The Coprinopsis cinerea septin Cc.Cdc3 is involved in stipe cell elongation

Fungal Genetics and Biology 58–59 (2013) 80–90

Contents lists available at ScienceDirect

Fungal Genetics and Biology journal homepage: www.elsevier.com/locate/yfgbi

Regular Articles

The Coprinopsis cinerea septin Cc.Cdc3 is involved in stipe cell elongation Tatsuhiro Shioya a, Hiroe Nakamura a, Noriyoshi Ishii a, Naoki Takahashi a, Yuichi Sakamoto b, Noriaki Ozaki a, Masayuki Kobayashi a, Keiju Okano a, Takashi Kamada c, Hajime Muraguchi a,⇑ a

Department of Biotechnology, Faculty of Bioresource Sciences, Akita Prefectural University, Akita 010-0195, Japan Iwate Biotechnology Research Center, Kitakami, Iwate 024-0003, Japan c Graduate School of Natural Science and Technology, Okayama University, Okayama 700-8530, Japan b

a r t i c l e

i n f o

Article history: Received 4 May 2013 Accepted 13 August 2013 Available online 20 August 2013 Keywords: Coprinopsis cinerea Fruiting Stipe Cell elongation Septin Cdc3

a b s t r a c t We have identified and characterized a Coprinopsis cinerea mutant defective in stipe elongation during fruiting body development. In the wild-type, stipe cells elongate at the maturation stage of fruiting, resulting in very slender cells. In the mutant, the stipe cells fail to elongate, but become rather globular at the maturation stage. We found that the mutant phenotype is rescued by a gene encoding a homolog of Saccharomyces cerevisiae CDC3 septin, Cc.Cdc3. The C. cinerea genome includes 6 septin genes, 5 of which, including Cc.cdc3, are highly transcribed during stipe elongation in the wild type. In the mutant, the level of Cc.cdc3 transcription in the stipe cells remains the same as that in the mycelium, and the level of Cc.cdc10 transcription is approximately 100 times lower than that in the wild-type stipe cells. No increase in transcription of Cc.cdc3 in the mutant may be due to the fact that the Cc.cdc3 gene has a 4-base pair insertion in its promoter and/or that the promoter region is methylated in the mutant. Overexpressed EGFP-Cc.Cdc3 fusion protein rescues the stipe elongation in the transformants, localizes to the cell cortex and assembles into abundant thin filaments in the elongating stipe cells. In contrast, in vegetative hyphae, EGFP-Cc.Cdc3 is localized to the hyphal tips of the apical cells of hyphae. Cellular defects in the mutant, combined with the localization of EGFP-Cc.Cdc3, suggest that septin filaments in the cell cortex provide the localized rigidity to the plasma membrane and allow cells to elongate cylindrically. Ó 2013 Elsevier Inc. All rights reserved.

1. Introduction The basidiomycete Coprinopsis cinerea forms a highly differentiated structure, the fruiting body (Muraguchi and Kamada; 1998; Kües, 2000). Fig. 1 is a schematic diagram illustrating fruiting in C. cinerea. Fruiting body formation begins with the aggregation of hyphae, producing hyphal knots of approximately 0.2 mm or less in diameter. In the hyphal knots, cells divide rapidly and differentiate into a compact core composed of highly branched short cells and a layer of veil cells covering the core (van der Valk and Marchant, 1978). Following differentiation of the primordial shaft, the rudimentary pileus (cap) differentiates at the upper region of the primordial shaft, forming a tiny fruiting body primordium (Muraguchi and Kamada, 1998). The stipe tissue differentiates at the central region encompassed by the rudimentary gill. The primordium gradually enlarges and matures under proper light conditions, such as a 12 h light/12 h dark cycle (Kamada et al., 1978; Terashima et al., 2005). The maturation stage is triggered by light ⇑ Corresponding author. Address: Department of Biotechnology, Faculty of Bioresource Sciences, Akita Prefectural University, Shimoshinjo-nakano, Akita 010-0195, Japan. Fax: +81 18 872 1676. E-mail address: [email protected] (H. Muraguchi). 1087-1845/$ - see front matter Ó 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.fgb.2013.08.007

(0 h in Fig. 1), and stipe elongation starts around the end of the light period in the final day (Kamada, 1994). During stipe elongation, stipe cells elongate without cell division and with nuclear division, becoming multinucleate (Gooday, 1985; Stephenson and Gooday, 1984). The pileus expands to disperse basidiospores near the end of stipe elongation. Pileus expansion and spore dispersion are associated with fruiting body autolysis (Muraguchi et al., 2008), which characterizes the ephemeral life of the Coprinopsis genus. In fruiting, two types of cell expansion occur: a slow process, which is often encountered in primordia, and a more rapid one involved specifically in stipe elongation (Reijnders and Moore, 1985). Stipe elongation is almost entirely due to elongation of the stipe cells, which elongate from approximately 0.1 mm to 1 mm during the final phase of fruiting, providing a good opportunity to study cell expansion that is characterized by diffuse extension growth (Kamada and Takemaru, 1977; Kamada, 1994; Gooday, 1985). Diffuse extension growth, unlike tip growth in vegetative hyphae, occurs throughout the cell surface; the helical or transverse arrangement of chitin microfibrils or glucosaminoglycan chains in the cell wall contributes to the process (Gooday, 1979; Kamada et al., 1991; Mol et al., 1990). Such microfibril arrangement was observed in an initial stage of fruiting body development, i.e., in

T. Shioya et al. / Fungal Genetics and Biology 58–59 (2013) 80–90

81

Fig. 1. Schematic diagram of C. cinerea fruiting. Tissue differentiation occurs in hyphal knots to produce fruiting-body primordia, which enlarge up to approximately 1 cm in height. The maturation stage of fruiting is triggered by light a day before the final day of fruiting. The 12 h light/12 h dark cycle is indicated by open and filled boxes, respectively, under the diagram. The time from the trigger light is shown in hr under the light regime, as previously described (Kamada et al., 1978).

hyphal knots of 0.1–0.2 mm in diameter (Kamada and Tsuru, 1993). Models have been proposed for the ontogeny and construction of the helical wall structure (Kamada et al., 1991). However, little is known about the molecular mechanisms underlying diffuse extension growth. We have isolated elongationless mutants, which fail to elongate the stipe during the maturation stage of fruiting. Genetic analysis of the mutants identified at least eight genes, eln1 to eln8, involved in stipe elongation. Of the eight genes, eln2 and eln3 were cloned and found to encode a cytochrome P450 and a putative glycosyltransferase, respectively (Muraguchi and Kamada, 2000; Arima et al., 2004). In this study, we investigated the elongationless mutant Uad435, which was induced in a homokaryotic fruiting strain, CopD5-12 (Muraguchi et al., 1999). In this report, we show that the gene responsible for the elongationless phenotype in Uad435 encodes a septin protein similar to the Saccharomyces cerevisiae CDC3, designated Cc.cdc3. Subcellular localization of Cc.Cdc3 was examined in stipe, veil, and vegetative hyphal cells using EGFPtagged Cc.Cdc3. The results suggest that cortical septin filaments provide the localized rigidity to the plasma membrane of stipe cells and allow stipe cells to elongate cylindrically. 2. Materials and methods

B1 trp1-1,1-6 eln8-1) was selected as the recipient strain. Tester strain D365 (Amut Bmut pab1-1 eln8-1) was selected among F1 progeny derived from a cross between Uad435 and #326 (Amut Bmut pab1-1). Protoplasts of strain B87 were obtained from oidia and transformed with BAC DNAs or DNA fragments using a PEG-Ca2+ method as described previously (Binninger et al., 1987; Muraguchi et al., 2005). Trp+ transformants were crossed with tester strain D365 in MYG slant medium to observe the fruiting phenotype. BAC DNA of s14B9 was digested partially with HindIII and fractionated with CHEF electrophoresis. The gel portion containing fragments greater than 40 kb was excised and subjected to electroelution as described (Muraguchi et al., 2005). The recovered fragments were self-ligated and transformed into competent DH10B cells to construct a sub-library. DNA was extracted from subclones of s14B9 and examined for rescuing ability. Transformation experiments using subclones derived from s14B9 and endsequencing of the subclones with the rescuing activity narrowed the active region to about 15 kb in the C. cinerea genome browser (http://genome.semo.edu/cgi-bin/gbrowse/cc/). Within the 15-kb region was the septin-coding region (Fig. S2). A septin gene containing approximately 1 kb of the 50 - and 30 -flanking regions was PCR-amplified, used for co-transformation with pCc1003 (Binninger et al., 1987), and found to carry the rescuing activity.

