The Crystal Structure of the Antibody N10-Staphylococcal Nuclease Complex at 2.9 Å Resolution

J. Mol. Biol. (1995) 253, 559–575

The Crystal Structure of the Antibody N10–Staphylococcal Nuclease Complex at 2.9 Å Resolution Patricia Bossart-Whitaker1, ChiehYing Y. Chang1, Jiri Novotny1 David C. Benjamin2 and Steven Sheriff1* 1

Bristol-Myers Squibb Pharmaceutical Research Institute, P.O. Box 4000 Princeton, NJ 08543-4000 USA 2 Department of Microbiology and The Beirne B. Carter Center for Immunology Research, University of Virginia Health Sciences Center, Charlottesville VA 22908, USA

The three-dimensional structure of the antibody N10 Fab fragment complexed with staphylococcal nuclease (SNase) has been determined to 2.9 Å resolution. Eighteen residues from six complementarity-determining regions (CDR) recognize an epitope of five distinct SNase segments with a total of 17 residues. The overall shape of the antibody–antigen interface is U-shaped rather than the more or less rectangular interface seen in other antibody–protein antigen interfaces. Despite the U-shaped interface, the amount of surface buried in the complex, 828 Å2 for SNase and 793 Å2 for N10, is typical of antibody–protein antigen complexes. Contributing to the shape of the interface is the shortest antibody heavy chain-CDR3 loop reported to date, which probably allows access of bulk solvent in the center of the ‘‘U’’ interface. Another unusual feature of the N10 antibody is the 15 residue antibody light chain-CDR1, a length seen in only three other reported antibodies. Antibody light chain-CDR1 displays a previously unobserved conformation in its distal portion. Finally, although some of the movement observed in the antibody-bound SNase may be due to crystal contacts, it is clear that some side-chain rearrangements are the result of antigen–antibody interaction. 7 1995 Academic Press Limited

*Corresponding author

Keywords: antibodies; antigen; nuclease; antibody–protein complexes; X-ray crystallography

Introduction Antibodies to proteins can play a critical role in protection against infectious organisms and in the induction of auto-immunity. Antibody neutralization of viruses and bacterial endotoxins has been known since the days of Paul Ehrlich. In addition, some auto-antibodies may react with hormone

Present address: P. Bossart-Whitaker, 1738 Saddlewood Dr., Ft. Mill, SC 29715, USA. Abbreviations used: The numbering system of Kabat et al. (1991) is used throughout. SNase, staphylococcal nuclease; CDR, complementarity-determining region; FR, framework region; Fab, antigen-binding fragment; Fv, antibody variable domain dimer; L, antibody light chain; H, antibody heavy chain; S, staphylococcal nuclease chain; VL , light chain variable domain; VH , heavy chain variable domain; CL , light chain constant domain; CH 1, heavy chain constant domain 1; r.m.s., root-mean-square; Ig, immunoglobulin; PCR, polymerase chain reaction. 0022–2836/95/440559–17 $12.00/0

receptors and mimic hormone-induced cellular responses. For example, the anti-receptor auto-antibodies in Grave’s disease mimic the action of thyroid stimulating hormone (TSH) and stimulate the thyroid cells to secrete excessive amounts of thyroxine in vivo and promote the growth of thyroid cells in vitro (reviewed by Adams, 1988). Principles that govern antibodies complexed with proteins are drawn from a growing structural database. Detailed interactions have been reported for several antibody–protein antigen systems: avian lysozymes (Amit et al., 1986; Bhat et al., 1990, 1994; Fischmann et al., 1991; Sheriff et al., 1987b; Padlan et al., 1989; Chitarra et al., 1993; Braden et al., 1994; Chacko et al., 1995), avian influenza A neuraminidase (Colman, 1989; Tulip et al., 1992a,b; Malby et al., 1994), the Escherichia coli phosphocarrier protein (HPr: Prasad et al., 1993), influenza hemagglutinin (Bizebard et al., 1995) and four idiotype–anti-idiotype complexes (Bentley et al., 1990; Ban et al., 1994; Evans et al., 1994; Fields et al., 1995). A detailed description of an antibody–HIV 7 1995 Academic Press Limited

560 reverse transcriptase-DNA complex (Jacobo-Molina et al., 1993) awaits further refinement. Finally, the crystallization of antibody–horse cytochrome c complexes has been reported (Mylvaganam et al., 1991; Jemmerson et al., 1994). In antibody–protein antigen complexes, antibody combining surfaces are less involuted than for antibodies to small molecules (Wilson & Stanfield, 1993, 1994; Webster et al., 1994). While antigen–antibody interfaces exhibit shape complementarity, the packing density at the interface seems to be poorer than observed for the interior of proteins or at the interface between monomers in multimeric proteins including the VH :VL interface (Tulip et al., 1992a; Mariuzza & Poljak, 1993; Lawrence & Colman, 1993). Interaction between antigen and antibody is mediated by hydrogen bonds, hydrophobic interactions, and in some cases, salt-bridges. Isolated water molecules have also been observed at the interface (Davies et al., 1990; Bhat et al., 1994; Malby et al., 1994) and may be involved in maintaining the shape complementarity at the interface and the stability of the complex. The effects of antibody binding on protein antigen structure have been small in the crystal structures; however, long-range conformational effects have been reported (Benjamin et al., 1992; Mayne et al., 1992). The binding of small molecules including peptides to antibodies, suggests that conformational alterations in the antibody can occur. These changes range from side-chain orientation through segmental motion and peptidebackbone rearrangement to reorientation of the VL domain relative to the VH domain (reviewed by Davies & Padlan, 1992; Wilson & Stanfield, 1993, 1994). Whether induced conformational changes occurs in protein antigen or in antibody during complexation requires examination of a variety of protein antigen–antibody systems. A large body of structural and functional information is available for Staphylococcal aureus micrococcal nuclease (SNase; EC 3.1.4.7) including the high resolution crystal structures of: both wild-type (Arnone et al., 1971; Cotton et al., 1979; Loll & Lattman, 1989) and an active site mutant with bound calcium and a substrate analogue (Loll & Lattman, 1990); the wild-type apoenzyme (Hynes & Fox, 1991); an insertion mutant (Keefe et al., 1993), as well as high resolution NMR solution structures of wild-type (Torchia et al., 1989) and an omega (V) loop deletion mutant (Baldisseri et al., 1991). A panel of monoclonal anti-SNase antibodies has been produced and characterized (Smith et al., 1991; Smith & Benjamin, 1991). Furthermore, the coding sequences for SNase (Shortle, 1983) and for the Fab fragment of N10 (S. S. Perdue, E. D. Hershey, D. C. Williams & D.C.B., unpublished results), have been cloned and expressed in bacteria. ˚ resolution In this report, we describe the 2.9 A structure of a complex between SNase and the Fab fragment of the murine monoclonal antibody N10. In this complex, the interface between N10 and SNase is U-shaped, but the amount of surface area

Structure of the N10-Staphylococcal Nuclease Complex

buried is similar to that of other antibody–protein antigen complexes. The unusual shape of the interface appears to be due to a very short (four residues) H-CDR3.

Results and Discussion Overall structure and crystal packing The final model for the complex consists of 565 amino acid residues with an R-value of 0.196 for all ˚ range with r.m.s. deviations data in the 5 to 2.8 A ˚ and for ideal bond lengths and bond angles 0.013 A 2.1°, respectively (see Materials and Methods for details). The mean coordinate error was estimated ˚ . Overall, by the method of Luzzati (1952) at 0.34 A the backbone conformation is well-defined with an ˚ 2. Those residues with the average B-factor of 19 A highest B-factors often adopt unfavorable mainchain torsional angles and generally reside within the more flexible regions of the N10 Fab–SNase complex. The structure of the N10 Fab–SNase complex is shown in Figure 1. The complex is shaped like ˚ in length and 55 A ˚ diameter. a cylinder, 100 A Antibody and SNase lie roughly in the same plane, tilted 15° with respect to the crystallographic a-axis ˚ of space group C2. The antibody binds to a site 24 A distal to and directly opposite the SNase active site. All of the CDR loops of the antibody and some framework residues interact with the epitope on SNase, which consists of five segments. Four of five domains of the N10 Fab–SNase complex, SNase, VL , CL and CH 1, participate in crystal contacts with the largest number from VL to the CL of a neighboring, symmetry-related Fab fragment. Two interesting points emerge from examination of the lattice contacts. First, with one exception SNase contacts only SNase by symmetry and similarly Fab contacts only Fab. Second, the SNase contacts its symmetry mate about a 2-fold axis. The antigen–antibody interface The surface features of the interface between SNase and the N10 antibody are shown in Fig˚ 2 for ures 2 and 3. The buried surface area is 793 A ˚ 2 for SNase, the latter the N10 antibody and 828 A being roughly 12% of the SNase surface (Table 1). Seventeen residues from five segments of SNase contact 18 residues from all six CDR regions and two framework residues (Lys L-49 and Tyr H-27) of the N10 antibody (Tables 1, 2 and 3). L-CDR1, L-CDR3 and H-CDR2 contribute 72% of the N10 antibody contact residues. Ten residues from the light chain and eight residues from the heavy chain make seven hydrogen bonds, two salt-bridges and 102 van der Waals contacts with antigen. Of these, the light chain contributes 51 (48 VDW, one H-bond and two salt-bridges) and the heavy chain contribute 60 contacts (54 VDW and six H-bonds).

