- Email: [email protected]
The cyanobacterium Anabaena sp. PCC 7120 has two distinct β-carotene ketolases: CrtO for echinenone and CrtW for ketomyxol synthesis
FEBS 30070
FEBS Letters 579 (2005) 6111–6114
The cyanobacterium Anabaena sp. PCC 7120 has two distinct b-carotene ketolases: CrtO for echinenone and CrtW for ketomyxol synthesis Mari Mochimarua, Hajime Masukawab, Shinichi Takaichic,* b
a Natural Science Faculty, Komazawa University, Tokyo 154-8525, Japan Department of Biological Sciences, Kanagawa University, Hiratsuka 259-1293, Japan c Biological Laboratory, Nippon Medical School, Kawasaki 211-0063, Japan
Received 22 August 2005; revised 16 September 2005; accepted 21 September 2005 Available online 13 October 2005 Edited by Richard Cogdell
Abstract Two b-carotene ketolases, CrtW and CrtO, are widely distributed in bacteria, although they show no significant sequence homology with each other. The cyanobacterium Anabaena sp. PCC 7120 was found to have two homologous genes. In the crtW deleted mutant, myxol 2 0 -fucoside was present, but ketomyxol 2 0 -fucoside was absent. In the crtO deleted mutant, b-carotene was accumulated, and the amount of echinenone was decreased. Therefore, CrtW catalyzed myxol 2 0 -fucoside to ketomyxol 2 0 -fucoside, and CrtO catalyzed b-carotene to echinenone. This cyanobacterium was the first species found to have both enzymes, which functioned in two distinct biosynthetic pathways. 2005 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. Keywords: b-Carotene ketolase; Carotenoid; crtO; crtW; Cyanobacteria; Anabaena sp. PCC 7120
1. Introduction Anabaena (also known as Nostoc) sp. PCC 7120 is a filamentous and heterocystous cyanobacterium. It is the most commonly used cyanobacteria for genetic and physiological studies. Their cells can be manipulated by genetical techniques based on conjugative transformation, as developed by Wolk et al. [1,2], and its genome sequencing has already been completed [3]. We previously identified the molecular structures of carotenoids in Anabaena sp. PCC 7120 [4]. The myxoxanthophyll and ketomyxoxanthophyll are (3R,2 0 S)-myxol 2 0 -fucoside and (3S,2 0 S)-4-ketomyxol 2 0 -fucoside, respectively. The glycoside moiety of the pigments is fucose, not rhamnose. The major carotenoids are b-carotene and echinenone, and the minors are b-cryptoxanthin, zeaxanthin, canthaxanthin and 3 0 -hydroxyechinenone. We have also proposed the candidates of the carotenogenesis genes by sequence homology only from the functionally confirmed genes. Ketocarotenoids and glycosyl carotenoids in cyanobacteria are unique among phototrophic organisms, and are not observed in higher plants. Further, the biosynthetic pathways of these carotenoids have yet to be well characterized, and only four b-carotene ketolases have been functionally reported to * Corresponding author. Fax: +81 44 722 1231. E-mail address: [email protected] (S. Takaichi).
Abbreviations: HPLC, high performance liquid chromatography
date: CrtO in Synechocystis sp. PCC 6803 [5], two CrtWs in Nostoc punctiforme PCC 73102 [6], and recently CrtW in Gloeobacter violaceus PCC 7421 [7]. In the present study, we found two distinct b-carotene ketolase genes, crtW and crtO, in the genome sequence of Anabaena sp. PCC 7120. From disruption experiments of the genes, both had b-carotene ketolase activity, although their substrate specificities were different. This cyanobacterium was the first species found to have both enzymes, which functioned in two distinct biosynthetic pathways.