2.1. Strains, culture conditions and genetic techniques The strains of C. cinerea used in this study are listed in Table 1. Strain Uad435 carries the eln8-1 recessive mutation, which was induced by UV-mutagenesis of homokaryotic fruiting strain CopD512 (Muraguchi et al., 1999). An eln8-1 homozygous strain, B87+D365, was used to observe the mutant phenotype. Malt extract–yeast extract–glucose (MYG) medium (Rao and Niederpruem, 1969) solidified with 1.5% (w/v) agar was used for all experiments. MYG slant medium in test tubes was used to observe fruiting phenotypes. To obtain F1 progeny, basidiospore germlings were isolated at random using a chisel-shaped needle under a dissecting microscope (Miles et al., 1966). The mycelium was cultured on CY-1 medium (Kamada and Takemaru, 1977) at 28 °C to observe hyphal cells. 2.2. Transformation experiments To obtain a recipient strain for transformation experiments, the original mutant strain Uad435 (A12 B12 eln8-1) was crossed with #292 (A3 B1 trp1-1,1-6). Among the F1 progeny, strain B87 (A12

2.3. Phylogenetic analysis Amino-acid sequences of fungal septins were first aligned using ClustalW (http://www.genome.jp/tools/clustalw/). Next, the aligned sequences were used to generate a phylogenetic tree by executing a command: rooted phylogenetic tree with branch length (UPGMA) in the ClustalW site. To distinguish used aminoacid sequences of septins from filamentous fungi, assigned numbers of the sequences and the number of amino acids were indicated in Fig. 3.

2.4. Expression analysis Total RNA was extracted from the mycelium, fruit-body primordium, cap, and elongating stipe using RNAiso solution (TaKaRa Bio) and then used for northern blot analysis, quantitative real-time PCR, and super-SAGE. Fruit-body primordia were harvested at 0– 12 h in Fig. 1. The stipe and cap tissues were harvested from the fruit bodies at around 35 h in Fig. 1.

82

T. Shioya et al. / Fungal Genetics and Biology 58–59 (2013) 80–90

Table 1 Coprinopsis cinerea strains used in this study. Strain

Genotype/description

Source/Reference

5026+5132 Okayama-7 CopD5-12 Uad435 326 292 B87 D365 N#2 N#17

A2B2 ade8-1+A7B7 ade8-2 A2B2 ade8-1/a progeny of 5026+5132 A12B12/homokaryotic fruiting A12B12 eln8-1/homokaryotic fruiting AmutBmut pab1-1/homokaryotic fruiting A3B1 trp1-1, 1-6 A12B1 eln8-1 trp1-1, 1-6/a progeny of Uad435292 AmutBmut eln8-1 pab1-1/a progeny of Uad435326, homokaryotic fruiting A12B1 eln8-1 trp1-1, 1-6 EGFP-Cc.cdc3+trp1+ A12B1 eln8-1 trp1-1, 1-6 EGFP-Cc.cdc3+trp1+

Kamada and Takemaru (1977) P.J. Pukkila Muraguchi et al. (1999) Muraguchi et al. (1999) P.J. Pukkila P.J. Pukkila This study This study This study This study

Table 2 Primers used in this study. Primer

Sequence 50 ? 30

Cc.cdc3-For Cc.cdc3-Rev Cc.cdc3-(2)For Cc.cdc3-(1)For Cc.cdc3-(200)For Cc.cdc3-1For Cc.cdc3-1ForATG Cc.cdc3-1Rev Cc.cdc3-1Rev2 Cc.cdc3-1Rev3 Cc.cdc3-2For Cc.cdc3-2Rev Cc.cdc3-3For EcoRI-Cc.cdc3-For NGFP-Cc.cdc3-2Rev NGFP-Cc.cdc3-3For NGFP-Cc.cdc3-4Rev NGFP-Cc.cdc3-5For NGFP-Cc.cdc3-6Rev qPCR-Cc.cdc3-For qPCR-Cc.cdc3-Rev qPCR-Cc.cdc10-For qPCR-Cc.cdc10-Rev qPCR-Cc.cdc12-For qPCR-Cc.cdc12-Rev qPCR-Cc.cdc11a-For qPCR-Cc.cdc11a-Rev qPCR-Cc.cdc11b-For qPCR-Cc.cdc11b-Rev

TCTAAAGGCCTCCAAGTC AAAGCCTGCATGTCAGTC GAATGTCAACGAGGACGCGC CTCAGTCTCAGCCAGAGGCG GAAGACAGTCGCTACTGCTG GTTTGGAGACTGGATTGC ATGGCAGAGTCTTTCACGTC TTGTGGTGGGCAATATCC TCACAAGGGTAGACTTGC GATTGCGTTGTTGGCACTAGAGAC TATCGAGTTTATGCGCAG AAGACTAGGCAGGTAGAG AGGAGGCTCGAGACTGGA GCGCGAATTCTCGCAACGATCAACTACC CTCGCCCTTGCTCACCATCTGGCCGAAACGGAGTGT ACACTCCGTTTCGGCCAGATGGTGAGCAAGGGCGAG CGTGAAAGACTCTGCCATCTTGTACAGCTCGTCCAT ATGGACGAGCTGTACAAGATGGCAGAGTCTTTCACG GCGCCTGCAGCAGTCATCGTGCTCGTCGTC GAGGAACTCCGAGAGTACAC GCTGGAACACCATCTTCATC CGATGAGGATGAAGAGGAGG CTCATAGTGGATCTGAGCGG GAGGAGGAGGAAGCACTCAG GGAAACCGACTTGAAGGCTG CGCTTCTCAAAGCGTTCGCCTC CAATCTCGGAATTCGCCTTGAG CGAGGATCTCGCCAGCCAGAGC AGTAGCTGGTGTTGGAGTCCTG

For northern blot analysis, approximately 15 lg of total RNA was fractionated by electrophoresis in a 1.2% agarose formaldehyde gel, transferred to a Hybond-N+ membrane (Amersham) according to Sambrook and Russell (2001), and fixed using a UV crosslinker. The Cc.cdc3 coding region was PCR-amplified using primer sets Cc.cdc3-1For-1Rev and 2For-2Rev, labeled using the Gene Image system (Amersham), and used as a probe.cDNA for quantitative real-time PCR was synthesized from total RNA with the ReverTra Ace qPCR RT Kit (Toyobo). Gene expression was quantified with a CFX96 (Bio-Rad). The primers for the five septin genes are listed in Table 2. The primers were designed to distinguish amplification of the cDNA from that of the genomic DNA, which contains an intron. For amplification, the QuantiTect SYBR Green PCR Kit (Qiagen) was used according to the manufacturer’s instructions. The expression of septin genes was determined by means of the comparative DDCt method. A serial dilution of cloned cDNA was amplified under the same conditions to determine the concentrations of reference (b-tubulin) and target cDNA in the samples. The copy number was calculated as follows: 6.02  1023 (copies/mol)  DNA amount (g)/[DNA length (bp)  660 (g/mol)]. RNA-Seq was conducted by the DOE Joint Genome Institute (JGI). Total RNA was isolated in biological duplicate at 13 points