Structure of the N10-Staphylococcal Nuclease Complex

561

Figure 1. Stereo diagram of the N10–SNase complex is shown as a ribbon structure. SNase is shown in cyan with the epitope contact residues in red. The N10 antibody heavy chain is in green and the light chain in yellow. For both heavy chain and light chain, the CDR regions are colored silver and the contact residues are in magenta. Figure produced with RIBBONS (Carson, 1991).

The light chain framework residue, Lys L-49, contributes one salt-bridge whereas the heavy chain framework residue, Tyr H-27, contributes two VDW and one H-bond. In addition to these contact residues, 19 residues at the interface are at least partially buried in the complex. The N10 antibody contact residues form a U-shaped (horseshoe) ridge that surrounds a depression with a protrusion in the center (Figure 2). The base of this depression is formed by VDW packing between Tyr L-36, Phe L-98 and Trp H-103, all non-contact residues. The short length of H-CDR3 places this loop in a recessed position and a single residue, Asn H-96, protrudes to contact antigen. Due to the small size of the H-CDR3 loop, the central depression at the interface is accessible to bulk solvent. However, at the current resolution it is unclear whether ordered solvent fills the cavity. The bottom of the U-shaped ridge that represents the contact surface (paratope) of the N10 antibody Table 1. Summary of Fab N10–SNase interface N10

SNase

6 18 57 111

5 17 45 111

8 37 109 793

5 33 118 828

a

A. Contacts Segments (CDRs) Residues Atoms Contacts B. Buried surface b Segments Residues Atoms ˚ 2) Area (A a

Contacts calculated as by Sheriff (1993). Molecular surfaces were calculated with MS (Connolly, 1983) ˚ probe radius and atomic radii from Gelin & using a 1.7 A Karplus (1979). b

is formed primarily by L-CDR3. The arms of the U are formed on one side by L-CDR1 and L-CDR2 and on the other side by H-CDR1 and H-CDR2. The sole H-CDR3 contact residue, Asn H-96, lies just inside the open end of the U, equidistant from the tip of each arm. This sole H-CDR3 contact residue is largely accessible to solvent. Interestingly, the two framework contact residues, Lys L-49 and Tyr H-27, are at the very tips of the U arms. The ‘‘cavity’’ between the arms of the U-shaped epitope and paratope is Y-shaped when viewed from SNase towards N10. The arms of the Y are created by Asn H-96 projecting towards and contacting SNase and are open to bulk solvent. When the cavity was enclosed by covering the opening with a grid of atoms, the enclosed volume ˚ 3, which is the was estimated to be 01650 A equivalent of 055 water molecules. The cavity is ˚ , although as the widest near the antigen at 018 A cavity extends into the VL :VH interface it narrows ˚ . The cavity also narrows as it goes to 09 A ‘‘deeper’’ into the interface (the tail of the Y) to ˚ . The cavity is longest from SNase to the 010 A ˚ , but on both the VH side VL :VH interface at 018 A ˚ of Asn H-96 and in the tail of the Y, it is only 10 A ˚ deep, long. At the cavity’s deepest point it is 024 A measured from the enclosing grid of atoms to Asp S-95. The majority of the light chain interactions are contributed by L-CDR1 and L-CDR3 which interact primarily with helix-1 and the loop between helix-1 and b-strand 4 of SNase. Both salt-bridges (between Glu L-93 and Lys S-70 and between framework residue Lys L-49 and Glu S-135) are exposed to solvent. The H-CDR2 region contributes the majority of the heavy chain contacts with SNase, providing three H-bonds and 42 VDW contacts with

562

Structure of the N10-Staphylococcal Nuclease Complex

(a)

(b) Figure 2. Stereo diagram of the N10 antibody paratope. The VH :VL region of the N10 antibody was rotated relative to Figure 1 to show the antibody combining site surface. (a) Ribbon structure of the VH :VL domain showing the side-chains of the contact residues that comprise the N10 paratope. The heavy chain is colored green, the light chain yellow, CDR regions silver, and contact residues (with side-chains shown) are magenta. Figure produced with RIBBONS (Carson, 1991). (b) Contact molecular surface (cyan dots) of the N10 antibody (blue with contact residues in yellow) calculated by the method of Connolly (1983) and displayed using GRASP (Nicholls et al., 1991). Note the U-shape of the contact surface with the single heavy chain CDR3 contact residue Asn H-96 located just inside the open end of the U.

four of the five segments that comprise the SNase epitope. N10 interacts with an epitope that lies on a relatively flat face of SNase with notable projections formed by five residues (Lys S-70, Lys S-97, His S-124, Lys S-127, and Glu S-135; Figure 3). This face is comprised primarily of the three helices of SNase directly opposite the catalytic site. In fact, 15 of the 17 contact residues in the epitope lie either within these helices or in loops joining the helices to other structural elements of the SNase antigen (Table 2). Nine of the 17 SNase contact residues are part of helices 1 and 3, which form two of the outer edges of the epitope (Figure 3(a)). Three contact residues lie within helix-2, one within a bend connecting helix-1 and b-strand 4 and two lie within a loop connecting b-strand 5 and helix-2 (Table 2). The remaining residue of the epitope is Lys S-9, which lies within the N-terminal b-strand. Four residues

(Val S-99, Glu S-101, Ala S-102, and Leu S-103) lie within the center of this surface of SNase, yet none contact the N10 antibody. These residues lie directly above the deepest part of the depression that forms the N10 antibody combining site. Overall, the interacting surface of SNase also has a rough U shape. However, in this case the open end is narrower. Residues from helix-1 interact primarily with light chain whereas the remainder of the epitope reacts primarily with heavy chain (Table 2). Arg S-105 projects into the interior of the U and toward the N10 antibody where it forms hydrogen bonds with the sole heavy chain CDR3 contact residue, Asn H-96. Therefore, the entire interface is formed by two U-shaped interacting surfaces such that the open end of the interface may permit access of bulk solvent to the cavity between SNase and the N10 antibody.

563

Structure of the N10-Staphylococcal Nuclease Complex

and changed significantly as the refinement proceeded. Overall, the light chain contributes approximately twice the binding energy (−8.8 kcal/mol) compared to the heavy chain (−3.7 kcal/mol), although the H-chain contributes more total contacts (Table 2) and slightly more surface area (Table 3). The most prominent contributions come from the large DGEL of Lys L-49 and Glu L-93. Nevertheless, the calculated DG value of interaction (−12 kcal/mol; calculated KA = 4.4 × 108 ) agrees reasonably well with that estimated experimentally (KA11010: Smith et al., 1991). Some residues stabilize the complex (e.g. Tyr H-27, Ser H-31, Tyr H-51, Ser H-55, Asn H-96, Phe L-30, Lys L-49, and Glu L-97) whereas others destabilize binding (e.g. Tyr L-32 and Asn L-53). On SNase the results suggest that the N10 epitope is dominated by two residues (Lys

Energetics of binding The contribution of individual SNase and N10 antibody residues to binding were quantified by empirical free energy calculations with a Gibbs function including the hydrophobic effect, solventmodified electrostatic interaction, and loss of side-chain conformational entropy upon binding (Novotny et al., 1989, 1990; Novotny, 1991; Tulip et al., 1994). Given the approximate nature of the calculations only a relative energetics ranking of residues is presented in Figure 4(a) and (b). The binding calculations were repeated several times in the course of the crystallographic refinement; little change was observed in the calculated hydrophobic and conformational entropy terms; however, the electrostatic binding term was sensitive to small rearrangements of charged atoms

(a)

(b) Figure 3. Stereo diagram of the SNase epitope. The SNase molecule was rotated relative to Figure 1 to show the epitope surface. (a) Ribbon structure of SNase (cyan) showing the contact residues (red) with side-chains. Figure produced with RIBBONS (Carson, 1991). (b) Contact molecular surface (cyan dots) of the SNase molecule (blue with contact residues in yellow) calculated by the method of Connolly (1983) and displayed using GRASP (Nicholls et al., 1991). Note the rough U-shape of the contact surface with Arg S-105 and Gln S-106 protruding into the central region of the U where Arg S-105 interacts with the sole heavy chain CDR3 region contact residue Asn H-96.