2. Materials and methods 2.1. Strains, growth conditions and carotenoid analysis Anabaena (also known as Nostoc) sp. PCC 7120 was grown photoautotrophically in BG-11 medium as described elsewhere [4]. Escherichia coli strains were maintained in Luria–Bertani medium at 37 C. E. coli strain XL1-Blue MRFÕ (Stratagene) was used for plasmid maintenance and strain HB101 containing pRL623 [8] as a conjugal donor. Antibiotics were added at the following concentrations (lg/ ml): for Anabaena mutants, erythromycin, 5; neomycin, 30; for E. coli strains, ampicillin, 100; chloramphenicol, 100; erythromycin, 100; and kanamycin, 50. The pigments were extracted using an acetone/methanol mixture (7:2 v/v) and analyzed by high performance liquid chromatography (HPLC) equipped with the lBondapak C18 column (8 · 100 mm, RCM type, Waters, USA) eluted with methanol/water (9:1, v/v) for 20 min and then 100% methanol (2.0 ml/min). The elution profiles and absorption spectra were monitored with an MCPD-3600 photodiode array detector (Otsuka Electronics, Japan). The relative molecular masses of the purified carotenoids were measured with an M-2500 double-focusing gas chromatograph-mass spectrometer (Hitachi, Japan) equipped with field-desorption apparatus [4]. 2.2. Construction of deleted mutants The construction of mutants by triparental mating [9,10] was performed as described elsewhere [11], unless otherwise indicated. The target genes for disruption were alr3189 (crtW) and all3744 (crtO). Sequence information regarding the genomic DNA in Anabaena sp. PCC 7120 was released from the Cyanobase database (http://www. kazusa.or.jp/cyanobase/). Genomic DNA was isolated from mutant cells by the glass bead method [12]. The two adjoining parts of the target genes (Fig. 1) were amplified by PCR using KOD-Plus-polymerase (Toyobo, Japan) and the primers described in Table 1. The PCR products, W-f1 and O-f2, were ligated into the EcoRV site of pBluescript II SK+ (Stratagene, USA), and W-f2 and O-f1 were ligated into the SmaI site in pUC19 [13]. A 1.1 kb BamHI fragment containing PpsbA-npt gene from pRL648 [8] was ligated into the BamHI site in the plasmid containing W-f2 or O-f1. A 2.2 kb fragment containing W-f2 and npt or O-f1and npt was excised with SacI and partially with XbaI and ligated into the SacI–XbaI sites in the plasmid containing W-f1 or O-f2. The fragment
0014-5793/$30.00 2005 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2005.09.081
6112
M. Mochimaru et al. / FEBS Letters 579 (2005) 6111–6114
Fig. 2. PCR confirmation of insertional mutants of (A) alr3189 (crtW) and (B) all3744 (crtO). The primer pairs, 3189-s1 and 3189-a2, and 3744-s1 and 3744-a2, were used in (A) and (B), respectively. The left lane, molecular marker; wt, wild type; M, mutant. Fig. 1. Construction of insertional mutants of alr3189, homologue of crtW (A) and all3744, homologue of crtO (B). Fragments of about 1 kb, named W-f1, W-f2, O-f1 and O-f2, containing a part of crtW or crtO, were amplified by PCR. A 1.1-kb npt gene was inserted between these two adjoining fragments.
containing W-f2, npt and W-f1 or O-f1, npt and O-f2 was excised with SacI and XhoI and ligated into the corresponding sites in pRL271 [14], a suicide vector for triparental mating. The insertion of the npt gene was confirmed by PCR (Fig. 2). The primer pairs, 3189-s1 and 3189-a2, and 3744-s1 and 3744-a2, were used for confirmation of the insertion into alr3189 and all3744, respectively.
3. Results 3.1. b-Carotene ketolase gene candidates in the genome sequence of Anabaena sp. PCC 7120 and confirmation of deleted mutants BLAST was used to search for b-carotene ketolase genes in the genome sequence of Anabaena sp. PCC 7120 [3]. Two genes that were homologous to the functionally identified genes were found [4]. One gene (alr3189) showed 55% and 57% identity and e-values of 1e79 and 1e91 on the amino acid level to CrtW38 and CrtW148 of Nostoc punctiforme PCC 73102, respectively [6]. Another (all3744) had 64% identity and an evalue of 0.0 on the amino acid level to CrtO (Slr0088 in Cyanobase) of Synechocystis sp. PCC 6803 [5]. To investigate the functions of the probable b-carotene ketolase genes in Anabaena sp. PCC 7120 described above, we constructed deleted mutants of alr3189 and all3744 by targeted
disruptions (Fig. 1). The insertional disruptions of alr3189 and all3744 were confirmed by PCR (Fig. 2). The PCR fragments containing each target gene from the mutants were about 1-kb longer than those from the wild type, indicating the insertion of the neomycin resistant cassette. The photoautotrophical growth of two deleted mutants were almost the same with that of the wild type. This indicates that deletion of the genes have not significant effects on the growth. 3.2. Carotenoids in deleted mutants We recently identified all the carotenoids in the wild type, and those in the deleted mutants were confirmed based on the retention times on HPLC, absorption spectrum in HPLC eluent, and relative molecular masses, as described elsewhere [4]. Fig. 3A shows the HPLC elution profile of the carotenoids in the wild type; they were b-carotene (41%, mol% to total carotenoids), echinenone (37%) and canthaxanthin (4%); and the carotenoid glycosides were myxol 2 0 -fucoside (7%) and ketomyxol 2 0 -fucoside (12%). In the alr3189 deleted mutant, ketomyxol 2 0 -fucoside was completely absent (Fig. 3B), while myxol 2 0 -fucoside (14%) was present. b-Carotene (53%), echinenone (32%) and canthaxanthin (1%) were also found. Therefore, Alr3189 (CrtW) catalyzes myxol 2 0 -fucoside to ketomyxol 2 0 -fucoside. In the all3744 deleted mutant, the content of echinenone was decreased to 3% and canthaxanthin was absent, while the content of b-carotene was increased to 85% (Fig. 3C). Both myxol 2 0 -fucoside (5%) and ketomyxol 2 0 -fucoside (7%) were present.