during the fruiting of strain #326. Strand-specific RNA-Seq was performed with an Illumina sequencer in JGI. Data from forward reads was normalized for gene length and total counts in each sample. SuperSAGE was performed in Iwate Biotechnology Research Center as described (Matsumura et al., 2003). 2.5. DNA sequencing Genomic DNA was extracted using a previously described method (Zolan and Pukkila, 1986). DNA fragments were amplified from the Cc.cdc3 gene region by two sets of primers (Table 2) using iProof DNA polymerase (BioRad), subjected to agarose gel electrophoresis, purified from agarose gels with a GENECLAEN II Kit (Bio101), and used as templates for cycle sequencing reactions with BigDye Terminator v3.1 (Applied Biosystems). The promoter region of Cc.cdc3 was amplified by primers (1)For and 1Rev3 using iProof (Bio-Rad). The purified fragment was amplified by AmpliTaq Gold (Applied Biosystems), cloned into pGEM-T Easy (Promega), and sequenced using primer Cc.cdc3-1Rev3. Sequencing was performed by the Biotechnology Center in Akita Prefectural University. To synthesize a cDNA pool, a BD SMART RACE cDNA Amplification Kit (BD Biosciences) was used. The cDNA pool was used as a template to amplify the cDNA of Cc.cdc3 and other septin genes. 2.6. Construction of strains expressing EGFP-tagged Cc.Cdc3 All DNA manipulations were carried out according to Sambrook and Russell (2001) using Escherichia coli strain DH10B as a host. The oligonucleotide primers are listed in Table 2. To construct EGFP-Cc.cdc3, the Cc.cdc3 native promoter was amplified using primers EcoRI-Cc.cdc3-For and NGFP-Cc.cdc3-2Rev to have an EcoRI site at the 50 end and a region with homology to the N terminus of EGFP at the 30 end. The EGFP fragment was amplified using primers NGFP-Cc.cdc3-3For and NGFP-Cc.cdc3-4Rev to have overlapping regions at both ends. The fragment containing the Cc.cdc3 coding region and the native terminator was amplified using primers NGFP-Cc.cdc3-5For and Cc.cdc3-2Rev to have a region with homology to the C terminus of EGFP at the 50 end. The amplified fragments were fused by a sewing PCR, digested with EcoRI and SacI, and inserted into pBluescript SKII. The SacI fragment containing the Cc.cdc3 terminator was inserted into the resulting construct, yielding pBlue-EGFP-Cc.cdc3. Protoplasts of strain B87 were transformed with a mixture of pCc1003 (trp1+) and pBlue-EGFP-Cc.cdc3. Trp+ transformants were crossed with tester strain D365 in MYG slant media to fruit. Transformants showing stipe elongation in dikaryotic fruiting were selected as strains expressing functional EGFP-Cc.cdc3. 2.7. Microscopy To image stipe cells and veil cells, small amounts of tissue were removed from fruit-bodies, placed in Petri dishes, and dissected in

T. Shioya et al. / Fungal Genetics and Biology 58–59 (2013) 80–90

distilled water with needles under a stereoscopic microscope to obtain small pieces of the tissues. The small pieces were placed on a slide glass and mounted with a coverslip. To image growing vegetative hyphae, a small piece of mycelium was inoculated into 400 ll of CY-1 medium, placed on a coverslip (24  55 mm; Matsunami Glass Ind., Ltd., Japan), and cultured at 28 °C for 1 or 2 days under humid conditions in Petri dishes. The coverslip was set on the slide glass for microscopy as described (Tanabe and Kamada, 1996). Bright field and fluorescence images were captured with a BX51 fluorescence microscope (Olympus, Tokyo) equipped with a DP70 digital camera. Confocal laser scanning microscopy and Z-stack slicing was performed using a Nikon A1 system.

2.8. Yeast two-hybrid assay Yeast two-hybrid analyses were conducted using the Matchmaker Gold Yeast Two-hybrid System (Clontech Laboratories, Inc.). Strain Y2HGold was transformed with pGBKT7 (marked with TRP1) into which the cDNA of Cc.cdc3 or other septins was inserted in frame to produce full-length proteins. Strain Y187 was transformed with pGADT7 AD (marked with LEU2) into which the cDNA of Cc.cdc3 or other septins was also inserted in frame. Expression of DBD and AD fusion proteins was confirmed by western blotting using anti-c-Myc antibody and anti-HA antibody, respectively. The transformants expressing the fusion proteins were mated with each other to examine interactions between Cc.septins. Cloned

83

cDNA was also used as standard templates for quantitative realtime PCR. 3. Results 3.1. The eln8-1 mutant phenotypes We mutagenized a homokaryotic fruiting strain, CopD5-12, with UV-irradiation and screened for developmental mutants (Muraguchi et al., 1999). Strain Uad435 exhibited the elongationless phenotype: the stipe fails to elongate at the maturation stage of fruiting (Fig. 2A and B). Genetic analysis of Uad435 indicated that the mutant phenotype was caused by a single recessive mutation, which was mapped to chromosome I and designated eln8-1. Cellular defects were observed in a dikaryotic strain homozygous for eln8-1. The mutant stipe cells fails to elongate and become thicker than the wild-type stipe cells (Fig. 2C andD). Cellular defects of the eln8-1 mutant are observed not only in stipe cells but also in veil cells. The veil tissue covers the surface of the pileus and comprises strings of cylindrical veil cells (Fig. 2E). In the mutant, veil cells are globular or lemon-shaped (Fig. 2F). These cellular phenotypes suggest that eln8 products function like hoops of a barrel or like a corset to make cells cylindrical. 3.2. The Cc.cdc3 septin gene rescued the eln8-1 mutation To identify the wild-type eln8 gene by complementation, we used a bacterial artificial chromosome (BAC) library constructed

Fig. 2. The eln8-1 mutant phenotypes. (A) A wild-type fruiting body of dikaryotic strain 5026+5132. (B) An eln8-1 mutant fruiting body strain B87+D365. This dikaryotic strain is homozygous for eln8-1. The fruiting bodies in A and B were cultivated in test tubes 18 mm in diameter. (C) Wild-type stipe cells in strain 5026+5132. (D) eln8-1 mutant stipe cells in strain B87+D365. (E) Wild-type veil cells in strain 5026+5132. (F) eln8-1 mutant veil cells in strain B87+D365. Scale bars in C–F represent 50 lm.

84

T. Shioya et al. / Fungal Genetics and Biology 58–59 (2013) 80–90

using genomic DNAs of the Okayama-7 strain and the pBACTZ vector carrying the C. cinerea trp1 gene as a selectable marker for transformation (Muraguchi et al., 2005; Stajich et al., 2010). Since the eln8 locus mapped near his5 on chromosome I by linkage analysis using auxotrophic markers and restriction fragment length polymorphism (RFLP) markers (Muraguchi et al., 1999), we examined BAC clones that mapped near his5 for rescuing the eln8-1 recessive mutation. We found that BAC DNA from clones s2F7 and s14B9 rescued the mutant phenotype (Fig. S1A). A subclone #6, which was derived from s14B9, carried a 15-kb interval overlapped with s2F7, and had the rescuing activity (Fig. S2). We identified in the 15-kb interval a gene encoding a septin protein homologous to S. cerevisiae CDC3. The 3-kb genomic fragment containing the septin gene was PCR-amplified and its rescuing activity was examined by co-transformation with the trp1 marker gene. Of 20 trp+ transformants, 13 transformants produced fruiting bodies with elongated stipes, indicating that the septin protein, Cc.Cdc3, can rescue the eln8-1 mutation. These transformation experiments suggested that Cc.Cdc3 plays an important role in stipe cell elongation, although we could not rule out the possibility that eln8 encodes a protein other than Cc.Cdc3 (see below). Cc.Cdc3 possesses domains typical of Cdc3 septins: a phosphoinositide binding motif, a GTP-binding domain, a septin-unique element, and a C-terminal extension containing a predicted coiled coil (Pan et al., 2007), but not an N-terminal region known to be modified by SUMO in S. cerevisiae CDC3 (Johnson and Blobel, 1999). The absence of an N-terminal region with SUMO sites is common in Cdc3-like septins in other filamentous fungi (Hernández-Rodríguez and Momany, 2012). The annotation of the C. cinerea genome sequence identified six septin genes: Cc.cdc3 (CC1G_10270), Cc.cdc10 (CC1G_12292), Cc.cdc12 (CC1G_02638), two Cc.cdc11 (Cc.cdc11a: CC1G_03701 and Cc.cdc11b: CC1G_03218), and Cc.aspE (CC1G_04978). Fig. 3 shows a phylogenetic analysis of septins in C. cinerea, S. cerevisiae, Schyzosaccharomyces pombe, Aspergillus nidulans, Neurospora crassa, Ashbya gossypii, Cryptococcus neoformans and Ustilago maydis. In C. cinerea, two paralogs of Cdc11 exist. Expression analysis suggested that these two Cdc11 septins play different roles (see below). 3.3. Cc.cdc3 is highly expressed in wild-type stipe cells To examine whether Cc.cdc3 gene transcription is developmentally regulated, we first performed northern blot analysis using total RNA extracted from dikaryotic vegetative hyphae, the wild-type fruiting primordium, the wild-type pileus (cap), and wild-type and mutant stipes at the maturation stage of fruiting (Fig. 4A). In the wild-type strain, the expression of Cc.cdc3 was increased in elongating stipe cells compared with that in the mycelium. In mutant stipe cells, the expression of Cc.cdc3 was similar to that in the mycelium. These results suggest that a high level of Cc.cdc3 transcription is required for normal stipe cell elongation and that a mutation might affect the level of Cc.cdc3 transcription. To examine whether the septin genes were up-regulated during stipe elongation, we performed quantitative real-time PCR using cDNAs synthesized from the vegetative mycelium, fruiting body primordia, the cap, elongating wild-type stipes, and mutant stipes. Fig. 4B shows the transcript levels of five septin genes, presented as ratios relative to the level of Cc.cdc3 in the wild-type vegetative mycelium. In the wild-type, the Cc.cdc3 transcript level in elongating stipe cells was twofold higher than that in the vegetative mycelium, consistent with the results of northern blot analysis (Fig. 4A) and SuperSAGE (data not shown). In the eln8-1 mutant, the Cc.cdc3 transcript level in stipe cells did not increase; it remained the same as that in the wild-type mycelium, consistent with the results of northern blot analysis. In fruiting body tissues, Cc.cdc12 was highly transcribed. While the transcript level of Cc.cdc10 was up-regu-

