). Arrest of replication fork progression at sites of topoisomerase II-mediated DNA cleavage in human leukemia CEM cells incubated with VM-26. Biochemistry, 36, 5739-5748. Chen, C.-R., Malik, M., Snyder, M. & Drlica, M. (1996). DNA gyrase and topoisomerase IV on the bacterial

790 chromosome: quinolone-induced DNA cleavage. J. Mol. Biol. 258, 627-637. Cove, M. E., Tingey, A. P. & Maxwell, A. (1997). DNA gyrase can cleave short DNA fragments in the presence of quinolone drugs. Nucl. Acids Res. 25, 2716-2722. Critchlow, S. E. & Maxwell, A. (1996). DNA cleavage is not required for the binding of quinolone drugs to the DNA gyrase-DNA complex. Biochemistry, 35, 7387-7393. Cullen, M. E., Wyke, A. W., Kuroda, R. & Fisher, L. M. (1989). Cloning and characterisation of a DNA gyrase A gene from Escherichia coli that confers clinical resistance to 4-quinolones. Antimicrob. Agents Chemother. 33, 886-894. Deitz, W. H., Cook, T. M. & Goss, W. A. (1966). Mechanism of action of nalidixic acid on Escherichia coli. III. Conditions required for lethality. J. Bacteriol. 91, 768-773. Dobbs, S. T., Cullis, P. M. & Maxwell, A. (1992). The cleavage of DNA at phosphorothioate internucleotidic linkages by DNA gyrase. Nucl. Acids Res. 20, 3567-3573. Drlica, K. & Zhao, X. (1997). DNA gyrase, topoisomerase IV, and the 4-quinolones. Microbiol. Mol. Biol. Rev. 61, 377-392. Fass, D., Bogden, C. E. & Berger, J. M. (1999). Quaternary changes in topoisomerase II may direct orthogonal movements of two DNA strands. Nature Struct. Biol. 6, 322-326. Fisher, L. M., Mizuuchi, K., O'Dea, M. H., Ohmori, H. & Gellert, M. (1981). Site-speci®c interaction of DNA gyrase with DNA. Proc. Natl Acad. Sci. USA, 78, 4165-4169. Fisher, L. M., Barot, H. A. & Cullen, M. E. (1986). DNA gyrase complex with DNA: determinants for sitespeci®c DNA breakage. EMBO J. 5, 1411-1418. Gellert, M., O'Dea, M. H., Itoh, T. & Tomizawa, J. (1976). Novobiocin and coumermycin inhibit DNA supercoiling catalyzed by DNA gyrase. Proc. Natl Acad. Sci. USA, 73, 4474-4478. Goss, W. A., Deitz, W. H. & Cook, T. H. (1965). Mechanism of action of nalidixic acid on Escherichia coli. II. Inhibition of deoxyribonucleic acid synthesis. J. Bacteriol. 89, 1068-1074. Heddle, J. G. (2000). DNA gyrase, quinolone drugs and mutations in GyrB. Ph.D. thesis, University of Leicester. Heddle, J. G., Barnard, F. M., Wentzell, L. M. & Maxwell, A. (2000). The interaction of drugs with DNA gyrase: a model for the molecular basis of quinolone action. Nucleosides Nucleotides Nucl. Acids, 19, 1249-1264. Hiasa, H., Yousef, D. O. & Marians, K. J. (1996). DNA strand cleavage is required for replication fork arrest by a frozen topoisomerase-quinolone-DNA ternary complex. J. Biol. Chem. 271, 26424-26429. Hong, G. & Kreuzer, K. N. (2000). An antitumor druginduced topoisomerase cleavage complex blocks a T4 replication fork in vivo. Mol. Cell. Biol. 20, 594603. Howard, M. T., Neece, S. H., Matson, S. W. & Kreuzer, K. N. (1994). Disruption of a topoisomerase-DNA cleavage complex by a DNA helicase. Proc. Natl Acad. Sci. USA, 91, 12031-12035. Hsiang, Y.-H., Libou, M. G. & Liu, L. F. (1989). Arrest of replication forks by drug-stabilized topoisomerase I-DNA cleavable complexes as a mechanism of