564

Structure of the N10-Staphylococcal Nuclease Complex

Table 2. Contacts of SNase epitope with N10 antibody paratope residues Contactsa

Molecule SNase Secondary structureb N-Terminus Helix 1

Bend b-Strand 5 b-Turn Helix 2 Helix 3

Residue Lys S-9 Glu S-57 Ala S-60 Phe S-61 Lys S-64 Asn S-68 Lys S-70 Tyr S-93e Asp S-95 Gly S-96 Lys S-97 Met S-98 Arg S-105 Gln S-106 His S-121 His S-124 Lys S-127 Glu S-135

N10 Segment H2 L1 L1, L3 H2 H2 H2, L3 H2 H3 L2 H2 H1, H2 FR-H1, H1 FR-L2

X-ray Residue

VDW

Ser-H-54c, Thr H-56 Ser L-28 Ser L-28, Thr L-27D Phe L-30, Ser L-29 Thr L-27D, Trp L-92 Glu L-93, Trp L-92c Glu L-93d, Ile L-94 Ser H-54 Tyr H-50c, Ile L-94 Thr H-52, Ser H-54 Tyr H-50c, Tyr L-96 Tyr H-53 Asn H-96c Tyr L-50 Tyr H-53 Ser H-31, Tyr H-53 Tyr H-27c, Ser H-31c Lys L-49d

Total

3 3 7 5 17 8 4 5 3 11 2 7 1 1 20 5 102

HB

Minimized SB

1 1 1 1 2

2 7

1 2

VDW 4 1 5 7 17 12 5 1 5 4 9 2 6 7 2 23 6 2 118

HB

SB

1

2 1 1 1 2

2 9

1 2

a Atomic pairwise contacts calculated as for Table 1. X-ray refers to unminimized crystal structure. Minimized refers to structure generated for energetics calculations. VDW, van der Waals contacts; HB, hydrogen bonds; SB, salt-bridges (charged interactions). b SNase segments are as defined by Hynes & Fox (1991). c Denotes hydrogen bond. d Denotes salt-bridge. e Contact residue for minimized structure only.

S-70 and Glu S-135). These two residues would therefore constitute the ‘‘energetic’’ or ‘‘functional’’ epitope as defined by Novotny et al. (1989) and Jin et al. (1992). The N10 antibody N10 is a murine IgG (g1, k) monoclonal antibody. An insertion of four residues, 27A to 27D (Kabat et al. (1991) numbering), occurs in the first light chain hypervariable region, L-CDR1. Similarly an insertion of one residue, 35A, occurs in H-CDR1 while two residues, typically present in other antibodies, are missing in H-CDR3. No insertions or deletions are found in L-CDR2, L-CDR3 or H-CDR2. As described below, H-CDR3 is the shortest hypervariable loop seen to date while L-CDR1 adopts a unique conformation. The pseudo-dyad axes of rotation that relates VL :VH and CL :CH 1 involves rotations of 175° and 173°, respectively. The elbow bend angle inter-relating the two pseudodyad axes is 137°, a value at the lower end of the 127° to 225° range reported for other antibodies (Wilson & Stanfield, 1994). The structures of H-CDR1 and H-CDR2 are very similar to the canonical classes 1' and 1, respectively (Chothia et al., 1989). The four residue H-CDR3 is shown in Figure 5. This simple loop conformation is maintained by a surface salt-bridge between Arg H-94 and Asp H-98, as seen in other antibody structures (Chothia & Lesk, 1987), resulting in the side-chain of the H-CDR3 residue Asp H-98 pointing away from the antigen–antibody interface.

The remaining residues of H-CDR3, Gly H-95, Asn H-96 and Gly H-97, form an extended conformation with the side-chain of Asn H-96 pointing into the interface where it forms several contacts with Arg S-105 of SNase. Thus, the N10 and HyHEL-10 (Padlan et al., 1989) H-CDR3s have only a single contact residue, which contrasts with other antibodies that rely heavily on H-CDR3 for binding. Comparisons of known mouse and human antibody sequences show highly conserved arginine residues at position H-94 and aspartic acid residues at either H-98 or H-101 in the H-CDR3 loop (Kabat et al., 1991). Furthermore, examination of the structures of a number of antibodies (McPC603, KOL, J539, D1.3, and NEW) show conserved salt-bridges between these two residues, suggesting that they play a role in maintaining the H-CDR3 loop tertiary structure. Indeed, Novotny et al. (1990) suggested a role for Arg H-94 in antibody specificity. For the light chain, the structure of L-CDR2 agrees well with all other predicted and observed structures (Chothia & Lesk, 1987), while that of L-CDR3 is most closely related to the third canonical structure for which the anti-lysozyme antibody HyHEL-5 is the prototype (Chothia et al., 1989). Only L-CDR1 is structurally distinct. Other than N10, three other Fabs have been reported with an L-CDR1 of the same length: 15 residues by Kabat’s system (Kabat et al., 1991) and 11 residues by Chothia’s system (Chothia et al., 1989). These Fabs are 50.1 (PDB numbers 1GGB and 1GGI) and 59.1 (1ACY), both anti-HIV gp120 antibodies, and

565

Structure of the N10-Staphylococcal Nuclease Complex

40-50 (1IBG), an anti-digoxin antibody (Rini et al., 1993; Ghiara et al., 1994; Jeffrey et al., 1995; Bernstein et al., 1977). All four Fabs (N10, 50.1, 59.1, 40-50) have conserved residues in the canonical structure determinants (positions 2(Ile), 25(Ala), 27B(Val), 33(Ile, Val, Met) and 71(Phe); Figure 6). However, comparison of the loop structures of these four antibodies (five structures) shows that the distal portion (residues 27D, 28 and 29) of the loops do not all have the same conformation and the Ca deviation ˚ for the 11 residues of L1 ranges from 1.9 to 2.6 A (Figure 7) as compared to a Ca deviation for 78 ˚ . The two 50.1 framework residues of 0.60 to 0.68 A structures strongly resemble one another and 40–50 is reasonably similar to 50.1. However, N10 and 59.1 adopt conformations that are different and unique. This suggests that these loops are flexible and/or adopt conformations that are determined by their environment, whether that be residues from other CDRs or antigen (Steipe et al., 1992). In the case of

N10, the conformation may be determined by interaction of Phe L-30 with Tyr L-32 and Trp L-92. Alternatively, it is tempting to speculate that the conformation of N10 L-CDR1 is determined by complexation with antigen, because L-27D, L-28 and L-29 are contact residues and the L-CDR1 conformations of the other antibodies would not be sterically possible in the complex with SNase. The total buried surface area at the VH :VL ˚ 2, 567 A ˚ 2 from the light chain and interface is 1121 A 2 ˚ 554 A from the heavy chain, a value at the low end of that reported for other antibodies (1400 to ˚ 2, Davies & Chacko, 1993; 1100 to 1700 A ˚ 2, 1900 A Stanfield et al., 1993). Of the total light chain contribution to the buried VL :VH surface area, the framework regions contribute 70% and the CDR regions 30%. Similarly, the heavy chain contribution is composed of 75% from the framework and 25% from the CDR regions. H-CDR3 contributes but 5% to this interface, much less than for other antibodies.

(a)

(b) Figure 4. Surface representation of the calculated DG residue contribution to binding by the N10 antibody and the SNase antigen residues. See Materials and Methods and Results and Discussion for details of the calculations. A color scale was constructed of the DGresidue values, from blue (−2.0 kcal/mol) to red (+2.0 kcal/mol). Thus, blue colors represent negative (‘‘attractive’’) residue contributions, red colors represent positive (‘‘repulsive’’) contributions. Figure produced with GRASP (Nicholls et al., 1991). (a) N10 antibody paratope with light chain on the left; (b) SNase epitope.

566

Structure of the N10-Staphylococcal Nuclease Complex

Table 3. Buried surface area of SNase epitope and N10 paratope SNase Secondary structurea

N10 Area ˚ 2) (A

Segment

Residues

28 262

FR-L1 CDR L1

Bend b-Strand 4 b-Strand 5

Lys S-9 Pro S-56, Glu S-57, Ala S-60, Phe S-61, Lys S-63, Lys S-64, Met S-65, Asn S-68 Lys S-70 Lys S-71, Glu S-73 Tyr S-93, Ala S-94, Asp S-95

42 12 69

FR L2 CDR L2 CDR L3

b-Turn Helix 2 Bend

Gly S-96, Lys S-97 Met S-98, Arg S-105, Gln S-106 Leu S-108

84 100 14

FR H1 CDR H1 CDR H2

b-Turn Helix 3

Thr S-120 His S-121, Gln S-123, His S-124, Lys S-127, Ser S-128, Gln S-131, Lys S-134, Glu S-135, Leu S-137, Asn S-138

10 173

FR H3 CDR H3

Asp L-1 Ser L-27C, Thr L-27D, Ser L-28, Ser L-29, Phe L-30, Tyr L-32 Lys L-49 Tyr L-50, Asp L-53, Glu L-55, Ser L-56 Trp L-92, Glu L-93, Ile L-94, Pro L-95, Tyr L-96 Asp H-1, Tyr H-27, Ser H-28, Thr H-30 Ser H-31, Asp H-32 Ala H-34, Asn H-35A Tyr H-50, Thr H-52, Tyr H-53, Ser H-54, Thr H-56, Thr H-57, Ser H-58, Pro H-61, Lys H-64 Arg H-94 Gly H-95, Asn H-96

N-Terminus Helix 1

b-Turn Total

Residues

Area ˚ 2) (A 6 159 25 46 150 43 69 251 1 43

32 828

793 ˚ Molecular surfaces were calculated with MS (Connolly, 1983) using a 1.7 A probe radius and atomic radii from Gelin & Karplus (1979). a SNase segments are as defined by Hynes & Fox (1991).