Table 1 Primers used for PCR Primer (pair)
PCR product
Nucleotide sequence (5 0 to 3 0 )
3189-s1 3189-s2 3744-s1 3744-s2
W-f1 W-f2 O-f1 O-f2
CCCTTGGTGGTGATAGCGAT and GGATCCAGGATGTCCGTGGTGTAAC ATCGATGTTACACCACGGACATCCTG and TGCAGATGGAGACGGTGATG GTCTCCCTTATTTTGTCTGGGAAG and ATCGATACTTACCCGCACACCAACG GGATCCGTTGGTGTGCGGGTAAGT and CGCCACAAGAACAGACGGA
and and and and
3189-a1 3189-a2 3744-a1 3744-a2
M. Mochimaru et al. / FEBS Letters 579 (2005) 6111–6114 0.35
6113 1.4
0.30
1.2
0.25
1.0
0.20
0.8
KM 0.15
M
0.6
C
(A) 0.10
0.4
Absorbance at 664 nm
Absorbance at 475 nm
Chl E
(B) 0.05
0.2
(C) 0.00
0.0 8
16
24
32
40
Retention time (min)
Fig. 3. HPLC elution profiles of pigments extracted from wild type (A), and crtW (B) and crtO (C) deleted mutants of Anabaena sp. PCC 7120. Eluent was methanol/water (9:1, v/v) from the first 20 min, and then 100% methanol (2.0 ml/min). Absorbance at 475 nm (solid line) and 664 nm (dashed line) are shown. KM, 4-ketomyxol 2 0 -fucoside; M, myxol 2 0 -fucoside; C, canthaxanthin; E, echinenone; b, b-carotene; Chl, chlorophyll a.
Therefore, All3744 (CrtO) catalyzes b-carotene to echinenone and canthaxanthin, and a small amount of echinenone found in the mutant might be produced by CrtW. These indicate that CrtW has ability to catalyze b-carotene to echinenone, but that it can not compensate the reaction in the cells.
4. Discussion In Anabaena sp. PCC 7120, two distinct b-carotene ketolase genes, one crtW-type (alr3189) and one crtO-type (all3744), were found from homology based on the genome base sequence [4]. In the present study, we investigated their functions from the deleted mutants. CrtW catalyzed myxol to ketomyxol, and CrtO catalyzed b-carotene to echinenone and canthaxanthin. Therefore, this bacterium has two b-carotene ketolases, whose substrate specificities are different, and they function in two distinct biosynthetic pathways. The total contents of b-carotene, echinenone and canthaxanthin were around 85% in both the wild type and the mutants, and those of myxol 2 0 -fucoside and ketomyxol 2 0 -fucoside were around 15%. This indicates that two b-carotene ketolases have no effect on the total contents of b-carotene and its derivatives, and of myxol and ketomyxol glycosides, and two pathways might be regulated in some ways. Further in cyanobacteria, carotenoid glycosides are known to be mainly located in outer membrane, while b-carotene and echinenone are mainly located in thylakoid membrane [15]. Therefore, carotenoid glycosides, and b-carotene and echinenone might be synthesized in different membranes, and CrtW and CrtO might be also located in different membranes, respectively. At present, only four b-carotene ketolases are functionally confirmed in cyanobacteria. In Synechocystis sp. PCC 6803,
CrtO (Slr0088) catalyzes b-carotene to echinenone [5], and ketomyxol glycoside is absent [16]. In Gloeobacter violaceus PCC 7421, CrtW (Gll1728) catalyzes b-carotene to echinenone, and (2S,2 0 S)-oscillol 2,2 0 -di(a-L -fucoside) is present but myxol glycoside is absent. This bacterium also has a crtO-like gene (gll0394), but it has no b-carotene ketolase activity [7]. Nostoc punctiforme PCC 73102 has two b-carotene ketolases, CrtW38 (NpF5919: previous number, ORF501-5948 and ORF501-38) and CrtW148 (NpF4798: previous number, ORF502-6170 and ORF502-148) [6], and both ketomyxol 2 0 -fucoside and echinenone are present [4]. Although their functions in the cells were not reported, based on the substrate specificity in [6], CrtW38 might catalyze b-carotene to echinenone since its substrate is only b-carotene, and CrtW148 might catalyze myxol 2 0 -fucoside to ketomyxol 2 0 -fucoside since its substrate is both b-carotene and zeaxanthin [4]. In total in cyanobacteria, the reaction from myxol 2 0 -fucoside to ketomyxol 2 0 -fucoside is catalyzed by CrtW in two species, while that from b-carotene to echinenone is catalyzed by CrtW in two species and by CrtO in two species. Anabaena sp. PCC 7120 was the first species found to have both enzymes. In addition, it is interesting how cyanobacteria obtain both or either b-carotene ketolases and how to use them properly. Two b-carotene