Fig. 3. A phylogenetic tree using six septins in C. cinerea and septins from S. cerevisiae, S. pombe, A. nidulans, N. crassa, A. grosypii, C. albicans, C. neoformans, and U. maydis. Assigned numbers of the sequences are indicated in parenthesis, and the number of amino acids of each protein used is indicated on the right.

lated in elongating wild-type stipe cells, Cc.cdc10 transcript level in mutant stipe cells was approximately 100-fold lower than that in the wild-type stipe cells. The cause of reduced expression of Cc.cdc10 will be discussed below. The two Cc.cdc11 genes were differently expressed in fruiting body tissues. While the expression of

T. Shioya et al. / Fungal Genetics and Biology 58–59 (2013) 80–90

85

Fig. 4. Expression analyses of septin genes. (A) Northern blot analysis of Cc.cdc3. Total RNA was extracted from the mycelium (My), fruiting body primordia (Pri), the cap (Cap), and the elongating stipe (Sti) of the wild-type strain 5026+5132 and from stipes in the eln8-1 homozygous strain B87+D365. Total RNA was separated by gel electrophoresis, blotted, and probed with random priming-labeled Cc.cdc3 genomic DNA. (B) Quantitative real-time PCR analysis of five septin genes, Cc.cdc3, Cc.cdc10, Cc.cdc11a, Cc.cdc11b and Cc.cdc12, in wild-type fruiting and eln8-1 mutant stipe. Independent three experiments were performed and the representative data were presented. Each reaction was done in duplicate, bars indicate mean values, and error bars indicate standard deviations. Expression was normalized to that of the b-tubulin gene. The transcript levels were compared with that of Cc.cdc3 in the vegetative mycelium. (C) The relative expression of 6 septin genes, Cc.cdc3, Cc.cdc10, Cc.cdc11a, Cc.cdc11b, Cc.cdc12 and Cc.AspE, and b-tubulin, by RNA-seq. Total RNA was isolated in biological duplicate at 13 points during the fruiting of strain #326. Data from forward reads were normalized for gene length and total counts in each sample, and used to generate the graph, in which ratios to expression of Cc.cdc3 in mycelium are indicated. Bars indicate mean values, and error bars indicate standard deviations. The sampling times with tissue names are shown in hr from the time when the trigger light was applied, as shown in Fig. 1. (D) Quantitative real-time PCR analysis of five septin genes, Cc.cdc3, Cc.cdc10, Cc.cdc11a, Cc.cdc11b and Cc.cdc12 in the eln8-1 mutant stipe and the stipe rescued by EGFP-Cc.Cdc3. Independent two experiments were performed and the representative data were presented. Each reaction was done in duplicate, bars indicate mean values, and error bars indicate standard deviations. Expression was normalized to that of the b-tubulin gene. The transcript levels were indicated as ratio to expression of Cc.cdc3 in the eln8-1 mutant stipe.

Cc.cdc11a was constant in all samples, Cc.cdc11b was up-regulated in wild-type and mutant elongating stipe cells (Fig. 4B and D). RNA-Seq analysis of homokaryotic fruiting strain #326 also indicated that five septin genes, other than Cc.cdc11a, were highly expressed during stipe elongation (Fig. 4C). Up-regulation of five septin genes, Cc.cdc3, Cc.cdc10, Cc.cdc11b, Cc.cdc12 and Cc.aspE in the wild-type elongating stipe cells suggests that these septins play an important role for diffuse extension growth in inflating cells during stipe elongation. 3.4. The Cc.cdc3 gene in the eln8-1 mutant To clarify the molecular lesions in the eln8-1 mutant, we compared the genomic DNA and cDNA sequences of the Cc.cdc3 gene in the wild-type monokaryotic fruiting strain CopD5-12 and the

mutant strain Uad435. Comparison of the Cc.cdc3 cDNA sequences indicated that the mutant strain produced the wild-type Cc.Cdc3 protein. Direct sequencing of amplified fragments from the promoter regions revealed two 4-bp insertions 75-bp upstream of the first adenine of the coding region in the Uad435 mutant strain. Sequencing of the cloned fragments identified the 4-bp insertions as -ACAT- and -ATGT-, respectively (Fig. 5A). Interestingly, these 4-bp sequences are complementary. During PCR amplification of genomic DNA fragments from the Cc.cdc3 promoter region, we noticed that some of the primers hardly amplified the corresponding fragments from the eln8-1 mutant compared with the wild type. We reasoned that DNA-methylation/modification might disturb annealing of these primers. To explore DNA-methylation in the Cc.cdc3 gene region, we performed Southern blot analysis using restriction enzymes sensitive to DNA

86

T. Shioya et al. / Fungal Genetics and Biology 58–59 (2013) 80–90

digestion, suggesting inhibition of cleavage by methylation at the restriction site and the emergence of a new cleavage site in the promoter region. While the new recognition sites of HhaI and MboI in the eln8-1 genomic sequence were not detected, the primers (1)For and 1Rev2, and the other primers designed to anneal to the Cc.cdc3 promoter region could not amplify the corresponding region from the eln8-1 genomic DNA to the same extent as the wild-type genome. The highly modified sequences in the mutant might be cleaved by these restriction enzymes. On the basis of the results, we concluded that DNA-methylation and/or another modification occurred in a far-reaching region of the Cc.cdc3 gene, and disturbed the increase in the transcription of Cc.cdc3 required for stipe cell elongation. 3.5. Subcellular localization of Cc.Cdc3

