- Email: [email protected]
The curli biogenesis genes expression level is unassociated with Enterobacter cloacae hsp60 clusters and PFGE genotypes
Microbial Pathogenesis 98 (2016) 112e117
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
The curli biogenesis genes expression level is unassociated with Enterobacter cloacae hsp60 clusters and PFGE genotypes Majid Akbari a, Bita Bakhshi a, *, Shahin Najar-Peerayeh a, Mehrdad Behmanesh b a b
Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran Department of Genetics, Faculty of Biological Sciences, Tarbiat Modares University, Tehran, Iran
a r t i c l e i n f o
a b s t r a c t
Article history: Received 13 April 2016 Received in revised form 16 June 2016 Accepted 24 June 2016 Available online 25 June 2016
The objective of this study was to determine the correlation between Enterobacter cloacae complex subspecies and clusters involved in UTI infections and specific pulsotypes, and to assess the contribution of major curli biogenesis genes (csgD, csgA) expression level to pathogenesis of clusters and genotypes. Based on the PFGE analysis, 37 different profiles were observed among which 8 profiles were common types. Real time PCR of csgD and csgA genes of 50 E. cloacae complex in relation to PFGE and hsp60 genotypes showed that all the genetic clusters are not equally involved in pathogenesis of urinary tract infections. It was elucidated in this study that isolates with common PFGE genotypes belonged to identical hsp60 clusters, and the foremost clusters (VI, III, and V) mainly comprised within PFGE common types. In our study, no significant correlation was detected between the specific hsp60 clusters or PFGE genotypes and the expression level of csgD and csgA genes (P-value > 0.05). This is the first study describing that unequivalent contribution of E. cloacae genotypes and clusters in pathogenesis of UTI, is not owing to varied curli biogenesis expression potential. The PFGE genotyping showed more discriminatory power than hsp60 genotyping for epidemiological studies and source tracking purpose. © 2016 Published by Elsevier Ltd.
Keywords: Enterobacter cloacae hsp60 Curli PFGE Real time-PCR
1. Introduction Only few bacterial phyla are as adaptable as the nomenspecies Enterobacter cloacae. In addition to being ubiquitous in land and aquatic environments, it is part of the commensal gut microbiota and has a key role as a pathogen for plants, insects, and humans [1]. E. cloacae is progressively identified as one of the ten most frequent species causing hospital-acquired wound, urinary tract infections, pneumonia, and sepsis in intensive care units. But what clinical microbiologists identify as E. cloacae, relies on biochemical properties as well as sequencing of a fragment of hsp60, which represents a large complex of at least 13 different species, subspecies, and genotypes [2e5]. Special names are ascribed to a number of genetic clusters; nine of which correspond to species: Enterobacter asburiae (Cluster I), Enterobacter kobei (Cluster II), Enterobacter ludwigii (Cluster V), Enterobacter hormaechei subsp. oharae (Cluster VI), E. hormaechei
* Corresponding author. Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Jalal-Ale-Ahmad Ave, Tehran, 14117-13116, Iran. E-mail address: [email protected] (B. Bakhshi). http://dx.doi.org/10.1016/j.micpath.2016.06.030 0882-4010/© 2016 Published by Elsevier Ltd.
subsp. hormaechei (Cluster VII), E. hormaechei subsp. steigerwallti (Cluster VIII), Enterobacter nimipressuralis (Cluster X), E. cloacae subsp. cloacae (Cluster XI), E. cloacae subsp. dissolvens (Cluster XII) and E. cloacae sequence crowd (Cluster xiii); whereas four clusters do not have special names and referred to as E. cloacae Cluster III, E. cloacae Cluster IV, E. cloacae Cluster IX and Cluster XIII [6]. The genotypic together with phenotypic differences between subspecies and clusters is a topic that still needs to be explored. In recent years, genotypic methods have been developed to extend the discriminatory power of epidemiological investigations. Sensitive and reproducible molecular markers have been applied successfully to the E. cloacae complex, among which PFGE is considered to be the gold standard [7]. The pathogenesis of E. cloacae relies mainly on the ability to express and produce curli fimbria which is involved in cell accumulation, adherence to surfaces, and biofilm formation. An extremely controlled pathway involving 2 divergently expressed operons is crucial for curli biogenesis. The csgBAC operon encodes the most important curli subunit, CsgA, and its homolog CsgB. The csgDEFG operon encodes CsgD, a transcriptional activator of the csgBAC operon, along with CsgE and CsgF that act as chaperones
M. Akbari et al. / Microbial Pathogenesis 98 (2016) 112e117
113
Table 1 Primers used in this study. Primer
Sequence (5e3)
Target
PCR product (bp)
Ref.