ketolases are also widely distributed in bacteria and green algae in addition to cyanobacteria. CrtW and CrtO, whose functions have been confirmed, have been found in five and two species, respectively [17]. Even though the reactions of both CrtW and CrtO involve the same b-carotene ketolation, the characteristics of enzymes are different. The CrtO enzymes are almost twice the size of the CrtW enzymes and do not share significant amino acid sequence homology with CrtW. The substrate specificities of CrtW are only the b-end group (b-carotene) in three species and both the b-end and 3-hydroxy-b-end (zeaxanthin and myxol) groups in six species. That of CrtO is only the b-end group (b-carotene and c-carotene) in four species. CrtW has iron-binding motifs [6], while CrtO has six conserved regions including the FADbinding motif [17]. Two b-carotene ketolases might have evolved convergently from different ancestors to acquire the same functions, so further studies are needed. b-Carotene hydroxylase (CrtR) in Synechocystis sp. PCC 6803 catalyzes both b-carotene to zeaxanthin via b-cryptoxanthin, deoxymyxol 2 0 -glycoside to myxol 2 0 -glycoside, and echinenone to 3 0 -hydroxyechinenone [17,18]. This indicates that the substrate specificities of CrtR do not depend on the opposite side of the carotenoids, while those of CrtW and CrtO are so dependent. Acknowledgments: We thank Dr. C.P. Wolk of Michigan State University for the gift of the suicide vectors, and Dr. H. Sakurai of Waseda University for his help to construct the mutants. This work was supported in part by Grants-in-Aid for Scientific Research from JSPS to S.T. (No. 16570038).
References [1] Wolk, C.P., Ernst, A. and Elhai, J. (1994) Heterocyst metabolism and deveopment in: The Molecular Biology of Cyanobacteria (Bryant, D.A., Ed.), pp. 769–823, Kluwer Academic Publishers, Dordrecht. [2] Cohen, M.F., Meeks, J.C., Cai, Y.A. and Wolk, C.P. (1998) Transposon mutagenesis of heterocyst-forming filamentous cyanobacteria. Methods Enzymol. 297, 3–17.
6114 [3] Kaneko, T., Nakamura, Y., Wolk, C.P., Kuritz, T., Sasamoto, S., Watanabe, A., Iriguchi, M., Ishikawa, A., Kawashima, K., Kimura, T., Kishida, Y., Kohara, M., Matsumoto, M., Matsuno, A., Muraki, A., Nakazaki, N., Shimpo, S., Sugimoto, M., Takazawa, M., Yamada, M., Yasuda, M. and Tabata, S. (2001) Complete genomic sequence of the filamentous nitrogen-fixing cyanobacterium Anabaena sp. strain PCC 7120. DNA Res. 8, 205–213. [4] Takaichi, S., Mochimaru, M., Maoka, T. and Katoh, H. (2005) Myxol and 4-ketomyxol 2 0 -fucosides, not rhamnosides, from Anabaena sp. PCC 7120 and Nostoc punctiforme PCC 73102, and proposal for the biosynthetic pathway of carotenoids. Plant Cell Physiol. 46, 497–504. [5] Ferna´ndez-Gonza´lez, B., Sandmann, G. and Vioque, A. (1997) A new type of asymmetrically acting b-carotene ketolase is required for the synthesis of echinenone in the cyanobacterium Synechocystis sp. PCC 6803. J. Biol. Chem. 272, 9728–9733. [6] Steiger, S. and Sandmann, G. (2004) Cloning of two carotenoid ketolase genes from Nostoc punctiforme for the heterologous production of canthaxanthin and astaxanthin. Biotechnol. Lett. 26, 813–817. [7] Tsuchiya, T., Takaichi, S., Misawa, N., Maoka, T., Miyashita, H. and Mimuro, M. (2005) The cyanobacterium Gloeobacter violaceus PCC 7421 uses bacterial-type phytoene desaturase in carotenoid biosynthesis. FEBS Lett. 579, 2125–2129. [8] Elhai, J., Vepritskiy, A., Muro-Pastor, A.M., Flores, E. and Wolk, C.P. (1997) Reduction of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain PCC 7120. J. Bacteriol. 179, 1998–2005. [9] Elhai, J. and Work, C.P. (1988) A versatile class of positiveselection vectors based on the nonviability of palindrome-
M. Mochimaru et al. / FEBS Letters 579 (2005) 6111–6114
[10] [11]
[12]
[13] [14] [15] [16]
[17] [18]