Fig. 5. DNA-modification of the Cc.cdc3 region in the eln8-1 mutant. (A) Comparison of the nucleotide sequences in the promoter regions of the wild-type strain CopD512 (CopD5) and the eln8-1 mutant strain Uad435. The diagrams show that two types of 4-bp insertion were present in Uad435. Their sequences were determined by sequencing the DNA cloned from the PCR-amplified fragments. (B) Southern blot analysis using restriction enzymes sensitive to DNA-methylation. Genomic DNA from the wild-type strains, Okayama-7 (Ok7) and CopD5-12 (CopD5) and the eln8-1 mutant strain Uad435 was digested with SalI, HhaI, and MboI, blotted onto nylon membranes, and hybridized with probe A and probe B, whose positions are indicated in panel C. (C) The genomic region of Cc.cdc3. Solid boxes and an arrow indicate exons of Cc.cdc3 and the direction of transcription, respectively. An arrow head indicates the position of the 4-bp insertions found in the mutant, whose sequences are indicated in panel A. The restriction sites of the enzymes used in panel B are indicated by the vertical lines. The asterisk indicates a SalI site that was methylated and not cleaved by SalI in the mutant Uad435. Underlines indicate fragments in which a new site cleaved by HhaI and MboI emerged.

methylation. While HindIII digestion showed the same hybridization pattern in the wild-type and the mutant (data not shown), SalI digestion indicated that the probe hybridized to a larger fragment in the mutant strain than in the wild-type strains (Fig. 5B). Sequencing of the corresponding region revealed no alteration in sequence,suggesting that a SalI site was methylated (Fig. 5C, the methylated site is shown by an asterisk). Next, we used the restriction enzymes HhaI and MboI for Southern blot analysis. The hybridization patterns in the HhaI and MboI digests indicated altered

In the eln8-1 mutant, stipe cells fail to elongate and instead inflate (Fig. 2D). In addition, veil cells were globular in the mutant (Fig. 2F). The fact that these cellular phenotypes of the mutant could be rescued by Cc.cdc3 suggests that Cc.Cdc3 plays a role in making stipe and veil cells cylindrical. To visualize Cc.Cdc3 in cells, we fused enhanced green fluorescent protein (EGFP) to the N terminus of Cc.Cdc3. We obtained transformed strains showing rescued stipes in dikaryotic fruiting. Although the stipe lengths in the transformants varied with strain (data not shown), the maximum length of the rescued stipes was 7.0 cm, which was indistinguishable from the length of the wild-type stipes (Fig. S1C). Southern analysis of the transformants using Cc.cdc3 as a probe indicated that multiple copies of the EGFP-Cc.cdc3 construct were inserted into the genome, suggesting that the stipe length was dependent on EGFP-Cc.cdc3 copy number. Since strain N#2 exhibited the longest stipe in dikaryotic fruiting, it was selected for further analysis. Because Southern analysis suggested overexpression of EGFPCc.cdc3, we examined the extent of the overexpression by real-time qPCR. In the rescued stipe cells of N#2+D365, mRNA level of Cc.cdc3 including EGFP-Cc.cdc3 was approximately 5 times compared with the mutant stipe cells in B87+D365 (Fig. 4D). The qPCR analysis revealed that in the rescued stipe cells level of Cc.cdc10 transcription was not restored by EGFP-Cc.Cdc3 despite complete rescue of stipe elongation, suggesting that the decrease in Cc.cdc10 expression in the eln8-1 mutant does not result from low level of Cc.Cdc3. Subcellular localization of EGFP-Cc.Cdc3 shown below should be interpreted with these septin expressions in mind, and will be discussed below. To examine the subcellular localization of EGFP-Cc.Cdc3, we observed stipe cells of the dikaryotic strain N#2+D365. Before stipe elongation, stipe cells contained large vesicles (Fig. 6A, upper panel), and the EGFP signal was observed as patches (Fig. 6A, lower panel). In the elongating stipe, various stages of cell elongation were observed, and the EGFP signal was more frequently observed in the cell cortex as abundant thin filaments oriented along the longitudinal axis of stipe cells (Fig. 6B, D–H, Movie S1). Abundant thin filaments were also observed in relatively long veil cells that were located at the margin of the cap (Fig. 6I). In some stipe cells, in addition to the thin filaments, disks or rings were observed, which were approximately 1.26 lm in diameter (Fig. 6D). In some of the elongating stipe cells, we often observed a node from which cortical septin filaments gush out (Fig. 6F–H). After stipe elongation, the EGFP signal dispersed to the cytoplasm (Fig. 6C) and had disappeared at approximately 6 h after stipe elongation. Thus, the EGFP signal suggested that the shape and localization of the septin complexes containing EGFP-Cc.Cdc3 change dynamically during stipe cell elongation. Since expression analyses of the septin genes indicated that the Cc.cdc3 gene is expressed in vegetative hyphae (Fig. 4), we

T. Shioya et al. / Fungal Genetics and Biology 58–59 (2013) 80–90

87

Fig. 6. Subcellular localization of overexpressed EGFP-Cc.Cdc3 in stipe cells. Stipe cells of the fruiting body in strain N#2+D365 were observed before, during, and after stipe elongation. (A) Stipe cells before stipe elongation. Large vesicles were observed in the stipe cells. The fluorescence image shows patches of EGFP-Cc.Cdc3 signal in the stipe cells. (B) Stipe cells during stipe elongation. The fluorescence image shows abundant thin filaments of EGFP-Cc.Cdc3 signal in the elongating stipe cells. (C) Stipe cells after stipe elongation. The fluorescence image shows EGFP-Cc.Cdc3 signal dispersed into the cytoplasm. (D) An enlarged view of a part of panel B. Rings and disks are discernible with filaments. (E) Stipe cells of the fruiting body in strain N#2+D365 were observed with confocal fluorescent microscopy and Z-stacks were obtained. Sections were constructed to show the cortical localization of Cc.Cdc3 in stipe cells. (F and G) Cortical septin filaments in elongating stipe cells in two continuous Z-stack sections were shown. A node from which septin filaments gush out is discernible in panel G. These two Z-stacks were part of Movie S1. (H) Septin pellets from which septin filaments gush out are observed with abundant septin filaments in the cortex of stipe cells. (I) Veil cells. Thin filaments are discernible. Scale bars represent 20 lm in A–C, 10 lm in E–I, and 5 lm in D.

observed vegetative hyphal cells expressing EGFP-Cc.Cdc3. The EGFP signal was observed mostly in the cytoplasm of the apical cells. As shown in Fig. 7A–D, three types of specialized structures were discernible: one or two tip-associated patches (Fig. 7A and B), pellets in the cytoplasm between the tip and the nucleus (Fig. 7A and B), and sticks associated with the tip or away from the tip (Fig. 7C and D). The EGFP signal was occasionally observed in the septa (Fig. 7E). When a hypha branched, a tip-associated signal emerged at the tip of the branching hypha. Thus, a variety of septin structures were observed via the EGFP signal, suggesting that the Cc.Cdc3 protein plays roles in a variety of processes in cell morphogenesis in C. cinerea. 3.6. Cc.Cdc3 interacts with Cc.Cdc10, Cc.Cdc12 and itself Septins can assemble into heterooligomeric septin complexes (Bertin et al., 2008; Sirajuddin et al., 2007). The presence of six septin genes in the C. cinerea genome suggested that Cc.Cdc3 assembled into septin complexes and functioned together with other septins. We searched for interactions among the five septins in C. cinerea using a yeast two-hybrid assay (Fig. 8). The assay indicated that Cc.Cdc3 strongly interacted with Cc.Cdc10 and Cc.Cdc12 and weakly with itself. Cc.Cdc12 also interacted strongly with itself. The yeast two-hybrid system used did not detect Cc.Cdc11b interactions. Since Cc.cdc11b is highly expressed in elongating stipe cells (Fig. 4), Cc.Cdc11b likely play a role in stipe cell elongation. Incorporation of Cc.Cdc11b into the septin complex might require mod-

ification of Cc.Cdc11b, by phosphorylation or acetylation, for example (Mitchell et al., 2011; Hernández-Rodríguez and Momany, 2012). The results suggested that Cc.Cdc3 forms complexes with Cc.Cdc10 and Cc.Cdc12, and with itself. 4. Discussion We investigated an elongationless mutant, Uad435, of C. cinerea and found that a septin similar to the S. cerevisiae CDC3, Cc.Cdc3 could rescue the mutant phenotype. In this study, the subcellular localization of Cc.Cdc3 suggested versatile roles for septins in cellular morphogenesis, diffuse extension growth, tip growth, and septation. To understand pattern formation of fruiting body in basidiomycetes at molecular levels, determining the functions of septin in cell morphogenesis is essential, because septins play an important role in the expansion of some types of cells that constitute the fruiting body. 4.1. Subcellular localization of Cc.Cdc3 Since EGFP-Cc.Cdc3 was overexpressed as shown by Southern and qPCR analyses, its localization may not be the same as that of innate Cc.Cdc3. However, the stipe of transformants showed normal stipe elongation. In elongating stipe cells and veil cells of the transformant, abundant thin filaments of EGFP-Cc.Cdc3 were located over the whole cell cortex, and oriented along the longitudinal axis. Septin filaments or bars parallel to the direction of cell