Stanfield et al. (1993) have suggested that the relative size of H-CDR3 may be inversely proportional to the magnitude of VL :VH displacement, i.e. smaller H-CDR3 loops give rise to the largest VL :VH interface realignments upon interaction with antigen. Unfortunately, the structure of uncomplexed N10 has not been determined and it is not yet possible to test this hypothesis directly. Staphylococcal nuclease The SNase structure in the N10–SNase complex was aligned with the native SNase structure (Hynes & Fox, 1991) and with the SNase–inhibitor complex (Loll & Lattman, 1989). The deviation of N10-bound ˚ SNase relative to that of native SNase is 0.7 A ˚ for backbone atoms and 1.7 A for all atoms. The deviation relative to the SNase–inhibitor complex is ˚ for backbone atoms and 1.6 A ˚ for all atoms. 0.8 A The backbone conformations of the three a-helices and the five-strand b-barrel are essentially un-

changed with respect to their gross spatial positions. While no large spatial changes in secondary structure are induced in SNase by N10 antibody binding, in several places the backbone is deformed and differences in the two loops that frame the SNase active site are observed in the N10–SNase complex. One is comprised of residues S-113 to S-119 and the other is the V loop, which includes residues S-43 to S-52 (Leszczynski & Rose, 1986). In the V loop backbone atom positions shift by up to ˚ and in the S-113 to S-119 loop by 3.5 A ˚, 4.3 A including a peptide flip at Tyr S-115. However, the observed changes in these loops may not be the result of antibody binding since: (1) the V loop is highly flexible in solution (Torchia et al., 1989) and different conformations have been seen in various crystal structures (Loll & Lattman, 1989, 1990; Hynes & Fox, 1991; Keefe et al., 1993); (2) several residues within the loop (Glu S-43, Lys S-45, Pro S-47 and Tyr S-115) are involved in lattice contacts;

Figure 5. The N10 antibody heavy chain CDR3 loop. Shown are the four CDR3 residues, Gly H-95, Asn H-96, Gly H-97 and Asp H-98 together with the conserved framework residue Arg H-94. The salt bridge, formed between Arg H-94 and Asp H-98 (or Asp H-101 in other antibodies), is indicated by a broken line. See the text for a discussion of the role of this salt bridge in maintaining the conformation of the heavy chain CDR3 loop structure. Figure produced with MOLSCRIPT (Kraulis, 1991).

567

Structure of the N10-Staphylococcal Nuclease Complex

Figure 6. Sequence comparison of 15 residue (Kabat numbering) L-CDR1s for mouse monoclonal antibodies N10, 40-50, 50.1 and 59.1. Also included for comparison are representative 16 (4-4-20) and 17 (McPC603) residue L-CDR1s. Numbering systems are shown for both Kabat et al. (1991) and Chothia et al. (1989). Canonical determinants are marked with an asterisk above the column.

and (3) several residues in the loop have poorly defined electron density. Nevertheless, given that: (1) the conformations of these two loops in N10-bound nuclease are very different from that of equivalent regions in either form of unbound SNase; and (2) electron density is well-defined for most residues in these loops, it appears that N10-bound SNase assumes unique, previously unobserved, conformations in these regions. Differences in the position of side-chain atoms of residues within the epitope (Figure 8) are also seen. N10-bound SNase differs from both unbound SNase forms at four contact residues (Lys S-64, Lys S-70, Lys S-97, and Arg S-105). Residues S-70 and S-105 have relatively low B-factors in both unbound SNase forms, S-64 has moderate B-factors in the SNase-inhibitor complex and high B-factors in the native, and S-97 has high B-factors in the native and is noted as disordered in the SNase–inhibitor complex. In every instance, the distance between ˚ ) as one equivalent atoms increases (up to 6.5 A progresses out the side-chain (Figure 8). In the N10–SNase complex the electron density of these side-chains is well defined and all four residues form either salt-bridges or hydrogen bonds to

antibody (Table 2). Therefore, it is probable that the movement or localization of these side-chains in N10-bound SNase occurs to optimize binding. Large changes are also seen in other side-chain positions in the N10–SNase complex when compared to either native or SNase–inhibitor complex. Two active site residues, Tyr S-113 and Tyr S-115 assume very different conformations. As mentioned above, the peptide bond of Tyr S-115 is flipped relative to free SNase although its side-chain follows essentially the same path. The Ca atom of Tyr S-113 is displaced relative to native SNase and its side-chain points into the active site assuming a conformation similar to that found in SNase–inhibitor complex yet differing from native SNase by as ˚ . Changes are also observed in much as 12 A positions of atoms of residues not contacted by antibody, not involved in lattice contacts, and not part of either loop discussed above: Asp S-19, Lys S-24, Arg S-35, Gln S-80, Arg S-81, and Glu S-101. While some of these latter side chain alterations may result from crystal packing forces, or alternatively, switching between discrete energy minima of backbone conformations, some of these may be the result of binding by the N10 antibody.

Conclusion The antigen–antibody complex reported here is unique in that: (1) the interface is U-shaped; (2) the H-CDR3 loop is the shortest reported to date, which makes possible access of bulk solvent to the interface; (3) the L-CDR1 loop displays a distal conformation not previously reported either because it is flexible and/or it undergoes movement upon interaction with antigen; (4) both main-chain and side-chain SNase atoms undergo movement relative to their positions in uncomplexed SNase upon interaction with antibody. Figure 7. Stereo diagram of the chain trace of CDR L1 of Fabs N10 (cyan), 40–50 (red), 50.1 (magenta), 59.1 (yellow). In addition, side-chains of N10 residues Phe L-30, Tyr L-32 and Trp L-92 are shown in cyan and canonical base residues (Ile L-2, Ala L-25, Val L-27B, Met L-33 and Phe L-71) are shown in dark blue. Figure produced with MOLSCRIPT (Kraulis, 1991) ‘‘turn’’ command so that tubes run through Ca positions.

Materials and Methods N10 variable light and heavy chain sequences The amino acid sequences of the N10 VH and VL regions were inferred from cDNA sequences. The cDNA was obtained following first-strand synthesis from total

568

Structure of the N10-Staphylococcal Nuclease Complex

Figure 8. The conformation of the backbone and selected side-chains of the SNase molecule from the N10–SNase complex (red) is compared to those for the unbound native SNase (cyan) reported by Hynes & Fox (1991). Note the differences in the side-chains of four residues (Lys S-64, Lys S-70, Lys S-97, and Arg S-105) within the SNase epitope recognized by the N10 antibody, in the backbone of the V-loop and in the Tyr S-113 side-chain. The SNase from the N10–SNase complex is shown in red, whereas the unbound SNase is shown in cyan. Figure produced with RIBBONS (Carson, 1991). cellular RNA with reverse transcriptase and expansion by standard polymerase chain reaction (PCR) methodology. Consensus primers were used for the 5' (amino terminus) regions as follows: H-chain 5' GCCGGTACCCAGCTCCAGCTTCAGGAGTC 3'; L-chain 5' GCCGAATTCGACATTGTGCTGACCCAATCTCCAGCTTC 3'. in conjunction with 3' (antisense) primers complementary to sequences within the CH 1 and CL regions as follows: H-chain 5' GCGTCGACCAGGGGCCAGTGGATAGAC 3'; L-chain 5' GCGAATGCGGATGTTAACTGCTCACTGGATGGTGGG 3'. Three clones from each of three independent PCR reactions were sequenced. No PCR errors were observed, i.e. all clones gave identical sequences. The resulting DNA and inferred amino acid sequences are shown in Figure 9. The sequences have been deposited in GenBank, accession numbers U25121 (N10 VH ) and U25122 (N10 VL ). Protein purification and crystallization Recombinant SNase was used throughout this study. It was produced in E. coli and purified as described (Smith & Benjamin, 1991). Details of the preparation and purification of the Fab fragment of the N10 antibody, as well as that of the crystallization of the complex, have been reported elsewhere (Chang et al., 1994). Briefly, the N10 antibody was purified from ascites fluid by affinity chromatography (Smith et al., 1991) and the Fab fragment isolated following digestion with papain (Porter, 1959). The N10 Fab–SNase complex was prepared by incubating the Fab fragment with a 1.5 molar excess of SNase followed by gel filtration to remove excess SNase. The

purified complex was concentrated, dialyzed against 10 mM imidazole-HCl (pH 7.0) and adjusted to a final concentration of 18 mg/ml. Crystals were grown by vapor diffusion from a reservoir buffer that contained 100 mM Tris-maleic acid (pH 8.5) and 1.2 M sodium citrate (Chang et al., 1994). These crystals diffracted X-rays ˚ and belong to the monoclinic crystal system, to 2.5 A ˚, space group C2. The unit cell parameters are a = 234.7 A ˚ , c = 74.4 A ˚ with b = 106.4°. The unit cell has b = 43.5 A an asymmetric unit that consists of a single complex of relative molecular mass of 67,000, which yields a calculated solvent content of 57% consistent with the range reported for other proteins (Matthews, 1968).