containing plasmids that allows cloning into long polylinkers. Gene 68, 119–138. Thiel, T. and Wolk, C.P. (1987) Conjugal transfer of plasmids to cyanobacteria. Methods Enzymol. 153, 232–243. Masukawa, H., Mochimaru, M. and Sakurai, H. (2002) Disruption of the uptake hydrogenase gene, but not of the bidirectional hydrogenase gene, leads to enhanced photobiological hydrogen production by the nitrogen-fixing cyanobacterium Anabaena sp. PCC 7120. Appl. Microbial. Biotechnol. 58, 618–624. Tamagnini, P., Troshina, O., Oxelfelt, F., Salema, R. and Lindblad, P. (1997) Hydrogenases in Nostoc sp. PCC 73102, a strain lacking a bidirectional enzyme. Appl. Environ. Microbiol. 63, 1801–1807. Yanisch-Perron, C., Vieira, J. and Messing, J. (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103–119. Black, T.A., Cai, Y. and Wolk, C.P. (1993) Spatial expression and autoregulation of hetR, a gene involved in the control of heterocyst development in Anabaena. Mol. Microbiol. 9, 77–84. Omata, T. and Murata, N. (1984) Isolation and characterization of three types of membranes from the cyanobacterium (blue-green alga) Synechocystis PCC 6714. Arch. Microbiol. 139, 113–116. Takaichi, S., Maoka, T. and Masamoto, K. (2001) Myxoxanthophyll in Synechocystis sp. PCC 6803 is myxol 2 0 -dimethylfucoside, (3R,2 0 S)-myxol 2 0 -(2,4-di-O-methyl-a-L -fucoside), not rhamnoside. Plant Cell Physiol. 42, 756–762. Tao, L. and Cheng, Q. (2004) Novel b-carotene ketolases from non-photosynthetic bacteria for canthaxanthin synthesis. Mol. Genet. Genomics 272, 530–537. Masamoto, K., Misawa, N., Kaneko, T., Kikuno, R. and Toh, H. (1998) b-Carotene hydroxylase gene from the cyanobacterium Synechocystis sp. PCC6803. Plant Cell Physiol. 39, 560–564.
FEBS Letters 579 (2005) 6111–6114
The cyanobacterium Anabaena sp. PCC 7120 has two distinct b-carotene ketolases: CrtO for echinenone and CrtW for ketomyxol synthesis Mari Mochimarua, Hajime Masukawab, Shinichi Takaichic,* b
a Natural Science Faculty, Komazawa University, Tokyo 154-8525, Japan Department of Biological Sciences, Kanagawa University, Hiratsuka 259-1293, Japan c Biological Laboratory, Nippon Medical School, Kawasaki 211-0063, Japan
Received 22 August 2005; revised 16 September 2005; accepted 21 September 2005 Available online 13 October 2005 Edited by Richard Cogdell
Abstract Two b-carotene ketolases, CrtW and CrtO, are widely distributed in bacteria, although they show no significant sequence homology with each other. The cyanobacterium Anabaena sp. PCC 7120 was found to have two homologous genes. In the crtW deleted mutant, myxol 2 0 -fucoside was present, but ketomyxol 2 0 -fucoside was absent. In the crtO deleted mutant, b-carotene was accumulated, and the amount of echinenone was decreased. Therefore, CrtW catalyzed myxol 2 0 -fucoside to ketomyxol 2 0 -fucoside, and CrtO catalyzed b-carotene to echinenone. This cyanobacterium was the first species found to have both enzymes, which functioned in two distinct biosynthetic pathways. 2005 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. Keywords: b-Carotene ketolase; Carotenoid; crtO; crtW; Cyanobacteria; Anabaena sp. PCC 7120
1. Introduction Anabaena (also known as Nostoc) sp. PCC 7120 is a filamentous and heterocystous cyanobacterium. It is the most commonly used cyanobacteria for genetic and physiological studies. Their cells can be manipulated by genetical techniques based on conjugative transformation, as developed by Wolk et al. [1,2], and its genome sequencing has already been completed [3]. We previously identified the molecular structures of carotenoids in Anabaena sp. PCC 7120 [4]. The myxoxanthophyll and ketomyxoxanthophyll are (3R,2 0 S)-myxol 2 0 -fucoside and (3S,2 0 S)-4-ketomyxol 2 0 -fucoside, respectively. The glycoside moiety of the pigments is fucose, not rhamnose. The major carotenoids are b-carotene and echinenone, and the minors are b-cryptoxanthin, zeaxanthin, canthaxanthin and 3 0 -hydroxyechinenone. We have also proposed the candidates of the carotenogenesis genes by sequence homology only from the functionally confirmed genes. Ketocarotenoids and glycosyl carotenoids in cyanobacteria are unique among phototrophic organisms, and are not observed in higher plants. Further, the biosynthetic pathways of these carotenoids have yet to be well characterized, and only four b-carotene ketolases have been functionally reported to * Corresponding author. Fax: +81 44 722 1231. E-mail address: [email protected] (S. Takaichi).