F-hsp60 R-hsp60 F-csgA R-csgA F-csgD R-csgD F-rpoB R-rpoB
GGTAGAAGAAGGCGTGGTTGC ATGCATTCGGTGGTGATCATCAG ATTGCAGCAATCGTAGTTTCTGG ATWGAYCTGTCATCAGAGCCCTGG TGAAARYTGGCCGCATATCAATGG ACGCCTGAGGTTATCGTTTGCC GTAYGCACAGACNAACGAATAYGG GAACGGGATCAGGGACGCAC
hsp60
341
[5]
csgA
245
This study
csgD
355
This study
rpoB
280
This study
Table 2 Genetic clusters of the E. cloacae complex under study. Strains name
Cluster
Number of isolates
E. Asburiae E. Kobei E. Cloacae III E. lodwigii E. hormaechei subsp. oharae E. hormaechei subsp. hormaechei E. hormaechei subsp. Steigerwaltii E. cloacae subsp. cloacae Total
I II III V VI VII VIII XI 8
2 1 9 4 25 1 6 2 50
needed for efficient curli construction [5,6]. The objective of this research was to determine the correlation between E. cloacae complex subspecies and clusters involved in UTI infections and specific genotypes, and to assess the contribution of major curli biogenesis genes (csgD, csgA) expression level to pathogenesis of clusters and genotypes causing urinary tract infections in Tehran I.R. Iran. 2. Materials and methods 2.1. Bacterial strains and epidemiological data Fifty E. cloacae isolates were included from urine cultures of inpatients suffering from urinary tract infection, admitted to six major hospitals in Tehran, Iran during Dec 2012 to Nov 2013. The overall rate of E. cloacae isolation from the total UTIs was about 7%. The isolates were identified as E. cloacae by routine phenotypic identification systems (the API 20E; BioMerieux, France). The identity of isolates was previously confirmed by partial sequencing of the hsp60 gene [8]. Two E. cloacae (PTCC 1003 and PTCC 1798), kindly provided by IROST (Iranian Research Organization for Science and Technology), were used as positive controls. Phylogenetic and molecular evolutionary analyses based on the hsp60 sequences were conducted using MEGA software version 6, and the isolates were assigned to E. cloacae subspecies and clusters according to the criteria introduced by Haffman and colleagues [5]. 2.2. Genomic DNA preparation and PFGE PulseNet standardized protocol was used for subtyping of Enterobacter spp [9]. In brief, the plate cultures of bacteria were suspended in a cell suspension buffer (100 mmol L1 Tris, 100 mmol L1 EDTA, pH 8.0) and adjusted to absorbance values of 0.8e1.0 at a wavelength of 610 nm. Cell suspensions were used for preparation of agarose plugs using SeaKem Gold agarose (Lonza, Rockland, ME, USA) and proteinase K. A lysis solution consisting of 50 mmol L1 Tris, 50 mmol L1 EDTA (pH 8.0), 1% sarcosine, and 0.5 mg proteinase K, was used for treatment of agarose plugs at 54 C for 1 h. After
washing steps, twice with sterile ultrapure water and four times with TE buffer (10 mmol L1 Tris, 1 mmol L1 EDTA, pH 8.0), 40 units of XbaI restriction enzyme (Roche Diagnostic, Mannheim, Germany) was used for digestion of plugs with embedded DNA. DNA molecular weight size marker was prepared by XbaI digestion of Salmonella enterica serotype Braenderup H9812 plugs. CHEF Mapper XA System (Bio-Rad) was applied for electrophoresis with 200 V at 14 C for 18 h with the increasing pulsed time from 2.16 to 54.17 s. PFGE patterns were analyzed by Gel Compare II software version 4.0 (Applied Maths, Sint-Martens-Latem, Belgium), and the patterns were compared by using the Dice coefficient and unweighted pair group method with arithmetic averages (UPGMA) clustering. A dendrogram was constructed using an optimization value of 0.50% and a position tolerance of 1.0%. 2.3. RNA preparations of Enterobacter cloacae complex and cDNA synthesis Total RNA was isolated using the CinnaPure-RNA Kits (CinnaPure RNA Extraction, SinaClon BioScience, IR, Iran) according to manufacturer instruction and treated with 10 U DNase I (Takara Biotechnology) for 30 min at 37 C to eliminate genomic DNA (gDNA) contamination and then heat-inactivated at 80 C for 2 min before reverse transcription. For first-strand cDNA synthesis, the reverse transcription reaction contained 5 mg of treated RNA, 100 pmol (0.2 ml) hexamer primer, DEPC-treated water up to 12.5 ml. The mixture blended gently, centrifuged briefly and incubated at 65 C for 5 min. The 10 Buffer (2 ml), 10 mM dNTP, 200 U (1 ml) Revert Aid M-MLV reverse transcriptase (SinaClon BioScience) in a final volume of 20 ml was prepared and the mixture was incubated at 42 C for 1 h and the reaction was heat-inactivated at 70 C for 10 min. 2.4. Real-time PCR Oligo Primer Analysis software version 7 (Molecular Biology Insights, Inc., Cascade, CO, USA) was used to design the oligonucleotide primers for selected genes (Table 1). Accordingly, all available sequences in the GenBank database were downloaded and used for analysis. Reactions were set up in a total volume of 20 ml using 1 ml of cDNA, 2 ml 5X Hot FirePol EvaGreen qPCR Mix Plus (ROX) (Solis BioDyne), 0.3 ml each of gene-specific primer (Table 1), and 15.8 ml D.W. The reaction was performed by Applied Biosystems StepOne Real Time PCR Systems. The cycling conditions were as follows: 95 C for 15 min; 40 cycles of 95 C for 15 s, 60 C for 15 s, and 72 C for 15 s with a single fluorescence measurement; and a final elongation step at 72 C for 5 min. Specificity of the PCR products was confirmed by the analysis of the dissociation curve. In this study, quantitative expression of csgD and csgA genes by relative method was determined. Real-Time PCR experiments were performed in duplicate for each sample and the average amount of Ct of target genes (csgD and csgA) from the average amount of Ct of
114
M. Akbari et al. / Microbial Pathogenesis 98 (2016) 112e117
Fig. 1. Dendrogram was drawn based on PFGE patterns of 50 Enterobacter cloacae isolates from UTI in accordance with their clusters obtained through hsp60 sequencing. The distribution of isolates within each hospital is as follows: Hospital 1:16 isolates (32%), Hospital 2:8 isolates (16%), Hospital 3:3 isolates (6%), Hospital 4:2 isolates (4%), Hospital 5:5 isolates (10%), Hospital 6:16 isolates (32%).
normalizer gene (rpoB) deducted, and DCt mean of every target gene in isolates calculated. In this study, isolates of Cluster VI (E. hormaechei subsp. Oharae) were considered as index group, and DCt mean of csgD and csgA genes of other clusters were compared with this one relatively by SPSS software ver.16 and by t-test, and P value was calculated for each cluster and gene individually.