Gyrase-quinolone-DNA Complexes Block Replication cell killing by camptothecin. Cancer Res. 49, 50775082. Kampranis, S. C. & Maxwell, A. (1998a). Conformational changes in DNA gyrase revealed by limited proteolysis. J. Biol. Chem. 273, 22606-22614. Kampranis, S. C. & Maxwell, A. (1998b). The DNA gyrase-quinolone complex: ATP hydrolysis and the mechanism of DNA cleavage. J. Biol. Chem. 273, 22615-22626. Kreuzer, K. N. & Cozzarelli, N. R. (1979). Escherichia coli mutants thermosensitive for deoxyribonucleic acid gyrase subunit A: effects on deoxyribonucleic acid replication, transcription, and bacteriophage growth. J. Bacteriol. 140, 424-435. Lockshon, D. & Morris, D. R. (1985). Sites of reaction of Escherichia coli DNA gyrase on pBR322 in vivo as revealed by oxolinic acid-induced plasmid linearization. J. Mol. Biol. 131, 63-74. Maxwell, A. (1997). DNA gyrase as a drug target. Trends Microbiol. 5, 102-109. Maxwell, A. & Howells, A. J. (1999). Overexpression and puri®cation of bacterial DNA gyrase. In Protocols for DNA topoisomerases. I. DNA Topology and Enzyme Puri®cation (Bjornsti, M.-A. & Osheroff, N., eds), pp. 135-144, Humana Press, Towata, NJ. Morais Cabral, J. H., Jackson, A. P., Smith, C. V., Shikotra, N., Maxwell, A. & Liddington, R. C. (1997). Structure of the DNA breakage-reunion domain of DNA gyrase. Nature, 388, 903-906. Orphanides, G. & Maxwell, A. (1994). Evidence for a conformational change in the DNA gyrase-DNA complex from hydroxyl radical footprinting. Nucl. Acids Res. 22, 1567-1575. Patel, S. S., Wong, I. & Johnson, K. A. (1991). Pre-steady-state kinetic analysis of processive DNA replication including complete characterization of an exonuclease-de®cient mutant. Biochemistry, 30, 511-525. Patel, S. S., Rosenberg, A. H., Studier, F. W. & Johnson, K. A. (1992). Large scale puri®cation and biochemical characterization of T7 primase/helicase proteins. J. Biol. Chem. 267, 15013-15021. Reece, R. J. & Maxwell, A. (1991). DNA gyrase: structure and function. CRC Crit. Rev. Biochem. Mol. Biol. 26, 335-375. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edit., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Shea, M. E. & Hiasa, H. (1999). Interactions between DNA helicases and frozen topoisomerase IV-quinolone-DNA ternary complexes. J. Biol. Chem. 274, 22747-22754. Shea, M. E. & Hiasa, H. (2000). Distinct effects of the UvrD helicase on topoisomerase-quinolone-DNA ternary complexes. J. Biol. Chem. 275, 14649-14658. Shen, L. L., Mitscher, L. A., Sharma, P. D., O'Donnell, T. J., Chu, D. T. W., Cooper, C. S., Rosen, T. & Pernet, A. G. (1989). Mechanism of inhibition of DNA gyrase by quinolone antibacterials: a cooperative drug-DNA binding model. Biochemistry, 28, 3886-3894. Snyder, M. & Drlica, K. (1979). DNA gyrase on the bacterial chromosome: DNA cleavage induced by oxolinic acid. J. Mol. Biol. 131, 287-302. Sugino, A., Peebles, C. L., Kruezer, K. N. & Cozzarelli, N. R. (1977). Mechanism of action of nalidixic acid: puri®cation of Escherichia coli nalA gene product and its relationship to DNA gyrase and a novel

Gyrase-quinolone-DNA Complexes Block Replication nicking-closing enzyme. Proc. Natl Acad. Sci. USA, 74, 4767-4771. Tabor, S., Huber, H. E. & Richardson, C. C. (1987). Escherichia coli thioredoxin confers processivity on the DNA polymerase activity of the gene-5 protein of bacteriophage T7. J. Biol. Chem. 262, 16212-16223. Wigley, D. B. (1995). Structure and mechanism of DNA gyrase. In Nucleic Acids and Molecular Biology (Eckstein, F. & Lilley, D. M. J., eds), vol. 9, pp. 165176, Springer-Verlag, Berlin, Heidelberg. Wigley, D. B., Davies, G. J., Dodson, E. J., Maxwell, A. & Dodson, G. (1991). Crystal structure of an N-terminal fragment of the DNA gyrase B protein. Nature, 351, 624-629. Willmott, C. J. R. (1993). The interaction of quinolone antibacterials with DNA gyrase. PhD thesis, University of Leicester. Willmott, C. J. R. & Maxwell, A. (1993). A single point mutation in the DNA gyrase A protein greatly reduces the binding of ¯uoroquinolones to the gyrase-DNA complex. Antimicrob. Agents Chemother. 37, 126-127. Willmott, C. J. R., Critchlow, S. E., Eperon, I. C. & Maxwell, A. (1994). The complex of DNA gyrase and quinolone drugs with DNA forms a barrier to

791 transcription by RNA polymerase. J. Mol. Biol. 242, 351-363. Wolfson, J. S. & Hooper, D. C. (1985). The ¯uoroquinolones: structures, mechanisms of action and resistance, and spectra of activity in vitro. Antimicrob. Agents Chemother. 28, 581-586. Yamagishi, J., Yoshida, H., Yamyoshi, M. & Nakamura, S. (1986). Nalidixic acid-resistant mutations of the gyrB gene of Escherichia coli. Mol. Gen. Genet. 204, 367-373. Yoshida, H., Kojima, T., Yamagishi, J. & Nakamura, S. (1988). Quinolone-resistant mutations of the gyrA gene of Escherichia coli. Mol. Gen. Genet. 211, 1-7. Yoshida, H., Bogaki, M., Nakamura, M. & Nakamura, S. (1990). Quinolone resistance-determining region in the DNA gyrase gyrA gene of Escherichia coli. Antimicrob. Agents Chemother. 34, 1271-1272. Yoshida, H., Bogaki, M., Nakamura, M., Yamanaka, L. M. & Nakmura, S. (1991). Quinolone resistancedetermining region in the DNA gyrase gyrB gene of Escherichia coli. Antimicrob. Agents Chemother. 35, 1647-1650. Yoshida, H., Nakamura, M., Bogaki, M., Ito, H., Kojima, T., Hattori, H. & Nakamura, S. (1993). Mechanism of action of quinolones against Escherichia coli DNA gyrase. Antimicrob. Agents Chemother. 37, 839-845.

Edited by J. Karn (Received 20 July 2000; received in revised form 25 October 2000; accepted 27 October 2000)