Abbreviations: HPLC, high performance liquid chromatography
date: CrtO in Synechocystis sp. PCC 6803 [5], two CrtWs in Nostoc punctiforme PCC 73102 [6], and recently CrtW in Gloeobacter violaceus PCC 7421 [7]. In the present study, we found two distinct b-carotene ketolase genes, crtW and crtO, in the genome sequence of Anabaena sp. PCC 7120. From disruption experiments of the genes, both had b-carotene ketolase activity, although their substrate specificities were different. This cyanobacterium was the first species found to have both enzymes, which functioned in two distinct biosynthetic pathways.
2. Materials and methods 2.1. Strains, growth conditions and carotenoid analysis Anabaena (also known as Nostoc) sp. PCC 7120 was grown photoautotrophically in BG-11 medium as described elsewhere [4]. Escherichia coli strains were maintained in Luria–Bertani medium at 37 C. E. coli strain XL1-Blue MRFÕ (Stratagene) was used for plasmid maintenance and strain HB101 containing pRL623 [8] as a conjugal donor. Antibiotics were added at the following concentrations (lg/ ml): for Anabaena mutants, erythromycin, 5; neomycin, 30; for E. coli strains, ampicillin, 100; chloramphenicol, 100; erythromycin, 100; and kanamycin, 50. The pigments were extracted using an acetone/methanol mixture (7:2 v/v) and analyzed by high performance liquid chromatography (HPLC) equipped with the lBondapak C18 column (8 · 100 mm, RCM type, Waters, USA) eluted with methanol/water (9:1, v/v) for 20 min and then 100% methanol (2.0 ml/min). The elution profiles and absorption spectra were monitored with an MCPD-3600 photodiode array detector (Otsuka Electronics, Japan). The relative molecular masses of the purified carotenoids were measured with an M-2500 double-focusing gas chromatograph-mass spectrometer (Hitachi, Japan) equipped with field-desorption apparatus [4]. 2.2. Construction of deleted mutants The construction of mutants by triparental mating [9,10] was performed as described elsewhere [11], unless otherwise indicated. The target genes for disruption were alr3189 (crtW) and all3744 (crtO). Sequence information regarding the genomic DNA in Anabaena sp. PCC 7120 was released from the Cyanobase database (http://www. kazusa.or.jp/cyanobase/). Genomic DNA was isolated from mutant cells by the glass bead method [12]. The two adjoining parts of the target genes (Fig. 1) were amplified by PCR using KOD-Plus-polymerase (Toyobo, Japan) and the primers described in Table 1. The PCR products, W-f1 and O-f2, were ligated into the EcoRV site of pBluescript II SK+ (Stratagene, USA), and W-f2 and O-f1 were ligated into the SmaI site in pUC19 [13]. A 1.1 kb BamHI fragment containing PpsbA-npt gene from pRL648 [8] was ligated into the BamHI site in the plasmid containing W-f2 or O-f1. A 2.2 kb fragment containing W-f2 and npt or O-f1and npt was excised with SacI and partially with XbaI and ligated into the SacI–XbaI sites in the plasmid containing W-f1 or O-f2. The fragment
0014-5793/$30.00 2005 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2005.09.081
6112
M. Mochimaru et al. / FEBS Letters 579 (2005) 6111–6114
Fig. 2. PCR confirmation of insertional mutants of (A) alr3189 (crtW) and (B) all3744 (crtO). The primer pairs, 3189-s1 and 3189-a2, and 3744-s1 and 3744-a2, were used in (A) and (B), respectively. The left lane, molecular marker; wt, wild type; M, mutant. Fig. 1. Construction of insertional mutants of alr3189, homologue of crtW (A) and all3744, homologue of crtO (B). Fragments of about 1 kb, named W-f1, W-f2, O-f1 and O-f2, containing a part of crtW or crtO, were amplified by PCR. A 1.1-kb npt gene was inserted between these two adjoining fragments.
containing W-f2, npt and W-f1 or O-f1, npt and O-f2 was excised with SacI and XhoI and ligated into the corresponding sites in pRL271 [14], a suicide vector for triparental mating. The insertion of the npt gene was confirmed by PCR (Fig. 2). The primer pairs, 3189-s1 and 3189-a2, and 3744-s1 and 3744-a2, were used for confirmation of the insertion into alr3189 and all3744, respectively.