E. cloacae complex (Table 2). Thirty-two (64%) of the isolates belonged to 3 E. hormaechei taxon. As explained, E. hormaechei was the foremost eminent species of our study collection with the best clinical relevance in UTI. A full description of isolates under study is depicted in Table 2. 3.2. Pulsed-field gel electrophoresis
3. Results 3.1. Isolates and related hsp60 clusters classification Previously determined partial hsp60 sequences indicated that the study isolates were classified into several genetic clusters of
PFGE, after XbaI digestion, generated fingerprints of seven to twelve bands per isolate (Fig. 1). Following the criteria of Tenover et al. (1995) [10], isolates belong to an equivalent clone, if PFGE patterns differ with fewer than two restriction sites. Accordingly, PFGE analysis revealed 37 different profiles (Fig. 1) within the 50
M. Akbari et al. / Microbial Pathogenesis 98 (2016) 112e117
115
Diagram 1. View of csgD gene experssion in 50 Enterobacter cloacae complex base on DCt in relation to their hsp60 clusters.
Diagram 2. View of csgA gene experssion in 50 Enterobacter cloacae complex base on DCt in relation to their hsp60 clusters.
E. cloacae complex isolates, among which eight were common types, while others were presented as single types. Common types A and C, each contained four strains, and clonal type B with 3 strains were the commonest types. Additionally, clonal types D, E, F, G and H each consisted of two strains. A majority of the isolates with identical pulsotypes were isolated from the same hospitals (clonal types E, F, G, H) but similar patterns were also observed between the first and sixth hospitals (clonal types B, C, D) and between the sixth and third hospitals (clonal types A and B). Twenty-nine strains (single types) made individual PFGE patterns
(Fig. 1), which indicated the absence of clonal correlation among the isolates. Similarity indices indicated <50e100% homogeneity among the most diverse and identical isolates respectively. Diversity index of population under study was calculated to be 0.98, which is indicative of a very diverse population. 3.3. Real-time PCR The expression level (DCt mean) of genes varied between 3.860504 and 11.345986 values for csgA and between
116
M. Akbari et al. / Microbial Pathogenesis 98 (2016) 112e117
Table 3 The Mean and Standard Deviation of csga and csgd genes. Clusters
I II III IV VI VII VIII XI p-valuea a
csgD
csgA
Mean
SD
Mean
SD
2.107 6.356 6.625 1.742 4.920 3.061 6.464 1.270 0.196
3.6 _ 4.846 0.416 3.630 _ 3.296 1.192
0.999 11.345 3.321 5.554 2.592 3.113 3.507 4.462 0.321
2.5 _ 5.061 3.230 2.863 _ 2.644 2.150
Kruskal Wallis test.
0.26816177 and 13.157816 values for csgD. The highest level of expression was seen in members of Clusters III and VI (for both genes) (Diagrams 1 and 2). Relative to Cluster VI (as the major cluster in E. cloacae cluster), DCt mean of csgD and csgA genes of other clusters, showed no significant difference between clusters (Minimum P-value csgA 0.070 & Minimum P-value csgD 0.095). This means that no measurable difference was detected in the expression value of csgD and csgA genes between clusters. Mean of DCt of csgA and csgD genes in each clusters is shown in Table 3.
4. Discussion Based on the hsp60 analysis, not all genetic clusters were equally involved in pathogenesis of urinary tract infections. This fact highlights the need for more accurate routine bacterial identification methods and a better understanding of the etiology of UTI and pathogenesis of the E. cloacae complex. Three superior clusters together represented more than two third (76%) of the study strains (Cluster VI with 23members; Cluster III and VIII with 9 and 6 members respectively). Other investigators from USA and France have shown that the E. hormaechei subsp. oharae (Cluster 6), E. cloacae)Cluster III(, and E. hormaechei subsp. steigerwaltii (Cluster VIII) were the species which most frequently recovered from clinical specimens [11]. This suggests that regardless of their geographical distributions these genotypes and clusters are more frequently involved in human pathogenesis. This raises the question of whether some clusters or genotypes are intrinsically more pathogenic than the others. In order to answer the question, the presence and expression level of genes involved in curli biogenesis (the most important virulence factor of Enterobacter spp.) was assessed. All of 50 studied Enterobacter cloacae complex isolates harbored csgA and csgD genes. Zogaj and colleagues in 2003 reported the presence of csg genes in the genus Enterobacter, Citrobacter, Klebsiella, while no gene expression was detected [12]. Although the changes in the csg genes expression was reported by Kim and colleagues (2011), but correlation between clusters and the value of gene expression was still unsolved [13]. Some mutational or recombinational events which may occur within the coding or regulatory sequences of curli biogenesis gene cluster can lead to inactive curli or its absence [14]. Moreover, increase in csgD activities, a transcriptional regulator belonging to the LuxR protein family, is associated with increase in expression of curli and increase in aggressiveness and virulence of bacteria [15e17]. In our study, no significant relevance was detected between specific clusters or genotypes and the level of csgD and csgA expression (P-value > 0.05). Moreover, the level of expression of csgA was not necessarily in coordination with that of csgD, which suggests that other regulatory factors other than csgD may affect