X-ray data collection and processing X-ray diffraction data were collected using a Siemens/ Xentronics multiwire area detector (Durbin et al., 1986). The data collection was carried out at room temperature with CuKa radiation from a Rigaku RU-200 rotatinganode X-ray generator operating at 50 kV, 60 mA and equipped with focusing mirror optics. The crystal-to-detector distance was set to 150 mm with the detector swing angle (2u) set to 14°. Oscillation frames covered 0.15° and were measured for 120 seconds. Data were obtained from a single crystal measured in two separate orientations. Indexing and integration of the diffraction data collected from this crystal was processed by the XENGEN program package (Howard et al., 1987). A total of 32,828 observations were scaled, reduced and merged to produce 11,874 unique reflections with =F = > 2s(F). The ˚ resolution range dataset is 81% complete in the 6 to 2.8 A ˚ shell. The merged and 62% complete in the 3.0 to 2.9 A dataset was retained for the crystallographic structure determination and refinement. The quality of data obtained from the crystal was judged by the R-value on intensity (I) from the replicate reflections, Rmerge . Data collection statistics are presented in Table 4.

Structure of the N10-Staphylococcal Nuclease Complex

Molecular replacement The structure of the complex was determined by the method of molecular replacement using MERLOT (Fitzgerald, 1988), BRUTE (Fujinaga & Read, 1987) and X-PLOR 3.0 (Bru¨nger, 1990). The Fab structure was determined using a multi-domain approach (Cygler & Anderson, 1988a,b). The Fab was divided into Fv, comprised of residues 1 to 106 (VL ) and residues 1 to 116 (VH ); and CL :CH 1, consisting of residues 107 to 212 (CL ) and residues 117 to 218 (CH 1). The Fab search models were placed with the elbow axis parallel to the z-axis, which allows the difference in elbow bend, defined as the

569 angle that relates the VL :VH and CL :CH 1 pseudo-dyad axes, to be observed in the rotation angle g (Cygler & Anderson, 1988a). Fab structures were chosen on the basis of good overall model quality and close sequence homology to N10, and included four VL :VH fragments; HyHEL-5 (IgG1; Sheriff et al., 1987b); D1.3 (IgG1; Fischmann et al., 1991); 36-71 (IgG1; Strong et al., 1991); 40-50 (IgG2b; Jeffrey et al., 1995); and two murine IgGl CL :CH 1 fragments, D1.3 and 17/9 (Rini et al., 1992). The origin of the reference coordinate system was defined as the center of gravity for a previously oriented McPC603 Fab (Sheriff et al., 1990) and the remaining Fab models were superposed onto this model by least-squares

Figure 9. The cDNA sequence of the N10 VH and VL coding sequences are shown together with the amino acid sequence (Kabat numbering) inferred from them. The first 20 nucleotides of the heavy chain cDNA and the first 29 nucleotides of the light chain cDNA were determined by the PCR 5' consensus primers used to clone the cDNA. Thus, the first seven heavy chain amino acids and the first ten light chain amino acids shown above reflect the sequence of the primers and not necessarily the true sequence of the N terminus of the protein. However, the heavy chain sequence shown above for this region is the same as that for the murine H-chain class IA sequence, to which it belongs, except for the first two residues which are Gln-Leu above but Glu-Val in most class IA sequences. Similarly, the light chain sequence shown above is identical to that for the majority of the k chain class III proteins to which it belongs.

570

Structure of the N10-Staphylococcal Nuclease Complex

Table 4. Crystallographic data collection and refinement statistics Space group Cell dimensions Asymmetric unit contents

C2 ˚ b = 43.5A ˚ c = 74.4A ˚ , b = 106.4° a = 234.7 A 1 Fab–nuclease complex

A. Data Collection ˚) Maximum resolution (A Measured observations Unique reflections Completeness (%) Rmergea (%) I/s(I) B. Refinement ˚) Resolution range (A No. of unique reflections (sF > 0) R-valueb (%) Rfreec ˚) r.m.s. D bond length (A r.m.s. D bond angles (°) r.m.s. D dihedrals (°) r.m.s. D improper dihedrals (°) Total no. of amino acid residues No. of atoms (non-hydrogen) ˚ 2) Average B-factor (A ˚ 2) Maximum B-factor (A ˚ 2) Minimum B-factor (A

2.7 32,555 14,626 Overall 81 4.8 37.1

˚ shell 2.89–2.77 A 25 10.3 5.9

5.0–2.8 11,488 19.6 28.4 0.013 2.1 27.0 1.9 565 4390 19 45 2

Rmerge = S=Ii (h) − I(h)=/SIi (h). R-value = S>Fo = − =Fc >/S=Fo =. c Bru¨nger (1992a). a

b

minimization of a-carbons with the program ALIGN written by Gerson Cohen (Satow et al., 1986). The third domain was staphylococcal nuclease, comprised of residues 7 to 138 (Loll & Lattman, 1989; Hynes & Fox, 1991). Both native SNase (Hynes & Fox, 1991) and SNase–inhibitor complex (Loll & Lattmann, 1989) were used as search models. Coordinates for all search models, except Fab 40-50, were obtained from the Protein Data Bank (Bernstein et al., 1977). The fast-rotation function (Crowther, 1972) was used ˚ resolution data and a 23 A ˚ radius of with 10 to 4 A integration. The D1.3 CL :CH 1 domain yielded a single peak with an r.m.s. of 7.1. The orientation was further refined on a fine grid (Lattmann & Love, 1970). This orientation was used to interpret the VL :VH heterodimer domain rotation function results. Two of the four VL :VH search models produced orientations consistent with the D1.3 CL :CH 1 domain results. The Crowther–Blow translation function (Crowther & ˚ resolution data. A Blow, 1967) was used with 10 to 4 A single peak for the D1.3 CL :CH 1 domain of 6.9 r.m.s. was located from the refined orientation in the Crowther-Blow translation function. BRUTE (Fujinaga & Read, 1987) was used to check peak consistencies before ‘‘fixing’’ the position of either the constant or variable domain at the origin while the other search model was translated along ˚ increments to resolve the relative origin the y-axis in 1 A of the two heterodimer domains in the C2 space group. Deciphering the cross-rotation function results for SNase was more difficult. Initially, none of the rotation function solutions were convincing, since a clear translation function solution could not be located that produced a reasonable antibody complex. The Patterson correlation refinement protocol implemented in X-PLOR 3.0 (Bru¨nger, 1990) was used to orient the SNase. Using ˚ resolution data with =Fobs = > 2s, a single peak 15 to 4 A was produced after the filtering step. With this orientation

the translation function identified a weak (3.5s), but clear solution. The relative position between the antibody and the SNase was determined by a 5s peak, which corresponded to a maximum correlation coefficient of 0.414 and a minimum R-value of 0.439 using data in the ˚ resolution range. 6 to 4 A

Rigid-body refinement The overall orientations of the newly assembled N10 Fab–SNase complex was refined by the application of ˚ rigid-body minimization in X-PLOR using 6 to 3.2 A resolution data. As 36-71 Fv shares 62% amino acid sequence identity with N10 Fv, it was used for Fv with the IgG1 CL :CH 1 from D1.3. First, the orientations of each of the three rigid bodies, Fv, CL :CH 1, and SNase, were refined. This was followed by another 70 cycles with the complex further subdivided into five domains, VL , VH , CL , CH 1, and SNase. A graphical inspection of the crystal packing indicated that no serious neighboring steric clashes existed. Moreover, the Fv domain complementarity-determining regions formed contacts with the SNase. All non-identical residues were then replaced by alanine residues before continuing with the refinement. The rigid-body minimization was extended to include data in ˚ resolution range. The R-value after rigid-body the 2.8 A refinement for the newly constructed N10 Fab–SNase complex was 0.44 and the correlation coefficient was 0.47 ˚ resolution range. on =F=2 for all data in the 6 to 2.8 A Model building and refinement For graphical inspection and interactive model building, CHAIN (Sack, 1988) was used on a Silicon Graphics workstation. The complex structure was refined by simulated annealing using X-PLOR 3.1 (Bru¨nger, 1992b)