88

T. Shioya et al. / Fungal Genetics and Biology 58–59 (2013) 80–90

Fig. 8. Yeast two-hybrid assay of C. cinerea septins. Strain Y2HGold was transformed with constructs encoding five full-length septins fused to the DNA binding domain (BD) of GAL4. Strain Y187 was transformed with constructs encoding five full-length septins fused to the activation domain (AD) of GAL4. The transformed strains were mated with each other. The resulting diploids were selected on SD/ Trp/Leu medium, then spotted onto SD/Trp/Leu/+a-X-Gal and SD/Trp/ Leu/Ade/His to assess the activation of the MEL1 reporter or the ADE2 and HIS3 reporters.

Fig. 7. Subcellular localization of overexpressed EGFP-Cc.Cdc3 in vegetative hyphae. Dikaryotic strain N#2+D365 was cultured in CY-1 agar medium on a coverslip at 28 °C. (A) Tip-associated structures that divide into two patches and pellets in the cytoplasm. (B) A tip-associated structure in the dome-shaped region and small pellets in the cytoplasm. In this image, two nuclei are discernible as two dark spots on the right. (C) A stick-like structure in the cytoplasm. (D) A stick-like structure emanating from the tip associated structure. (E) Septum-associated signals in a clamp connection. Scale bars represent 10 lm.

growth have been observed in growing cells of various fungi (Gladfelter, 2010). In S. cerevisiae cells undergoing polarized morphogenesis in response to mating pheromone (shmooing), septins typically appear either as a fuzzy band (Kim et al., 1991; Ford and Pringle, 1991) or as a set of bars parallel to the projection axis (Longtine et al., 1998). Similar septin bars were observed in vegetative cells lacking Gin4p, Nap1p, or Cla4p (Longtine et al., 1998, 2000). When a hyphal germ tube of C. albicans evaginates from a mother yeast cell, the septin patch that remains at the germ-tube neck forms a band of longitudinal septin bars (Sudbery, 2001; Warenda and Konopka, 2002). In Ashbya gossypii hyphal cells, septins initially assemble into a loose, elongated band of filaments at the growing tips of hyphae (Helfer and Gladfelter, 2006; DeMay et al., 2009). In A. nidulans, septins have been implicated in normal development and limiting the emergence of new growth foci are important (Lindsey et al., 2010). Thus, septin filaments and bars have been observed in many fungal cells. Although we observed septin structures via overexpressed EGFP-Cc.Cdc3 and did not observe septin structures in the mutant stipe cells, cortical septin filaments in rescued elongating stipe cells might play an important role for elongation of stipe cells.

Before stipe elongation, stipe cells contain abundant large vesicles, which putatively carry cell wall components and enzymes to synthesize the cell wall during stipe cell elongation. These vesicles fuse to the plasma membrane of stipe cells, and the cell wall is constructed during stipe cell elongation. In S. cerevisiae, septin localization has been implicated in chitin deposition, which was observed as a broad and somewhat fuzzy band at the bases of shmoo projections (Schekman and Brawley, 1979; Kim et al., 1991; Konopka et al., 1995). The normal localization of chitin synthase III activity is achieved by assembly of a complex in which Chs3p links to the septins via Chs4 and Bni4p (DeMarini et al., 1997). The septum-like structures made by the septin mutant cdc3 at various sites on the cell cortex at a nonpermissive temperature suggested that septins, the contractile ring, and the chitin synthase II system constitute a relatively autonomous entity for the process of septation (Roh et al., 2002). These findings in S. cerevisiae suggest that septins are involved in proper chitin deposition in the cell wall. The eln8-1 mutation affects the shape of veil cells, causing the lemon shape. It is worth mentioning that, in U. maydis, similar morphologial defects in cell shape were observed in deletion mutants of septin genes (Alvarez-Tabarés and Pérez-Martín, 2010). In stipe cells of C. cinerea, chitin microfibrils have been observed in shallow helical arragement or transverse orientation to the longitudinal cell axis. A model for diffuse extension growth has been proposed in which new chitin microfibrils intercalate into preexistent microfibrils (Kamada et al., 1991). In the model, the septin filaments observed in the cell cortex might provide the rigidity to localized areas of the plasma membrane. Since mutant stipe and veil cells become inflated, exocytosis would occur independently of the proper septin filaments. The plasma membrane with the localized and anisotropic rigidity might function like hoops of a barrel or like a corset. In this situation, exocytosis should occur to allow new chitin microfibrils to intercalate into preexisting ones, resulting in diffuse extension growth to make cells cylindrical. On the basis of the model, further experiments will be required to know what determines the orientation of the cortical septin filaments in stipe cells and how the septin filaments provide the anisotropic rigidity to the localized areas and allow new chitin microfibrils to intercalate into preexisting ones. As seen in vegetative hyphae and in stipe cells using EGFPCc.Cdc3, the septin bars and rings in cytoplasm, as well as cortical septin structures, have been observed in some types of cells in fil-

T. Shioya et al. / Fungal Genetics and Biology 58–59 (2013) 80–90

amentous fungi and animals (Lindsey et al., 2010; Hernández-Rodríguez et al., 2012; Kinoshita et al., 2002). The cytoplasmic septin bars or rings would play a role different from cortical septin structures. The excess septins might be sequestered from the cell cortex and form bars or rings in the cytoplasm. 4.2. DNA methylation and/or modification in the Cc.cdc3 gene region The original mutant Uad435 harbors a subtle mutation, two different 4-bp insertions, in the promoter region of Cc.cdc3. Although molecular mechanism causing the 4-bp insertion at the exact same position is not clear at present, the presence of two different sequences at the exact same position suggests duplication of the sequences in the genome. When a genomic region was being replicated, accident caused by UV-irradiation might occur to result in duplication of the replicated region in the genome. The duplication in the genome might cause methylation to the genomic region containing Cc.cdc3. Southern blot analysis, using restriction enzymes sensitive to methylation, and sequencing suggested that DNA methylation and/or modification occur in the promoter region of Cc.cdc3 in the mutant strain. In the C. cinerea genome, a large number of genes encode DNA-modifying enzymes (Iyer et al., 2009); de novo methylation of repeated sequences occurs and heritability of methylated sequences has been reported (Freedman and Pukkila, 1993). It is possible that duplication in a genomic region causes DNA modification. The 4-bp insertion occurred 75 bp upstream of the start codon of Cc.Cdc3. PCR amplification experiments suggest that highly modification of DNA occurs in the Cc.cdc3 promoter region. The highly modified DNA might be susceptible to digestion of the restriction enzymes, HhaI and MboI. This region would be required for high level expression of Cc.cdc3 during the maturation stage and might receive the signal to trigger stipe elongation. Further experiments will be required to investigate the Cc.cdc3 promoter for upregulation of Cc.cdc3 in wild-type stipe elongation. 4.3. Relationship among Coprinopsis septins Expression analysis of the septin genes in the eln8-1 mutant stipe revealed that Cc.cdc3 expression did not increase and Cc.cdc10 expression decreased approximately 100 times lower than that in the wild-type elongating stipe cells. The low levels of Cc.Cdc10 in mutant stipe cells might impede septin filament assembly. In the stipe cells rescued by overexpression of EGFP-Cc.cdc3, Cc.cdc10 expression was not restored by EGFP-Cc.Cdc3, suggesting that the cause of decrease in Cc.cdc10 expression is not due to no increase in Cc.cdc3 expression. As discussed above, if DNA-methylation and/or another modification occur in a far-reaching region of the 4-bp insertion, expression of many genes might be affected by such modification. A gene controlling Cc.cdc10 expression might be included in such affected genes. Further experiments will be required to identify the gene controlling Cc.cdc10 expression. Overexpression of EGFP-Cc.cdc3 rescued the eln8-1 mutant phenotype, albeit low level of Cc.cdc10 expression. It is known in S. cerevisieae that, when cdc10 was deleted, Cdc3 interacts with itself to form septin filaments (McMurray et al., 2011). In the resuced stipe cells, overexpressed EGFP-Cc.Cdc3 could compensate for decreased amount of Cc.Cdc10 to form septin filaments. This idea could be supported by the results of yeast two-hybrid assay, in which Cc.Cdc3 can interact with not only Cc.Cdc10 and Cc.Cdc12, but also itself. Expression analysis also revealed that, while the expression of Cc.cdc11a was constantly low, the expression of Cc.cdc11b increased in elongating stipe cells, suggesting that Cc.Cdc11b septin plays an important role in stipe cell elongation. In the stipe tissue, there are not only inflating cells, but also narrow hyphae (Hammad