the expression of csgBAC operon. To our knowledge, no other study has explored the curli biogenesis gene expression within Enterobacter spp. In this study, PFGE analysis was conducted on fifty isolates of E. cloacae complex, all of which produced distinguishable banding patterns. PFGE, on the impact of XbaI restriction endonuclease, revealed fingerprints of seven to twelve bands with a high level of diversity (Di ¼ 0.98) in pulsotypes; Twenty-nine of which consisted of single types endorsing sporadic UTI cases caused by E. cloacae complex. In order to assess the correlation between hsp60 clusters and PFGE genotypes, the lack of clonality of isolates is of great significance. Among common types, members of CTA, C and D, were isolated from 2 major medical centers, and members of CTB were isolated from 3 medical centers, which rules out the probable clonality of isolates within common types. Each of the CTE, CTF, CTG, and CTH were composed of members isolated from a single hospital, however, the isolation date demonstrated a distance of at least 3 months, which confirms their independency. It was elucidated in this study that isolates with common PFGE genotypes belonged to identical hsp60 clusters, and the foremost clusters (VI, III, V) mainly comprised within common types. Moreover, there were many individual pulsotypes that fit in dominant hsp60 clusters, which may suggest that, i) the most common hsp60 clusters (with identical pulsotypes) may have increased circulation and consequently undergone more genetic changes through time and converted to diverse pulsotypes, ii) members of some clusters may have had the opportunity to more increasingly multiply and spread among clinical population and comprise common clusters probably due to increased pathogenic and competition potential. In conclusion, study on E. cloacae revealed that i) isolates from urinary infections belonging to common pulsotypes, had common hsp60 genetics clusters, and members of genetics Clusters VI and III had more capability for creating common types, ii) PFGE genotyping showed more discriminatory power than hsp60 genotyping, iii) the expression level of curli biogenesis genes and its positive regulator did not vary significantly between members of different hsp60 clusters, which rules out its role in unequivalent contribution of clusters in human pathogenesis. Conflict of interest There is no conflict of interest. Acknowledgements We thank the research council of Tarbiat Modares University for supporting the project. References [1] W.E. Sanders Jr., C.C. Sanders, Enterobacter spp.: pathogens poised to flourish at the turn of the century, Clin. Microbiol. Rev. 10 (2) (1997) 220e241. [2] H. Hoffmann, S. Stindl, W. Ludwig, A. Stumpf, A. Mehlen, D. Monget, D. Pierard, S. Ziesing, J. Heesemann, A. Roggenkamp, K.H. Schleifer, Enterobacter hormaechei subsp. oharae subsp. nov., E. hormaechei subsp. hormaechei comb. nov., and E. hormaechei subsp. steigerwaltii subsp. nov., three new subspecies of clinical importance, J. Clin. Microbiol. 43 (7) (2005) 297e303. [3] Harald Hoffmann, Sibylle Stindl, Anita Stumpf, Andre Mehlen, Daniel Monget, Jürgen Heesemann, Karl H. Schleifer, Andreas Roggenkamp, Description of Enterobacter ludwigii sp. nov., a novel Enterobacter species of clinical relevance, Syst. Appl. Microbiol. 28 (3) (2005) 206e212. [4] Harald Hoffmann, Sibylle Stindl, Wolfgang Ludwig, Anita Stumpf, Mehlen, Jürgen Heesemann, Daniel Monget, Karl H. Schleifer, Andre Andreas Roggenkamp, Reassignment of Enterobacter dissolvens to Enterobacter cloacae as E. cloacae subspecies dissolvens comb. nov. and emended description of Enterobacter asburiae and Enterobacter kobei, Syst. Appl. Microbiol. 28 (3) (2005) 196e205. [5] Harald Hoffmann, Andreas Roggenkamp, Population genetics of the
M. Akbari et al. / Microbial Pathogenesis 98 (2016) 112e117
[6]
[7]
[8]
[9]
[10]
[11]
nomenspecies Enterobacter cloacae, Appl. Environ. Microbiol. 69 (9) (2003) 5306e5318. Morten S. Dueholm, Mads Albertsen, Daniel Otzen, Per Halkjær Nielsen, Curli functional amyloid systems are phylogenetically widespread and display large diversity in operon and protein structure, PLoS One 7 (12) (2012) e51274. rie Sivadon-Tardy, Philippe C. Morand, Annick Billoet, Martin Rottman, Vale Luc Eyrolle, Luc Jeanne, Asmaa Tazi, Philippe Anract, Jean-Pierre Courpied, Claire Poyart, Specific distribution within the Enterobacter cloacae complex of strains isolated from infected orthopedic implants, J. Clin. Microbiol. 47 (8) (2009) 2489e2495. Majid Akbari, Bita Bakhshi, Shahin Najar Peerayeh, Particular distribution of Enterobacter cloacae strains isolated from urinary tract infection within clonal complexes, Iran. Biomed. J. 20 (1) (2016) 49. M. Ribot Efrain, M.A. Fair, R. Gautom, D.N. Cameron, S.B. Hunter, B. Swaminathan, J. Barrett Timothy, Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157: H7, Salmonella, and Shigella for PulseNet, Food. Pathogens Dis. 3 (1) (2006) 59e67. F.C. Tenover, R.D. Arbeit, R.V. Goering, P.A. Mickelsen, B.E. Murray, D.H. Persing, B. Swaminathan, Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing, J. Clin. Microbiol. 33 (9) (1995) 2233e2239. A. Kremer, H. Hoffmann, Prevalences of the Enterobacter cloacae complex and
[12]
[13]
[14]
[15]
[16]
[17]
117
its phylogenetic derivatives in the nosocomial environment, Eur. J. Clin. Microbiol. Infect. Dis. 31 (11) (2012) 2951e2955. n, Staffan Normark, sS-dependent growth-phase Anna Arnqvist, Arne Olse induction of the csgBA promoter in Escherichia coli can be achieved in vivo by s70 in the absence of the nucleoid-associated protein H-NS, Mol. Microbiol. 13 (6) (1994) 1021e1032. S.M. Kim, H.W. Lee, Y.W. Choi, S.H. Kim, J.C. Lee, Y.C. Lee, S.Y. Seol, D.T. Cho, J. Kim, Involvement of curli fimbriae in the biofilm formation of Enterobacter cloacae, J. Microbiol. 50 (1) (2012) 175e178. €mling, Production of Xhavit Zogaj, Werner Bokranz, Manfred Nimtz, Ute Ro cellulose and curli fimbriae by members of the family Enterobacteriaceae isolated from the human gastrointestinal tract, Infect. Immun. 71 (7) (2003) 4151e4158. G.A. Uhlich, J.E. Keen, R.O. Elder, Variations in the csgD promoter of Escherichia coli O157:H7 associated with increased virulence in mice and increased invasion of HEp-2 cells, Infect. Immun. 70 (1) (2002) 395e399. A. Uhlich Gaylen, E. Keen James, O. Elder Robert, Mutations in the csgD promoter associated with variations in curli expression in certain strains of Escherichia coli O157: H7, Appl. Environ. Microbiol. 67 (5) (2001) 2367e2370. N.T. Chirwa, M.B. Herrington, CsgD, a regulator of curli and cellulose synthesis, also regulates serine hydroxymethyltransferase synthesis in Escherichia coli K12, Microbiology 149 (Pt 2) (2003) 525e535.