3. Results 3.1. b-Carotene ketolase gene candidates in the genome sequence of Anabaena sp. PCC 7120 and confirmation of deleted mutants BLAST was used to search for b-carotene ketolase genes in the genome sequence of Anabaena sp. PCC 7120 [3]. Two genes that were homologous to the functionally identified genes were found [4]. One gene (alr3189) showed 55% and 57% identity and e-values of 1e79 and 1e91 on the amino acid level to CrtW38 and CrtW148 of Nostoc punctiforme PCC 73102, respectively [6]. Another (all3744) had 64% identity and an evalue of 0.0 on the amino acid level to CrtO (Slr0088 in Cyanobase) of Synechocystis sp. PCC 6803 [5]. To investigate the functions of the probable b-carotene ketolase genes in Anabaena sp. PCC 7120 described above, we constructed deleted mutants of alr3189 and all3744 by targeted
disruptions (Fig. 1). The insertional disruptions of alr3189 and all3744 were confirmed by PCR (Fig. 2). The PCR fragments containing each target gene from the mutants were about 1-kb longer than those from the wild type, indicating the insertion of the neomycin resistant cassette. The photoautotrophical growth of two deleted mutants were almost the same with that of the wild type. This indicates that deletion of the genes have not significant effects on the growth. 3.2. Carotenoids in deleted mutants We recently identified all the carotenoids in the wild type, and those in the deleted mutants were confirmed based on the retention times on HPLC, absorption spectrum in HPLC eluent, and relative molecular masses, as described elsewhere [4]. Fig. 3A shows the HPLC elution profile of the carotenoids in the wild type; they were b-carotene (41%, mol% to total carotenoids), echinenone (37%) and canthaxanthin (4%); and the carotenoid glycosides were myxol 2 0 -fucoside (7%) and ketomyxol 2 0 -fucoside (12%). In the alr3189 deleted mutant, ketomyxol 2 0 -fucoside was completely absent (Fig. 3B), while myxol 2 0 -fucoside (14%) was present. b-Carotene (53%), echinenone (32%) and canthaxanthin (1%) were also found. Therefore, Alr3189 (CrtW) catalyzes myxol 2 0 -fucoside to ketomyxol 2 0 -fucoside. In the all3744 deleted mutant, the content of echinenone was decreased to 3% and canthaxanthin was absent, while the content of b-carotene was increased to 85% (Fig. 3C). Both myxol 2 0 -fucoside (5%) and ketomyxol 2 0 -fucoside (7%) were present.
Table 1 Primers used for PCR Primer (pair)
PCR product
Nucleotide sequence (5 0 to 3 0 )
3189-s1 3189-s2 3744-s1 3744-s2
W-f1 W-f2 O-f1 O-f2
CCCTTGGTGGTGATAGCGAT and GGATCCAGGATGTCCGTGGTGTAAC ATCGATGTTACACCACGGACATCCTG and TGCAGATGGAGACGGTGATG GTCTCCCTTATTTTGTCTGGGAAG and ATCGATACTTACCCGCACACCAACG GGATCCGTTGGTGTGCGGGTAAGT and CGCCACAAGAACAGACGGA
and and and and
3189-a1 3189-a2 3744-a1 3744-a2
M. Mochimaru et al. / FEBS Letters 579 (2005) 6111–6114 0.35
6113 1.4
0.30
1.2
0.25
1.0
0.20
0.8
KM 0.15
M
0.6
C
(A) 0.10
0.4
Absorbance at 664 nm
Absorbance at 475 nm
Chl E
(B) 0.05
0.2
(C) 0.00
0.0 8
16
24
32
40
Retention time (min)
Fig. 3. HPLC elution profiles of pigments extracted from wild type (A), and crtW (B) and crtO (C) deleted mutants of Anabaena sp. PCC 7120. Eluent was methanol/water (9:1, v/v) from the first 20 min, and then 100% methanol (2.0 ml/min). Absorbance at 475 nm (solid line) and 664 nm (dashed line) are shown. KM, 4-ketomyxol 2 0 -fucoside; M, myxol 2 0 -fucoside; C, canthaxanthin; E, echinenone; b, b-carotene; Chl, chlorophyll a.
Therefore, All3744 (CrtO) catalyzes b-carotene to echinenone and canthaxanthin, and a small amount of echinenone found in the mutant might be produced by CrtW. These indicate that CrtW has ability to catalyze b-carotene to echinenone, but that it can not compensate the reaction in the cells.