89

et al., 1993). Since Cc.cdc11a is still expressed but not upregulated during stipe elongation, Cc.Cdc11a might play a role different from the other septins or function in cells that do not display diffuse extension growth, such as narrow hyphae in the stipe. Phylogenetic analysis showed that, instead of the Shs1 ortholog, two paralogs of Cdc11 exist in C. cinerea. It is interesting to consider that relationship between Cc.Cdc11a and Cc.Cdc11b corresponds to that between Cdc11 and Shs1 in S. cerevisiae, because Shs1 is most closely related to Cdc11 and can substitute for it in septin heterooctamers (Garcia et al., 2011). No interaction of Cc.Cdc11b with other septins was detected in the yeast two-hybrid assay. It is possible that modifications of Cc.Cdc11b, such as phosphorylation, sumoylation and acethylation, are required for Cc.Cdc11b to interact with other septins. A large number of regulatory factors involved in septin dynamics have been investigated in yeast, other filamentous fungi and mammals (Park and Bi, 2007; McMurray and Thorner, 2009; Kinoshita et al., 2002; Wightman et al., 2004; DeMay et al., 2009; Dobbelaere et al., 2003). Orthologous proteins in C. cinerea could be involved in the regulation of septin dynamics. Further studies investigating such regulatory factors as well as posttranslational modidiations are required to understand the relationship between septin dynamics and cell morphogenesis in C. cinerea. Acknowledgments We thank Y. Imai for confocal scanning microscopy and P.J. Pukkila for RNA-Seq analysis provided through JGI’s Community Sequencing Program ‘‘Functional genomics in the model mushroom Coprinopsis cinerea.’’ Support for sequencing was provided by the Biotechnology Center, Akita Prefectural University. This work was supported in part by a fund from the Ministry of Agriculture, Forestry and Fisheries of Japan (23053). Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.fgb.2013.08.007. References Alvarez-Tabarés, I., Pérez-Martín, J., 2010. Septins from the phytopathogenic fungus Ustilago maydis are required for proper morphogenesis but dispensable for virulence. PloS One 5, e12933. Arima, T., Yamamoto, M., Hirata, A., Kawano, S., Kamada, T., 2004. The eln3 gene involved in fruiting body morphogenesis of Coprinus cinereus encodes a putative membrane protein with a general glycosyltransferase domain. Fungal Genet. Biol. 41, 805–812. Bertin, A., McMurray, M.A., Grob, P., Park, S., Garcia III, G., Patanwala, I., Ng, H., Thorner, J., Nagales, E., 2008. Saccharomyces cerevisiae septins: supramolecular organization of heterooligomers and the mechanism of filament assembly. Proc. Natl. Acad. Sci. USA 105, 8274–8279. Binninger, D.M., Skrzynia, C., Pukkila, P.J., Casselton, L.A., 1987. DNA-mediated transformation of the basidiomycete Coprinus cinereus. EMBO J. 6, 835–840. DeMarini, D.J., Adams, A.E.M., Fares, H., Virgilio, C.D., Valle, G., Chuang, J.S., Pringle, J.R., 1997. A septin-based hierarchy of proteins required for localized deposition of chitin in the Saccharomyces cerevisiae cell wall. J. Cell Biol. 139, 75–93. DeMay, B.S., Meseroll, R.A., Occhipinti, P., Gladfelter, A.S., 2009. Regulation of distinct septin rings in a single cell by Elm1p and Gin4p kinases. Mol. Biol. Cell 20, 2311–2326. Dobbelaere, J., Gentry, M.S., Hallberg, R.L., Barral, Y., 2003. Phosphorylationdependent regulation of septin dynamics during the cell cycle. Dev. Cell 4, 345–357. Ford, S.K., Pringle, J.R., 1991. Cellular morphogenesis in the Saccharomyces cerevisiae cell cycle: localization of the CDC11 gene product and the timing of events at the budding site. Dev. Genet. 12, 281–292. Freedman, T., Pukkila, P.J., 1993. De novo methylation of repeated sequences in Coprinus cinereus. Genetics 135, 357–366. Garcia III, G., Bertin, A., Li, Z., Song, Y., McMurray, M.A., Thorner, J., Nogales, E., 2011. Subunit-dependent modulation of septin assembly: budding yeast septin Shs1 promotes ring and gause formation. J. Cell Biol. 195, 993–1004. Gladfelter, A.S., 2010. Guides to the final frontier of the cytoskeleton: septins in filamentous fungi. Curr. Opin. Microbiol. 13, 720–726.