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
The curli biogenesis genes expression level is unassociated with Enterobacter cloacae hsp60 clusters and PFGE genotypes Majid Akbari a, Bita Bakhshi a, *, Shahin Najar-Peerayeh a, Mehrdad Behmanesh b a b
Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran Department of Genetics, Faculty of Biological Sciences, Tarbiat Modares University, Tehran, Iran
a r t i c l e i n f o
a b s t r a c t
Article history: Received 13 April 2016 Received in revised form 16 June 2016 Accepted 24 June 2016 Available online 25 June 2016
The objective of this study was to determine the correlation between Enterobacter cloacae complex subspecies and clusters involved in UTI infections and specific pulsotypes, and to assess the contribution of major curli biogenesis genes (csgD, csgA) expression level to pathogenesis of clusters and genotypes. Based on the PFGE analysis, 37 different profiles were observed among which 8 profiles were common types. Real time PCR of csgD and csgA genes of 50 E. cloacae complex in relation to PFGE and hsp60 genotypes showed that all the genetic clusters are not equally involved in pathogenesis of urinary tract infections. It was elucidated in this study that isolates with common PFGE genotypes belonged to identical hsp60 clusters, and the foremost clusters (VI, III, and V) mainly comprised within PFGE common types. In our study, no significant correlation was detected between the specific hsp60 clusters or PFGE genotypes and the expression level of csgD and csgA genes (P-value > 0.05). This is the first study describing that unequivalent contribution of E. cloacae genotypes and clusters in pathogenesis of UTI, is not owing to varied curli biogenesis expression potential. The PFGE genotyping showed more discriminatory power than hsp60 genotyping for epidemiological studies and source tracking purpose. © 2016 Published by Elsevier Ltd.
Keywords: Enterobacter cloacae hsp60 Curli PFGE Real time-PCR
1. Introduction Only few bacterial phyla are as adaptable as the nomenspecies Enterobacter cloacae. In addition to being ubiquitous in land and aquatic environments, it is part of the commensal gut microbiota and has a key role as a pathogen for plants, insects, and humans [1]. E. cloacae is progressively identified as one of the ten most frequent species causing hospital-acquired wound, urinary tract infections, pneumonia, and sepsis in intensive care units. But what clinical microbiologists identify as E. cloacae, relies on biochemical properties as well as sequencing of a fragment of hsp60, which represents a large complex of at least 13 different species, subspecies, and genotypes [2e5]. Special names are ascribed to a number of genetic clusters; nine of which correspond to species: Enterobacter asburiae (Cluster I), Enterobacter kobei (Cluster II), Enterobacter ludwigii (Cluster V), Enterobacter hormaechei subsp. oharae (Cluster VI), E. hormaechei
* Corresponding author. Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Jalal-Ale-Ahmad Ave, Tehran, 14117-13116, Iran. E-mail address: [email protected] (B. Bakhshi). http://dx.doi.org/10.1016/j.micpath.2016.06.030 0882-4010/© 2016 Published by Elsevier Ltd.
subsp. hormaechei (Cluster VII), E. hormaechei subsp. steigerwallti (Cluster VIII), Enterobacter nimipressuralis (Cluster X), E. cloacae subsp. cloacae (Cluster XI), E. cloacae subsp. dissolvens (Cluster XII) and E. cloacae sequence crowd (Cluster xiii); whereas four clusters do not have special names and referred to as E. cloacae Cluster III, E. cloacae Cluster IV, E. cloacae Cluster IX and Cluster XIII [6]. The genotypic together with phenotypic differences between subspecies and clusters is a topic that still needs to be explored. In recent years, genotypic methods have been developed to extend the discriminatory power of epidemiological investigations. Sensitive and reproducible molecular markers have been applied successfully to the E. cloacae complex, among which PFGE is considered to be the gold standard [7]. The pathogenesis of E. cloacae relies mainly on the ability to express and produce curli fimbria which is involved in cell accumulation, adherence to surfaces, and biofilm formation. An extremely controlled pathway involving 2 divergently expressed operons is crucial for curli biogenesis. The csgBAC operon encodes the most important curli subunit, CsgA, and its homolog CsgB. The csgDEFG operon encodes CsgD, a transcriptional activator of the csgBAC operon, along with CsgE and CsgF that act as chaperones
M. Akbari et al. / Microbial Pathogenesis 98 (2016) 112e117
113
Table 1 Primers used in this study. Primer
Sequence (5e3)
Target
PCR product (bp)
Ref.