571

Structure of the N10-Staphylococcal Nuclease Complex

using the parameters of Engh & Huber (1991). No attempt was made to model the bulk solvent. Four rounds of simulated annealing refinements with slow cooling (Bru¨nger et al., 1990) were conducted. For the first three rounds of refinement, B-factors were fixed at ˚ 2 for all structure factor calculations. In the fourth 15 A refinement round, B-factors were refined. The first round of simulated annealing refinement with ‘‘slow cooling’’ on the partial complex model reduced ˚ resolution the R-value to 0.32 using data in the 6 to 3 A range with =Fobs = > 2s. The entire model was refit to an electron density map contoured at 1.0s calculated with (2=Fobs = − =Fcalc =) coefficients and acalc phases from the partial model. The second round of simulated annealing ˚ refinement was conducted with all data in the 5 to 2.8 A resolution range. After this round, the model was completely rebuilt in the CDR loops according to the N10 VL :VH sequence. The backbone residues and the side-chain rotamers of CDRs L1, L2, and L3 of the variable light chain were assigned without reliance on canonical loop structures (Chothia & Lesk, 1987). The placement of main-chain and the conformations for many of the side-chains was more problematic for residues of CDR loops H1, H2, and H3. For the third round of simulated annealing refinement, polypeptide fragments for CDR H1 and H3 were completely omitted and a simulated annealing-omit electron density map was used to rebuild these loops. The entire model was re-examined and residues with geometrically unfavorable f/c values in Ramachandran plots (Ramachandran & Sasisekharan, 1968) were graphically inspected and fitted to appropriate electron density. Statistics for the final model are shown in Table 4. Structure analysis Stereochemistry was checked with PROCHECK (Laskowski et al., 1993). Intermolecular pairwise contacts were generated by CONTACSYM (Sheriff et al., 1987a;

Sheriff, 1993) using extended van der Waals radii (Gelin & Karplus, 1979). Hydrogen bonds were included up ˚ , charged interactions to a maximum length of 3.4 A (salt-bridges) were included up to a maximum length ˚ , and van der Waals interactions, which are 3.8 A ˚ for atom-type-dependent, were included up to 4.33 A methyl groups. The molecular surface area was calculated ˚ probe and with MS (Connolly, 1983) using a 1.7 A extended van der Waals radii to enable comparisons with previously described antibodies. Analysis of the surface area was carried out with ATMSRF (Sheriff et al., 1987b; Sheriff, 1993) and SUMAREA (Davies et al., 1990; Sheriff, 1993). Coordinates and structure factors have been deposited in the Protein Data Bank (Bernstein et al., 1977), accession numbers 1NSN and R1NSNSF, respectively. Model quality The geometry of the main-chain dihedral angles is presented as a Ramachandran plot (Figure 10). Residues for the N10 Fab fragment are clustered in an energetically favorable upper left-hand corner, typically associated with b-pleated sheets. Light chain residues at the antigen–antibody interface are well-defined although two light chain CDR residues (Arg L-31 and Ala L-51) which do not contact antigen, are among several with f/c values outside this region. Although the heavy chain is not as well-defined by the electron density, the gross features of the polypeptide tracing and the placement of the side-chains are clear. Several heavy chain residues have f/c values that lie outside the expected regions of the Ramachandran plot. Electron density for Ala H-114 and Lys H-115, which lie in the elbow region between the VH and CH 1 domains, is not entirely visible. Other equivocal residues include two heavy chain CDR1 residues (Asp H-32 and Ala H-34) and the FRl residue Ile H-29. While distortions of CDR residues have been reported for more refined Fab structures (Tulip et al., 1992a), these N10 residues are not

Figure 10. Ramachandran plot of the torsion angles of the N10–SNase complex. The plot is divided into regions based on distribution of torsion angles obtained from an analysis of highly refined structures by Laskowski et al. (1993). These regions range from dark grey as the most favored regions (A, B, L) to light grey for disallowed regions. Most non-glycine, non-proline residues of the N10–SNase complex lie within the most favored (340 residues, darkest grey regions A, B, L) or the additional allowed (112 residues, next darkest grey a, b, l, p) regions. Only ten residues lie within disallowed regions. Glycine residues are indicated by triangles and all other residues by squares.

572 well-defined and no significance should be placed on their locations in the Ramachandran plots. The only other tentative tracing is for residues 130 to 136 of the CH 1 domain, which is in electron density that is weak and discontinuous even at 0.8s. This region lies within a loop that is accessible to solvent and that is ill-determined in nearly all Fabs. The antigen, SNase, is much better defined by the electron density. The electron density is weak but continuous for the main-chain and Cb of three N-terminal residues (Thr S-4, Lys S-5, and Lys S-6), which have not been reported. No electron density is visible for the carboxy-terminal residues S-142 to S-149, consistent with other reports (Cotton et al., 1979; Loll & Lattman, 1989; Hynes & Fox, 1991). The f/c values of 69% of the visible 138 SNase residues lie within the most favored region of the Ramachandran plot and 22% lie within additional allowed conformational regions. Ten non-glycine SNase residues lie outside sterically favorable regions. The electron density is not continuous for residues Val S-111, Ala S-112, and Tyr S-113, which are part of a small solvent-exposed loop, nor is there continuous electron density for Lys S-48 or Lys S-49, which are part of the highly mobile V loop. In addition, a break in the main-chain density occurs between Lys S-49 and Tyr S-50 although the side-chain of Tyr S-50 is well-defined and the e-amino group of Lys S-49 clearly forms a salt-bridge with the Oe1 atom of Glu S-52. The remaining large number of solvent-exposed Lys, Arg, and Glu residues are clearly visible in the final (2=Fobs = − =Fcalc =) electron density map. Empirical free energy calculations The empirical free energy calculations were carried out with use of the program CONGEN (Bruccoleri & Karplus, 1987) as described (Novotny et al., 1989). Briefly, the X-ray crystallographic coordinates were energy-minimized for 200 cycles of the adopted basis Newton–Raphson (ABNR) protocol, with harmonic constraints of 20 kcal applied to the current atomic positions. The hydrophobic, electrostatic and side-chain conformational entropic contributions to the DG value of binding were estimated from calculations carried out on the complex and the isolated molecules, and subtracted from each other. Thus, the hydrophobic effect was estimated from the antibody–anti˚ probe radius); gen accessible contact surface areas (1.4 A the pairwise atomic electrostatic interactions were obtained from a Coulomb formula with an effective dielectric constant 4r evaluated to infinity; and the side-chain conformational loss was estimated from the number of torsional bonds between atoms buried in the interface, assuming 0.6 kcal for the TDS contribution from a single torsion.

Acknowledgements We thank Dr Ju¨rgen Bajorath for helpful discussions. Supported in part by grant IM-728 from the American Cancer Society to D.C.B.

References Adams, D. D. (1988). Long-acting thyroid stimulator: how receptor auto-immunity was discovered. J. Autoimmun. 1, 3–9. Amit, A. G., Mariuzza, R. A., Phillips, S. E. V. & Poljak, R. J. (1986). Three-dimensional structure of

Structure of the N10-Staphylococcal Nuclease Complex ˚ resolution. an antigen-antibody complex at 2.8 A Science, 233, 747–753. Arnone, A., Bier, C. J., Cotton, F. A., Day, V. W., Hazen, E. E., Richardson, D. C. & Richardson, J. S. (1971). A high resolution structure of an inhibitor complex of the extracellular nuclease of Staphylococcus aureus. I. Experimental procedures and chain tracing. J. Biol. Chem. 245, 2302–2316. Baldisseri, D. M., Torchia, D. A., Poole, L. B. & Gerlt, J. A. (1991). Deletion of the omega loop in the active site of staphylococcal nuclease. 2. Effects on protein structure and dynamics. Biochemistry, 30, 3628–3633. Ban, N., Escobar, C., Garcia, R., Hasel, K., Day, J., Greenwood, A. & McPherson, A. (1994). Crystal structure of an idiotype-anti-idiotype Fab complex. Proc. Natl Acad. Sci. USA, 91, 1604–1608. Benjamin, D. C., Williams, D. C., Jr, Smith-Gill, S. J. & Rule, G. S. (1992). Long-range changes in a protein antigen due to antigen-antibody interaction. Biochemistry, 31, 9539–9545. Bentley, G. A., Boulot, G., Riottot, M. M. & Poljak, R. J. (1990). Three-dimensional structure of an idiotopeanti-idiotope complex. Nature, 348, 254–257. Bernstein, F. C., Koetzle, T. F., Williams, G. J. B., Meyer, E. F., Brice, M. D., Rodgers, J. R., Kennard, O., Shimanouchi, T. & Tasumi, M. (1977). The Protein Data Bank: a computer-based archival file for macromolecular structures. J. Mol. Biol. 112, 535–542. Bhat, T. N., Bentley, G. A., Fischmann, T. O., Boulot, G. & Poljak, R. J. (1990). Small rearrangements in structures of Fv and Fab fragments of antibody D1.3 on antigen binding. Nature, 347, 483–485. Bhat, T. N., Bentley, G. A., Boulot, G., Greene, M. I., Tello, D., Dall’Acqua, W., Souchon, H., Schwarz, F. P., Mariuzza, R. A. & Poljak, R. J. (1994). Bound water molecules and conformational stabilization help mediate an antigen-antibody association Proc. Natl Acad. Sci. USA, 91, 1089–1093. Bizebard, T., Gigant, B., Rigolet, P., Rasmussen, B., Diat, O., Bo¨secke, P., Wharton, S. A., Skehel, J. A. & Knossow, M. (1995). Structure of influenza virus haemagglutinin complexed with a neutralizing antibody. Nature, 376, 92–94. Braden, B. C., Souchon, H., Eisele´, J.-L., Bentley, G. A., Bhat, T. N., Navaza, J., Poljak, R. J. (1994). Three-dimensional structures of the free and the antigen-complexed Fab from monoclonal anti-lysozyme antibody, D44.1. J. Mol. Biol. 243, 767–781. Bruccoleri, R. & Karplus, M. (1987). Prediction of the folding of short polypeptide segments by uniform conformational sampling. Biopolymers, 26, 137–168. Bru¨nger, A. T. (1990). Extension of molecular replacement: a new search strategy based on Patterson correlation refinement. Acta Crystallog. sect. A, 46, 46–57. Bru¨nger, A. T. (1992a). The free R value: a novel statistical quantity for assessing the accuracy of crystal structures. Nature, 355, 472–474. Bru¨nger, A. T. (1992b). X-PLOR version 3.1. a system for X-ray crystallography and NMR. Yale University Press, New Haven. Bru¨nger, A. T., Krukowski, A. & Erickson, J. (1990). Slow-cooling protocols for crystallographic refinement simulated annealing. Acta Crystallog. sect. A, 46, 585–593. Carson, M. (1991). Ribbons 2.0. J. Appl. Crystallog. 24, 958–961. Chacko, S., Silverton, E., Kam-Morgan, L., Smith-Gill, S., Cohen, G. & Davies, D. (1995). Structure of an