90

T. Shioya et al. / Fungal Genetics and Biology 58–59 (2013) 80–90

Gooday, G.W., 1979. Chitin synthesis and differentiation in Coprinus cinereus. In: Burnett, J.H., Trinci, A.P.J. (Eds.), Fungal Walls and Hyphal Growth. Cambridge University Press, Cambridge, UK, pp. 203–223. Gooday, G.W., 1985. Elongation of the stipe of Coprinus cinereus. In: Moore, D., Casselton, L.A., Wood, D.A., Frankland, J.C. (Eds.), Developmental Biology of Higher Fungi. Cambridge University Press, Cambridge, UK, pp. 311–331. Hammad, F., Watling, R., Moore, D., 1993. Cell population dynamics in Coprinus cinrerus: narrow and inflated hyphae in the basidiome stipe. Mycol. Res. 97, 275–282. Helfer, H., Gladfelter, A.S., 2006. AgSwe1p regulates mitosis in response to morphogenesis and nutrients in multinucleated Ashbya gossypii cells. Mol. Biol. Cell 17, 4494–4512. Hernández-Rodríguez, Y., Hastings, S., Momany, M., 2012. The septin AspB in Aspergillus nidulans forms bars and filaments and plays roles in growth emergence and conidiation. Eukaryot. Cell 11, 311–323. Hernández-Rodríguez, Y., Momany, M., 2012. Posttranslational modifications and assembly of septin heteropolymers and higher-order structures. Curr. Opin. Microbiol. 15, 660–668. Iyer, L.M., Tahiliani, M., Rao, A., Aravind, L., 2009. Prediction of novel families of enzymes involved in oxidative and other complex modifications of bases in nucleic acids. Cell Cycle 8, 1698–1710. Johnson, E.S., Blobel, G., 1999. Cell cycle-regulated attachment of the ubiquitinrelated protein SUMO to the yeast septins. J. Cell Biol. 147, 981–993. Kamada, T., 1994. Stipe elongation in fruit bodies. In: Esser, K., Lemke, P.A. (Eds.), The Mycota I. Springer-Verlag, Berlin, pp. 367–379. Kamada, T., Kurita, R., Takemaru, T., 1978. Effects of light on basidiocarp maturation in Coprinus macrorhizus. Plant Cell Physiol. 19, 263–275. Kamada, T., Takemaru, T., 1977. Stipe elongation during basidiocarp maturation in Coprinus macrorhizus: mechanical properties of stipe cell wall. Plant Cell Physiol. 18, 831–840. Kamada, T., Takemaru, T., Prosser, J.I., Gooday, G.W., 1991. Right- and left-handed helicity of chitin microfibrils in stipe cells in Coprinus cinereus. Protoplasma 165, 64–70. Kamada, T., Tsuru, M., 1993. The onset of the helical arrangement of chitin microbibrils in fruit body development of Coprinus cinereus. Mycol. Res. 97, 884–888. Kim, H.B., Haarer, B.K., Pringle, J.R., 1991. Cellular morphogenesis in the Saccharomyces cerevisiae cell cycle: localization of the CDC3 gene product and the timing of events at the budding site. J. Cell Biol. 112, 535–544. Kinoshita, M., Field, C.M., Coughlin, M.L., Straight, A.F., Mitchison, T.J., 2002. Selfand actin-templated assembly of mammalian septins. Dev. Cell 3, 791–802. Konopka, J.B., Demattei, C., Davis, C., 1995. AFR1 promotes polarized apical morphogenesis in Saccharomyces cerevisiae. Mol. Cell Biol. 15, 723–730. Kües, U., 2000. Life history and developmental processes in the basidiomycete Coprinus cinereus. Microbiol. Mol. Biol. Rev. 64, 316–353. Lindsey, R., Cowden, S., Hernández-Rodríguez, Y., Momany, M., 2010. Septins AspA and AspC are important for normal development and limit the emergence of new growth foci in the multicellular fungus Aspergillus nidulans. Eukaryot. Cell 9, 155–163. Longtine, M.S., Fares, H., Pringle, J.R., 1998. Role of the yeast Gin4p protein kinase in septin assembly and the relationship between septin assembly and septin function. J. Cell Biol. 143, 719–736. Longtine, M.S., Theesfeld, C.L., McMillan, J.N., Weaver, E., Pringle, J.R., Lew, D.J., 2000. Septin-dependent assembly of a cell cycle-regulatory module in Saccharomyces cerevisiae. Mol. Cell Biol. 20, 4049–4061. Matsumura, H., Reich, S., Ito, A., Saitoh, H., Kamoun, S., Winter, P., Kahl, G., Reuter, M., Kruger, D.H., Terauchi, R., 2003. Gene expression analysis of plant host– pathogen interactions by SuperSAGE. Proc. Natl. Acad. Sci. USA 100, 15718– 15723. McMurray, M.A., Thorner, J., 2009. Septins: molecular partitioning and the generation of cellular asymmetry. Cell Div. 4, 18. http://dx.doi.org/10.1186/ 1747-1028-4-18. McMurray, M.A., Bertin, A., Garcia III, G., Lam, L., Nogales, E., Thorner, J., 2011. Septin filament formation is essential in budding yeast. Dev. Cell 20, 540–549. Miles, P.G., Takemaru, T., Kimura, K., 1966. Incompatibility factors in the natural population of Schizophyllum commune. I. Analysis of the incompatibility factors present in fruit bodies collected within a small area. Bot. Mag. (Tokyo) 79, 693– 705.

Mitchell, L., Lau, A., Lambert, J.P., Zhou, H., Fong, Y., Couture, J.F., Figeys, D., Baetz, K., 2011. Regulation of septin dynamics by the Saccharomyces cerevisiae lysine acetyltransferase NuA4. PLoS One 6, e25336. Mol, P.C., Vermeulen, C.A., Wessels, J.G.H., 1990. Diffuse extension of hyphae in stipes of Agaricus bisporus may be based on a unique wall structure. Mycol. Res. 94, 480–488. Muraguchi, H., Fujita, T., Kishibe, Y., Konno, K., Ueda, N., Nakahori, K., Yanagi, S.O., Kamada, T., 2008. The exp1 gene essential for pileus expansion and autolysis of the inky cap mushroom Coprinopsis cinerea (Coprinus cinereus) encodes an HMG protein. Fungal Genet. Biol. 45, 890–896. Muraguchi, H., Kamada, T., 1998. The ich1 gene of the mushroom Coprinus cinereus is essential for pileus formation in fruiting. Development 125, 3133–3141. Muraguchi, H., Kamada, T., 2000. A mutation in the eln2 gene encoding a cytochrome P450 of Coprinus cinereus affects mushroom morphogenesis. Fungal Genet. Biol. 29, 49–59. Muraguchi, H., Kamada, T., Yanagi, S.O., 2005. Construction of a BAC library of Coprinus cinereus. Mycoscience 46, 49–53. Muraguchi, H., Takemaru, T., Kamada, T., 1999. Isolation and characterization of developmental variants in fruiting using a homokaryotic fruiting strain of Coprinus cinereus. Mycoscience 40, 227–235. Pan, F., Malmberg, R.L., Momany, M., 2007. Analysis of septins across kingdoms reveals orthology and new motifs. MBC Evol. Biol. 7, 103. Park, H.O., Bi, E., 2007. Central roles of small GTPases in the development of cell polarity in yeast and beyond. Microbiol. Mol. Biol. Rev. 71, 48–96. Rao, P.S., Niederpruem, D.J., 1969. Carbohydrate metabolism during morphogenesis of Coprinus lagopus (sensu Buller). J. Bacteriol. 100, 1222–1228. Reijnders, A.F.M., Moore, D., 1985. Developmental biology of agarics—an overview. In: Moore, D., Casselton, L.A., Wood, D.A., Frankland, J.C. (Eds.), Developmental Biology of Higher Fungi. Cambridge University Press, Cambridge, UK, pp. 581– 595. Roh, D., Bowers, B., Schmidt, M., Cabib, E., 2002. The septation apparatus, an autonomous system in budding yeast. Mol. Biol. Cell 13, 2747–2759. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Schekman, R., Brawley, V., 1979. Localized deposition of chitin on the yeast cell surface in response to mating pheromone. Proc. Natl. Acad. Sci. USA 76, 645– 649. Sirajuddin, M., Farkasovsky, M., Hauer, F., Kühlmann, D., Macara, I., Weyand, M., Stark, H., Wittinghofer, A., 2007. Structural insight into filament formation by mammalian septins. Nature 449, 311–315. Stajich, J.E., Wilke, S.K., Ahren, D., Au, C.H., Birren, B.W., Borodovsky, M., Burns, C., Canback, B., Casselton, L.A., Cheng, C.K., et al., 2010. Insights into evolution of multicellular fungi from the assembled chromosomes of the mushroom Coprinopsis cinerea (Coprinus cinereus). Proc. Natl. Acad. Sci. USA 107, 11889– 11894. Stephenson, N.A., Gooday, G.W., 1984. Nuclear numbers in the stipe cells of Coprinus cinereus. T. Brit. Mycol. Soc. 82, 531–534. Sudbery, P., 2001. The germ tubes of Candida albicans hyphae and pseudohyphae show different patterns of septin ring localization. Mol. Microbiol. 41, 19–31. Tanabe, S., Kamada, T., 1996. Dynamics of the actin cytoskeleton, hyphal tip growth and the movement of the two nuclei in the dikaryon of Coprinus cinereus. Mycoscience 37, 339–344. Terashima, K., Katsuyuki, Y., Muraguchi, H., Akiyama, M., Kamada, T., 2005. The dst1 gene involved in mushroom photomorphogenesis of Coprinus cinereus encodes a putative photoreceptor for blue light. Genetics 171, 101–108. van der Valk, P., Marchant, R., 1978. Hyphal ultrastructure in fruit-body primordia of the basidiomycetes Schizophyllum commune and Coprinus cinereus. Protoplasma 95, 57–72. Warenda, A.J., Konopka, J.B., 2002. Septin function in Candida albicans morphogenesis. Mol. Biol. Cell 13, 2732–2746. Wightman, R., Bates, S., Amornrrattanapan, P., Sudbery, P., 2004. In Candida albicans, the Nim1 kinases Gin4 and Hsl1 negatively regulate pseudohypa formation and Gin4 also controls septin organization. J. Cell Biol. 164, 581–591. Zolan, M.E., Pukkila, P.J., 1986. Inheritance of DNA methylation in Coprinus cinereus. Mol. Cell Biol. 6, 195–200.