F-hsp60 R-hsp60 F-csgA R-csgA F-csgD R-csgD F-rpoB R-rpoB
GGTAGAAGAAGGCGTGGTTGC ATGCATTCGGTGGTGATCATCAG ATTGCAGCAATCGTAGTTTCTGG ATWGAYCTGTCATCAGAGCCCTGG TGAAARYTGGCCGCATATCAATGG ACGCCTGAGGTTATCGTTTGCC GTAYGCACAGACNAACGAATAYGG GAACGGGATCAGGGACGCAC
hsp60
341
[5]
csgA
245
This study
csgD
355
This study
rpoB
280
This study
Table 2 Genetic clusters of the E. cloacae complex under study. Strains name
Cluster
Number of isolates
E. Asburiae E. Kobei E. Cloacae III E. lodwigii E. hormaechei subsp. oharae E. hormaechei subsp. hormaechei E. hormaechei subsp. Steigerwaltii E. cloacae subsp. cloacae Total
I II III V VI VII VIII XI 8
2 1 9 4 25 1 6 2 50
needed for efficient curli construction [5,6]. The objective of this research was to determine the correlation between E. cloacae complex subspecies and clusters involved in UTI infections and specific genotypes, and to assess the contribution of major curli biogenesis genes (csgD, csgA) expression level to pathogenesis of clusters and genotypes causing urinary tract infections in Tehran I.R. Iran. 2. Materials and methods 2.1. Bacterial strains and epidemiological data Fifty E. cloacae isolates were included from urine cultures of inpatients suffering from urinary tract infection, admitted to six major hospitals in Tehran, Iran during Dec 2012 to Nov 2013. The overall rate of E. cloacae isolation from the total UTIs was about 7%. The isolates were identified as E. cloacae by routine phenotypic identification systems (the API 20E; BioMerieux, France). The identity of isolates was previously confirmed by partial sequencing of the hsp60 gene [8]. Two E. cloacae (PTCC 1003 and PTCC 1798), kindly provided by IROST (Iranian Research Organization for Science and Technology), were used as positive controls. Phylogenetic and molecular evolutionary analyses based on the hsp60 sequences were conducted using MEGA software version 6, and the isolates were assigned to E. cloacae subspecies and clusters according to the criteria introduced by Haffman and colleagues [5]. 2.2. Genomic DNA preparation and PFGE PulseNet standardized protocol was used for subtyping of Enterobacter spp [9]. In brief, the plate cultures of bacteria were suspended in a cell suspension buffer (100 mmol L1 Tris, 100 mmol L1 EDTA, pH 8.0) and adjusted to absorbance values of 0.8e1.0 at a wavelength of 610 nm. Cell suspensions were used for preparation of agarose plugs using SeaKem Gold agarose (Lonza, Rockland, ME, USA) and proteinase K. A lysis solution consisting of 50 mmol L1 Tris, 50 mmol L1 EDTA (pH 8.0), 1% sarcosine, and 0.5 mg proteinase K, was used for treatment of agarose plugs at 54 C for 1 h. After
washing steps, twice with sterile ultrapure water and four times with TE buffer (10 mmol L1 Tris, 1 mmol L1 EDTA, pH 8.0), 40 units of XbaI restriction enzyme (Roche Diagnostic, Mannheim, Germany) was used for digestion of plugs with embedded DNA. DNA molecular weight size marker was prepared by XbaI digestion of Salmonella enterica serotype Braenderup H9812 plugs. CHEF Mapper XA System (Bio-Rad) was applied for electrophoresis with 200 V at 14 C for 18 h with the increasing pulsed time from 2.16 to 54.17 s. PFGE patterns were analyzed by Gel Compare II software version 4.0 (Applied Maths, Sint-Martens-Latem, Belgium), and the patterns were compared by using the Dice coefficient and unweighted pair group method with arithmetic averages (UPGMA) clustering. A dendrogram was constructed using an optimization value of 0.50% and a position tolerance of 1.0%. 2.3. RNA preparations of Enterobacter cloacae complex and cDNA synthesis Total RNA was isolated using the CinnaPure-RNA Kits (CinnaPure RNA Extraction, SinaClon BioScience, IR, Iran) according to manufacturer instruction and treated with 10 U DNase I (Takara Biotechnology) for 30 min at 37 C to eliminate genomic DNA (gDNA) contamination and then heat-inactivated at 80 C for 2 min before reverse transcription. For first-strand cDNA synthesis, the reverse transcription reaction contained 5 mg of treated RNA, 100 pmol (0.2 ml) hexamer primer, DEPC-treated water up to 12.5 ml. The mixture blended gently, centrifuged briefly and incubated at 65 C for 5 min. The 10 Buffer (2 ml), 10 mM dNTP, 200 U (1 ml) Revert Aid M-MLV reverse transcriptase (SinaClon BioScience) in a final volume of 20 ml was prepared and the mixture was incubated at 42 C for 1 h and the reaction was heat-inactivated at 70 C for 10 min. 2.4. Real-time PCR Oligo Primer Analysis software version 7 (Molecular Biology Insights, Inc., Cascade, CO, USA) was used to design the oligonucleotide primers for selected genes (Table 1). Accordingly, all available sequences in the GenBank database were downloaded and used for analysis. Reactions were set up in a total volume of 20 ml using 1 ml of cDNA, 2 ml 5X Hot FirePol EvaGreen qPCR Mix Plus (ROX) (Solis BioDyne), 0.3 ml each of gene-specific primer (Table 1), and 15.8 ml D.W. The reaction was performed by Applied Biosystems StepOne Real Time PCR Systems. The cycling conditions were as follows: 95 C for 15 min; 40 cycles of 95 C for 15 s, 60 C for 15 s, and 72 C for 15 s with a single fluorescence measurement; and a final elongation step at 72 C for 5 min. Specificity of the PCR products was confirmed by the analysis of the dissociation curve. In this study, quantitative expression of csgD and csgA genes by relative method was determined. Real-Time PCR experiments were performed in duplicate for each sample and the average amount of Ct of target genes (csgD and csgA) from the average amount of Ct of
114
M. Akbari et al. / Microbial Pathogenesis 98 (2016) 112e117
Fig. 1. Dendrogram was drawn based on PFGE patterns of 50 Enterobacter cloacae isolates from UTI in accordance with their clusters obtained through hsp60 sequencing. The distribution of isolates within each hospital is as follows: Hospital 1:16 isolates (32%), Hospital 2:8 isolates (16%), Hospital 3:3 isolates (6%), Hospital 4:2 isolates (4%), Hospital 5:5 isolates (10%), Hospital 6:16 isolates (32%).
normalizer gene (rpoB) deducted, and DCt mean of every target gene in isolates calculated. In this study, isolates of Cluster VI (E. hormaechei subsp. Oharae) were considered as index group, and DCt mean of csgD and csgA genes of other clusters were compared with this one relatively by SPSS software ver.16 and by t-test, and P value was calculated for each cluster and gene individually.