Structure of the N10-Staphylococcal Nuclease Complex

antibody–lysozyme complex: unexpected effect of a conservative mutation. J. Mol. Biol. 245, 261–274. Chang, C. Y., Bossart Whitaker, P., Tabernero, L., Einspahr, H., Workman, L., Benjamin, D. C. & Sheriff, S. (1994). Crystallization and preliminary X-ray analysis of an anti-Staphylococcal nuclease– Staphylococcal nuclease complex and of a second anti-Staphylococcal nuclease antibody. J. Mol. Biol. 239, 154–157. Chitarra, V., Alzari, P. M., Bentley, G. A., Bhat, T. N., Eisele´, J.-L., Houdusse, A., Lescar, J., Souchon, H. & Poljak, R. J. (1993). Three-dimensional structure of a heteroclitic antibody–antigen cross-reaction complex. Proc. Natl Acad. Sci. USA, 90, 7711–7715. Chothia, C. & Lesk, A. M. (1987). Canonical structures for the hypervariable regions of immunoglobulins. J. Mol. Biol. 196, 901–917. Chothia, C., Lesk, A. M., Tramontano, A., Levitt, M., Smith-Gill, S. J., Air, G., Sheriff, S., Padlan, E. A., Davies, D., Tulip, W. R., Colman, P. M., Spinelli, S., Alzari, P. M. & Poljak, R. J. (1989). The conformations of immunoglobulin hypervariable regions. Nature, 342, 877–883. Colman, P. M. (1989). Neuraminidase: enzyme and antigen. In The Influenza Viruses (Krug, R. M., ed.), pp. 175–218, Plenum, New York. Connolly, M. L. (1983). Analytical molecular surface calculation. J. Appl. Crystallog. 16, 548–558. Cotton, F. A., Hazen, E. E., Jr & Legg, M. J. (1979). Staphylococcal nuclease: proposed mechanism of action based on structure of enzyme-thymidine ˚ resol3',5'biphosphate-calcium ion complex at 1.5 A ution. Proc. Natl Acad. Sci. USA, 76, 2551–2555. Crowther, R. A. (1972). In The Molecular Replacement Method (Rossmann, M. G., ed.), pp. 173–178, Gordon and Breach, New York. Crowther, R. A. & Blow, D. M. (1967). A method of positioning a known molecule in an unknown crystal structure. Acta Crystallog. 23, 544–548. Cygler, M. & Anderson, W. F. (1988a). Application of the molecular replacement method to multidomain proteins. 1. Determination of the orientation of an immunoglobulin Fab fragment. Acta Crystallog. sect. A, 44, 38–45. Cygler, M. & Anderson, W. F. (1988b). Application of the molecular replacement method to multidomain proteins. 2. Comparison of various methods for positioning an oriented fragment in the unit cell. Acta Crystallog. sect. A, 44, 300–308. Davies, D. R. & Chacko, S. (1993). Antibody structure. Acc. Chem. Res. 26, 421–427. Davies, D. R. & Padlan, E. A. (1992). Twisting into shape. Curr. Biol. 2, 254–256. Davies, D. R., Padlan, E. A. & Sheriff, S. (1990). Antibody-antigen complexes. Annu. Rev. Biochem. 59, 439–473. Durbin, R. M., Burns, R., Moulai, J., Metcalf, P., Freymann, D., Blum, M., Anderson, J. E., Harrison, S. C. & Wiley, D. C. (1986). Protein, DNA, and virus crystallography with a focused imaging proportional counter. Science, 232, 1127–1132. Engh, R. A. & Huber, R. (1991). Accurate bond and angle parameters for X-ray protein structure refinement. Acta Crystallog. sect. A, 47, 392–400. Evans, S. V., Rose, D. R., To, R., Young, N. M. & Bundle, D. R. (1994). Exploring the mimicry of polysaccharide antigens by anti-idiotypic antibodies: the crystalliz˚ ation, molecular replacement, and refinement to 2.8 A resolution of an idiotope-anti-idiotape Fab complex

573 and of the unliganded anti-idiotope Fab. J. Mol. Biol. 241, 691–705. Fields, B. A., Goldbaum, F. A., Ysern, X., Poljak, R. J. & Mariuzza, R. A. (1995). Molecular basis of antigen mimicry by an anti-idiotope. Nature, 374, 739–742. Fischmann, T. O., Bentley, G. A., Bhat, T. N., Boulot, G., Mariuzza, R. A., Phillips, S. E. V., Tello, D. & Poljak, R. J. (1991). Crystallographic refinement of the three-dimensional structure of the Fab D1.3– ˚ resolution. J. Biol. Chem. lysozyme complex at 2.5-A 266, 12915–12920. Fitzgerald, P. M. D. (1988). MERLOT, an integrated package of computer programs for the determination of crystal structures by molecular replacement. J. Appl. Crystallog. 21, 273–278. Fujinaga, M. & Read, R. J. (1987). Experiences with a new translation-function program. J. Appl. Crystallog. 20, 517–521. Gelin, B. R. & Karplus, M. (1979). Side-chain torsional potentials: effect of dipeptide, protein, and solvent environment. Biochemistry, 18, 1256–1268. Ghiara, J. B., Stura, E. A., Stanfield, R. L., Profy, A. T. & Wilson, I. A. (1994). Crystal structure of the principal neutralizing site of HIV-1. Science, 264, 82–85. Howard, A. J., Gilliland, G. L., Finzel, B. C., Poulos, T. L., Ohlendorf, D. H. & Salemme, F. R. (1987). The use of an imaging proportional counter in macromolecular crystallography. J. Appl. Crystallog. 20, 383–387. Hynes, T. R. & Fox, R. O. (1991). The crystal structure of ˚ resolution. staphylococcal nuclease refined at 1.7 A Proteins: Struct. Funct. Genet. 10, 92–105. Jacobo-Molina, A., Ding, J., Nanni, R. G., Clark, A. D., Jr, Lu, X., Tantillo, C., Williams, R. L., Kamer, G., Ferris, A. L., Clark, P., Hizi, A., Hughes, S. H. & Arnold, E. (1993). Crystal structure of human immunodeficiency virus type 1 reverse transcriptase complexed ˚ resolution with double-stranded DNA at 3.0 A shows bent DNA. Proc. Natl Acad. Sci. USA, 90, 6320–6324. Jeffrey, P. D., Schildbach, J. S., Chang, C. Y., Kussie, P. H., Margolies, M. N. & Sheriff, S. (1995). Structure and specificity of the anti-digoxin antibody 40-50. J. Mol. Biol. 248, 344–360. Jemmerson, R., Buron, S., Sanishvili, R., Margoliash, E., Westbrook, E. & Westbrook, M. (1994). Crystallization of two monoclonal Fab fragments of similar amino-acid sequence bound to the same area of horse cytochrome c and interacting by potentially distinct mechanisms. Acta Crystallog. sect. D, 50, 64–70. Jin, L., Fendly, B. M. & Wells, J. A. (1992). High resolution analysis of antibody–antigen interactions. J. Mol. Biol. 226, 851–865. Kabat, E. A., Wu, T. T., Perry, H. M., Gottesman, K. S. & Foeller, C. (1991). Sequences of Proteins of Immunological Interest. 5th edit. National Institutes of Health, Bethesda, MD. Keefe, L. J., Sondek, J., Shortle, D. & Lattman, E. E. (1993). The alpha aneurism: a structural motif revealed in an insertion mutant of staphylococcal nuclease. Proc. Natl Acad. Sci. USA, 90, 3275–3279. Kraulis, P. J. (1991). MOLSCRIPT: a program to produce both detailed and schematic plots of protein structures. J. Appl. Crystallog. 24, 946–950. Laskowski, R. A., MacArthur, M. W., Moss, D. S. & Thornton, J. M. (1993). PROCHECK: a program to