E. cloacae complex (Table 2). Thirty-two (64%) of the isolates belonged to 3 E. hormaechei taxon. As explained, E. hormaechei was the foremost eminent species of our study collection with the best clinical relevance in UTI. A full description of isolates under study is depicted in Table 2. 3.2. Pulsed-field gel electrophoresis
3. Results 3.1. Isolates and related hsp60 clusters classification Previously determined partial hsp60 sequences indicated that the study isolates were classified into several genetic clusters of
PFGE, after XbaI digestion, generated fingerprints of seven to twelve bands per isolate (Fig. 1). Following the criteria of Tenover et al. (1995) [10], isolates belong to an equivalent clone, if PFGE patterns differ with fewer than two restriction sites. Accordingly, PFGE analysis revealed 37 different profiles (Fig. 1) within the 50
M. Akbari et al. / Microbial Pathogenesis 98 (2016) 112e117
115
Diagram 1. View of csgD gene experssion in 50 Enterobacter cloacae complex base on DCt in relation to their hsp60 clusters.
Diagram 2. View of csgA gene experssion in 50 Enterobacter cloacae complex base on DCt in relation to their hsp60 clusters.
E. cloacae complex isolates, among which eight were common types, while others were presented as single types. Common types A and C, each contained four strains, and clonal type B with 3 strains were the commonest types. Additionally, clonal types D, E, F, G and H each consisted of two strains. A majority of the isolates with identical pulsotypes were isolated from the same hospitals (clonal types E, F, G, H) but similar patterns were also observed between the first and sixth hospitals (clonal types B, C, D) and between the sixth and third hospitals (clonal types A and B). Twenty-nine strains (single types) made individual PFGE patterns
(Fig. 1), which indicated the absence of clonal correlation among the isolates. Similarity indices indicated <50e100% homogeneity among the most diverse and identical isolates respectively. Diversity index of population under study was calculated to be 0.98, which is indicative of a very diverse population. 3.3. Real-time PCR The expression level (DCt mean) of genes varied between 3.860504 and 11.345986 values for csgA and between
116
M. Akbari et al. / Microbial Pathogenesis 98 (2016) 112e117
Table 3 The Mean and Standard Deviation of csga and csgd genes. Clusters
I II III IV VI VII VIII XI p-valuea a
csgD
csgA
Mean
SD
Mean
SD
2.107 6.356 6.625 1.742 4.920 3.061 6.464 1.270 0.196
3.6 _ 4.846 0.416 3.630 _ 3.296 1.192
0.999 11.345 3.321 5.554 2.592 3.113 3.507 4.462 0.321
2.5 _ 5.061 3.230 2.863 _ 2.644 2.150
Kruskal Wallis test.
0.26816177 and 13.157816 values for csgD. The highest level of expression was seen in members of Clusters III and VI (for both genes) (Diagrams 1 and 2). Relative to Cluster VI (as the major cluster in E. cloacae cluster), DCt mean of csgD and csgA genes of other clusters, showed no significant difference between clusters (Minimum P-value csgA 0.070 & Minimum P-value csgD 0.095). This means that no measurable difference was detected in the expression value of csgD and csgA genes between clusters. Mean of DCt of csgA and csgD genes in each clusters is shown in Table 3.
4. Discussion Based on the hsp60 analysis, not all genetic clusters were equally involved in pathogenesis of urinary tract infections. This fact highlights the need for more accurate routine bacterial identification methods and a better understanding of the etiology of UTI and pathogenesis of the E. cloacae complex. Three superior clusters together represented more than two third (76%) of the study strains (Cluster VI with 23members; Cluster III and VIII with 9 and 6 members respectively). Other investigators from USA and France have shown that the E. hormaechei subsp. oharae (Cluster 6), E. cloacae)Cluster III(, and E. hormaechei subsp. steigerwaltii (Cluster VIII) were the species which most frequently recovered from clinical specimens [11]. This suggests that regardless of their geographical distributions these genotypes and clusters are more frequently involved in human pathogenesis. This raises the question of whether some clusters or genotypes are intrinsically more pathogenic than the others. In order to answer the question, the presence and expression level of genes involved in curli biogenesis (the most important virulence factor of Enterobacter spp.) was assessed. All of 50 studied Enterobacter cloacae complex isolates harbored csgA and csgD genes. Zogaj and colleagues in 2003 reported the presence of csg genes in the genus Enterobacter, Citrobacter, Klebsiella, while no gene expression was detected [12]. Although the changes in the csg genes expression was reported by Kim and colleagues (2011), but correlation between clusters and the value of gene expression was still unsolved [13]. Some mutational or recombinational events which may occur within the coding or regulatory sequences of curli biogenesis gene cluster can lead to inactive curli or its absence [14]. Moreover, increase in csgD activities, a transcriptional regulator belonging to the LuxR protein family, is associated with increase in expression of curli and increase in aggressiveness and virulence of bacteria [15e17]. In our study, no significant relevance was detected between specific clusters or genotypes and the level of csgD and csgA expression (P-value > 0.05). Moreover, the level of expression of csgA was not necessarily in coordination with that of csgD, which suggests that other regulatory factors other than csgD may affect