574 check the stereochemical quality of protein structures. J. Appl. Crystallog. 26, 283–291. Lattman, E. E. & Love, W. E. (1970). A rotational search procedure for detecting a known molecule in a crystal. Acta Crystallog. Sect. B, 26, 1854–1857. Lawrence, M. C. & Colman, P. M. (1993). Shape complementarity at protein/protein interfaces. J. Mol. Biol. 234, 946–950. Leszczynski, J. F. & Rose, G. D. (1986). Loops in globular proteins: a novel category of secondary structure. Science, 234, 849–855. Loll, P. J. & Lattman, E. E. (1989). The crystal structure of the ternary complex of staphylococcal nuclease, Ca2+, ˚ . Proteins: and the inhibitor pdTp, refined at 1.65 A Struct. Funct. Genet. 5, 183–201. Loll, P. J. & Lattman, E. E. (1990). Active site mutant Glu43Asp in staphylococcal nuclease displays non-local structural changes. Biochemistry, 29, 6866–6873. Luzzati, V. (1952). Traitement statistique des erreurs dans la determination des structures cristallines. Acta Crystallog. 5, 802–810. Malby, R. L., Tulip, W. R., Harley, V. R., McKimmBreschkin, J. L., Laver, W. G., Webster, R. G. & Colman, P. M. (1994). The structure of a complex between the NC10 antibody and influenza virus neuraminidase and comparison with the overlapping binding site of the NC41 antibody. Structure, 2, 733–746. Mariuzza, R. A. & Poljak, R. J. (1993). The basics of binding: mechanisms of antigen recognition and mimicry by antibodies. Curr. Opin. Immunol. 5, 50–55. Matthews, B. W. (1968). Solvent content of proteins. J. Mol. Biol. 33, 491-497. Mayne, L., Paterson, Y., Cerasoli, D. & Englander, S. W. (1992). Effect of antibody binding on protein motions studied by hydrogen-exchange labeling and two-dimensional NMR. Biochemistry, 31, 10678–10685. Mylvaganam, S. E., Paterson, Y., Kaiser, K., Bowdish, K. & Getzoff, E. D. (1991). Biochemical implications from the variable gene sequences of an anti-cytochrome c antibody and crystallographic characterization of its antigen-binding fragment in free and antigen-complexed forms. J. Mol. Biol. 221, 455–462. Nicholls, A., Sharp, K. & Honig, B. (1991). Protein folding and association: insights from the interfacial and thermodynamic properties of hydrocarbons. Proteins: Struct. Funct. Genet. 11, 281–296. Novotny, J. (1991). Protein antigenicity: a thermodynamic approach. Mol. Immunol. 28, 201–207. Novotny, J., Bruccoleri, R. & Saul, R. (1989). On the attribution of binding energy in antigen–antibody complexes McPC603, D1.3, and HyHEL-5. Biochemistry, 28, 4735–4749. Novotny, J., Bruccoleri, R. E. & Haber, E. (1990). Computer analysis of mutations that affect antibody specificity. Proteins: Struct. Funct. Genet. 7, 93–98. Padlan, E. A., Silverton, E. W., Sheriff, S., Cohen, G. H., Smith-Gill, S. J. & Davies, D. R. (1989). Structure of an antibody–antigen complex: crystal structure of the HyHEL-10 Fab-lysozyme complex. Proc. Natl Acad. Sci. USA, 86, 5938–5942. Porter, R. R. (1959). The hydrolysis of rabbit g-globulin and antibodies with crystalline papain. Biochem. J. 73, 119–126. Prasad, L., Sharma, S., Vandonselaar, M., Quail, J. W., Lee, J. S., Waygood, E. B., Wilson, K. S., Dauter, Z. & Delbaere, L. T. J. (1993). Evaluation of mutagenesis for epitope mapping: structure of an antibody-protein antigen complex. J. Biol. Chem. 268, 10705–10708.

Structure of the N10-Staphylococcal Nuclease Complex

Ramachandran, G. N. & Sasisekharan, V. (1968). Conformation of polypeptides and proteins. Advan. Protein Chem. 23, 283–438. Rini, J. M., Schulze-Gahmen, U. & Wilson, I. A. (1992). Structural evidence for induced fit as a mechanism for antibody-antigen recognition. Science, 255, 959– 965. Rini, J. M., Stanfield, R. L., Stura, E. A., Salinas, P. A., Profy, A. T. & Wilson, I. A. (1993). Crystal structure of a human immunodeficiency virus type 1 neutralizing antibody, 50.1, in complex with its V3 loop peptide antigen. Proc. Natl Acad. Sci. USA, 90, 6325–6329. Sack, J. S. (1988). CHAIN–a crystallographic modeling program. J. Mol. Graph. 6, 224–225. Satow, Y., Cohen, G. H., Padlan, E. A. & Davies, D. R. (1986). Phosphocholine binding immunoglobulin Fab ˚ . J. Mol. McPC603. An X-ray diffraction study at 2.7 A Biol. 190, 593–604. Sheriff, S. (1993). Some methods for examining the interactions between two molecules. Immunomethods, 3, 191–196. Sheriff, S. Hendrickson, W. A. & Smith, J. L. (1987a) Structure of myohemerythrin in the azidomet state at ˚ resolution. J. Mol. Biol. 197, 273–296. 1.7/1.3 A Sheriff, S., Silverton, E. W., Padlan, E. A., Cohen, G. H., Smith-Gill, S. J., Finzel, B. C. & Davies, D. R. (1987b). Three-dimensional structure of an antibody– antigen complex. Proc. Natl Acad. Sci. USA, 84, 8075–8079. Sheriff, S., Padlan, E. A., Cohen, G. H. & Davies, D. R. (1990). Molecular-replacement structure determination of two different antibody:antigen complexes. Acta Crystallog. sect. B, 46, 418–425. Shortle, D. (1983). A genetic system for analysis of staphylococcal nuclease. Gene, 22, 181–189. Smith, A. M. & Benjamin, D. C. (1991). The antigenic surface of staphylococcal nuclease. II. Analysis of the N-1 epitope by site-directed mutagenesis. J. Immunol. 146, 1259–1264. Smith, A. M., Woodward, M. P., Hershey, C. W., Hershey, E. D. & Benjamin, D. C. (1991). The antigenic surface of staphylococcal nuclease. I. Mapping epitopes by site-directed mutagenesis. J. Immunol. 146, 1254–1258. Stanfield, R. L., Takimoto-Kamimura, M., Rini, J. M., Profy, A. T. & Wilson, I. A. (1993). Major antigeninduced domain rearrangements in an antibody. Structure, 1, 83–93. Steipe, B., Plu¨ckthun, A. & Huber, R. (1992). Refined crystal structure of a recombinant immunoglobulin domain and a complementarity-determining region 1-grafted mutant. J. Mol. Biol. 225, 739–753. Strong, R. K., Campbell, R., Rose, D. R., Petsko, G. A., Sharon, J. & Margolies, M. N. (1991). Three-dimensional structure of murine anti-p-azophenylarsonate Fab 36-71.1. X-ray crystallography, site-directed mutagenesis, and modeling of the complex with hapten. Biochemistry, 30, 3739–3748. Torchia, D. A., Sparks, S. W. & Bax, A. (1989). Staphylococcal nuclease: sequential assignments and solution structure. Biochemistry, 28, 5509–5524. Tulip, W. R., Varghese, J. N., Laver, W. G., Webster, R. G. & Colman, P. M. (1992a). Refined crystal structure of the influenza virus N9 neuraminidase–NC41 Fab complex. J. Mol. Biol. 227, 122–148. Tulip, W. R., Varghese, J. N., Webster, R. G., Laver, W. G. & Colman, P. M. (1992b). Crystal structures of two

Structure of the N10-Staphylococcal Nuclease Complex

mutant neuraminidase–antibody complexes with amino acid substitutions in the interface. J. Mol. Biol. 227, 149–159. Tulip, W. R., Harley, V. R., Webster, R. G. & Novotny, J. (1994). N9 neuraminidase complexes with antibodies NC41 and NC10: empirical free energy calculations capture specificity trends observed with mutant binding data. Biochemistry, 33, 7987–7997.

575 Webster, D. M., Henry, A. H. & Rees, A. R. (1994). Antibody–antigen interactions. Curr. Opin. Struct. Biol. 4, 123–129. Wilson, I. A. & Stanfield, R. L. (1993). Antibody–antigen interactions. Curr. Opin. Struct. Biol. 3, 113–118. Wilson, I. A. & Stanfield, R. L. (1994). Antibody–antigen interactions: new structures and new conformational changes. Curr. Opin. Struct. Biol. 4, 857–867.

Edited by I. A. Wilson (Received 15 June 1995; accepted 21 August 1995)