the expression of csgBAC operon. To our knowledge, no other study has explored the curli biogenesis gene expression within Enterobacter spp. In this study, PFGE analysis was conducted on fifty isolates of E. cloacae complex, all of which produced distinguishable banding patterns. PFGE, on the impact of XbaI restriction endonuclease, revealed fingerprints of seven to twelve bands with a high level of diversity (Di ¼ 0.98) in pulsotypes; Twenty-nine of which consisted of single types endorsing sporadic UTI cases caused by E. cloacae complex. In order to assess the correlation between hsp60 clusters and PFGE genotypes, the lack of clonality of isolates is of great significance. Among common types, members of CTA, C and D, were isolated from 2 major medical centers, and members of CTB were isolated from 3 medical centers, which rules out the probable clonality of isolates within common types. Each of the CTE, CTF, CTG, and CTH were composed of members isolated from a single hospital, however, the isolation date demonstrated a distance of at least 3 months, which confirms their independency. It was elucidated in this study that isolates with common PFGE genotypes belonged to identical hsp60 clusters, and the foremost clusters (VI, III, V) mainly comprised within common types. Moreover, there were many individual pulsotypes that fit in dominant hsp60 clusters, which may suggest that, i) the most common hsp60 clusters (with identical pulsotypes) may have increased circulation and consequently undergone more genetic changes through time and converted to diverse pulsotypes, ii) members of some clusters may have had the opportunity to more increasingly multiply and spread among clinical population and comprise common clusters probably due to increased pathogenic and competition potential. In conclusion, study on E. cloacae revealed that i) isolates from urinary infections belonging to common pulsotypes, had common hsp60 genetics clusters, and members of genetics Clusters VI and III had more capability for creating common types, ii) PFGE genotyping showed more discriminatory power than hsp60 genotyping, iii) the expression level of curli biogenesis genes and its positive regulator did not vary significantly between members of different hsp60 clusters, which rules out its role in unequivalent contribution of clusters in human pathogenesis. Conflict of interest There is no conflict of interest. Acknowledgements We thank the research council of Tarbiat Modares University for supporting the project. References [1] W.E. Sanders Jr., C.C. Sanders, Enterobacter spp.: pathogens poised to flourish at the turn of the century, Clin. Microbiol. Rev. 10 (2) (1997) 220e241. [2] H. Hoffmann, S. Stindl, W. Ludwig, A. Stumpf, A. Mehlen, D. Monget, D. Pierard, S. Ziesing, J. Heesemann, A. Roggenkamp, K.H. Schleifer, Enterobacter hormaechei subsp. oharae subsp. nov., E. hormaechei subsp. hormaechei comb. nov., and E. hormaechei subsp. steigerwaltii subsp. nov., three new subspecies of clinical importance, J. Clin. Microbiol. 43 (7) (2005) 297e303. [3] Harald Hoffmann, Sibylle Stindl, Anita Stumpf, Andre Mehlen, Daniel Monget, Jürgen Heesemann, Karl H. Schleifer, Andreas Roggenkamp, Description of Enterobacter ludwigii sp. nov., a novel Enterobacter species of clinical relevance, Syst. Appl. Microbiol. 28 (3) (2005) 206e212. [4] Harald Hoffmann, Sibylle Stindl, Wolfgang Ludwig, Anita Stumpf, Mehlen, Jürgen Heesemann, Daniel Monget, Karl H. Schleifer, Andre Andreas Roggenkamp, Reassignment of Enterobacter dissolvens to Enterobacter cloacae as E. cloacae subspecies dissolvens comb. nov. and emended description of Enterobacter asburiae and Enterobacter kobei, Syst. Appl. Microbiol. 28 (3) (2005) 196e205. [5] Harald Hoffmann, Andreas Roggenkamp, Population genetics of the
M. Akbari et al. / Microbial Pathogenesis 98 (2016) 112e117
[6]
[7]
[8]
[9]
[10]
[11]
nomenspecies Enterobacter cloacae, Appl. Environ. Microbiol. 69 (9) (2003) 5306e5318. Morten S. Dueholm, Mads Albertsen, Daniel Otzen, Per Halkjær Nielsen, Curli functional amyloid systems are phylogenetically widespread and display large diversity in operon and protein structure, PLoS One 7 (12) (2012) e51274. rie Sivadon-Tardy, Philippe C. Morand, Annick Billoet, Martin Rottman, Vale Luc Eyrolle, Luc Jeanne, Asmaa Tazi, Philippe Anract, Jean-Pierre Courpied, Claire Poyart, Specific distribution within the Enterobacter cloacae complex of strains isolated from infected orthopedic implants, J. Clin. Microbiol. 47 (8) (2009) 2489e2495. Majid Akbari, Bita Bakhshi, Shahin Najar Peerayeh, Particular distribution of Enterobacter cloacae strains isolated from urinary tract infection within clonal complexes, Iran. Biomed. J. 20 (1) (2016) 49. M. Ribot Efrain, M.A. Fair, R. Gautom, D.N. Cameron, S.B. Hunter, B. Swaminathan, J. Barrett Timothy, Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157: H7, Salmonella, and Shigella for PulseNet, Food. Pathogens Dis. 3 (1) (2006) 59e67. F.C. Tenover, R.D. Arbeit, R.V. Goering, P.A. Mickelsen, B.E. Murray, D.H. Persing, B. Swaminathan, Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing, J. Clin. Microbiol. 33 (9) (1995) 2233e2239. A. Kremer, H. Hoffmann, Prevalences of the Enterobacter cloacae complex and
[12]
[13]
[14]
[15]
[16]
[17]
117
its phylogenetic derivatives in the nosocomial environment, Eur. J. Clin. Microbiol. Infect. Dis. 31 (11) (2012) 2951e2955. n, Staffan Normark, sS-dependent growth-phase Anna Arnqvist, Arne Olse induction of the csgBA promoter in Escherichia coli can be achieved in vivo by s70 in the absence of the nucleoid-associated protein H-NS, Mol. Microbiol. 13 (6) (1994) 1021e1032. S.M. Kim, H.W. Lee, Y.W. Choi, S.H. Kim, J.C. Lee, Y.C. Lee, S.Y. Seol, D.T. Cho, J. Kim, Involvement of curli fimbriae in the biofilm formation of Enterobacter cloacae, J. Microbiol. 50 (1) (2012) 175e178. €mling, Production of Xhavit Zogaj, Werner Bokranz, Manfred Nimtz, Ute Ro cellulose and curli fimbriae by members of the family Enterobacteriaceae isolated from the human gastrointestinal tract, Infect. Immun. 71 (7) (2003) 4151e4158. G.A. Uhlich, J.E. Keen, R.O. Elder, Variations in the csgD promoter of Escherichia coli O157:H7 associated with increased virulence in mice and increased invasion of HEp-2 cells, Infect. Immun. 70 (1) (2002) 395e399. A. Uhlich Gaylen, E. Keen James, O. Elder Robert, Mutations in the csgD promoter associated with variations in curli expression in certain strains of Escherichia coli O157: H7, Appl. Environ. Microbiol. 67 (5) (2001) 2367e2370. N.T. Chirwa, M.B. Herrington, CsgD, a regulator of curli and cellulose synthesis, also regulates serine hydroxymethyltransferase synthesis in Escherichia coli K12, Microbiology 149 (Pt 2) (2003) 525e535.