4. Discussion In Anabaena sp. PCC 7120, two distinct b-carotene ketolase genes, one crtW-type (alr3189) and one crtO-type (all3744), were found from homology based on the genome base sequence [4]. In the present study, we investigated their functions from the deleted mutants. CrtW catalyzed myxol to ketomyxol, and CrtO catalyzed b-carotene to echinenone and canthaxanthin. Therefore, this bacterium has two b-carotene ketolases, whose substrate specificities are different, and they function in two distinct biosynthetic pathways. The total contents of b-carotene, echinenone and canthaxanthin were around 85% in both the wild type and the mutants, and those of myxol 2 0 -fucoside and ketomyxol 2 0 -fucoside were around 15%. This indicates that two b-carotene ketolases have no effect on the total contents of b-carotene and its derivatives, and of myxol and ketomyxol glycosides, and two pathways might be regulated in some ways. Further in cyanobacteria, carotenoid glycosides are known to be mainly located in outer membrane, while b-carotene and echinenone are mainly located in thylakoid membrane [15]. Therefore, carotenoid glycosides, and b-carotene and echinenone might be synthesized in different membranes, and CrtW and CrtO might be also located in different membranes, respectively. At present, only four b-carotene ketolases are functionally confirmed in cyanobacteria. In Synechocystis sp. PCC 6803,
CrtO (Slr0088) catalyzes b-carotene to echinenone [5], and ketomyxol glycoside is absent [16]. In Gloeobacter violaceus PCC 7421, CrtW (Gll1728) catalyzes b-carotene to echinenone, and (2S,2 0 S)-oscillol 2,2 0 -di(a-L -fucoside) is present but myxol glycoside is absent. This bacterium also has a crtO-like gene (gll0394), but it has no b-carotene ketolase activity [7]. Nostoc punctiforme PCC 73102 has two b-carotene ketolases, CrtW38 (NpF5919: previous number, ORF501-5948 and ORF501-38) and CrtW148 (NpF4798: previous number, ORF502-6170 and ORF502-148) [6], and both ketomyxol 2 0 -fucoside and echinenone are present [4]. Although their functions in the cells were not reported, based on the substrate specificity in [6], CrtW38 might catalyze b-carotene to echinenone since its substrate is only b-carotene, and CrtW148 might catalyze myxol 2 0 -fucoside to ketomyxol 2 0 -fucoside since its substrate is both b-carotene and zeaxanthin [4]. In total in cyanobacteria, the reaction from myxol 2 0 -fucoside to ketomyxol 2 0 -fucoside is catalyzed by CrtW in two species, while that from b-carotene to echinenone is catalyzed by CrtW in two species and by CrtO in two species. Anabaena sp. PCC 7120 was the first species found to have both enzymes. In addition, it is interesting how cyanobacteria obtain both or either b-carotene ketolases and how to use them properly. Two b-carotene ketolases are also widely distributed in bacteria and green algae in addition to cyanobacteria. CrtW and CrtO, whose functions have been confirmed, have been found in five and two species, respectively [17]. Even though the reactions of both CrtW and CrtO involve the same b-carotene ketolation, the characteristics of enzymes are different. The CrtO enzymes are almost twice the size of the CrtW enzymes and do not share significant amino acid sequence homology with CrtW. The substrate specificities of CrtW are only the b-end group (b-carotene) in three species and both the b-end and 3-hydroxy-b-end (zeaxanthin and myxol) groups in six species. That of CrtO is only the b-end group (b-carotene and c-carotene) in four species. CrtW has iron-binding motifs [6], while CrtO has six conserved regions including the FADbinding motif [17]. Two b-carotene ketolases might have evolved convergently from different ancestors to acquire the same functions, so further studies are needed. b-Carotene hydroxylase (CrtR) in Synechocystis sp. PCC 6803 catalyzes both b-carotene to zeaxanthin via b-cryptoxanthin, deoxymyxol 2 0 -glycoside to myxol 2 0 -glycoside, and echinenone to 3 0 -hydroxyechinenone [17,18]. This indicates that the substrate specificities of CrtR do not depend on the opposite side of the carotenoids, while those of CrtW and CrtO are so dependent. Acknowledgments: We thank Dr. C.P. Wolk of Michigan State University for the gift of the suicide vectors, and Dr. H. Sakurai of Waseda University for his help to construct the mutants. This work was supported in part by Grants-in-Aid for Scientific Research from JSPS to S.T. (No. 16570038).
References [1] Wolk, C.P., Ernst, A. and Elhai, J. (1994) Heterocyst metabolism and deveopment in: The Molecular Biology of Cyanobacteria (Bryant, D.A., Ed.), pp. 769–823, Kluwer Academic Publishers, Dordrecht. [2] Cohen, M.F., Meeks, J.C., Cai, Y.A. and Wolk, C.P. (1998) Transposon mutagenesis of heterocyst-forming filamentous cyanobacteria. Methods Enzymol. 297, 3–17.
6114 [3] Kaneko, T., Nakamura, Y., Wolk, C.P., Kuritz, T., Sasamoto, S., Watanabe, A., Iriguchi, M., Ishikawa, A., Kawashima, K., Kimura, T., Kishida, Y., Kohara, M., Matsumoto, M., Matsuno, A., Muraki, A., Nakazaki, N., Shimpo, S., Sugimoto, M., Takazawa, M., Yamada, M., Yasuda, M. and Tabata, S. (2001) Complete genomic sequence of the filamentous nitrogen-fixing cyanobacterium Anabaena sp. strain PCC 7120. DNA Res. 8, 205–213. [4] Takaichi, S., Mochimaru, M., Maoka, T. and Katoh, H. (2005) Myxol and 4-ketomyxol 2 0 -fucosides, not rhamnosides, from Anabaena sp. PCC 7120 and Nostoc punctiforme PCC 73102, and proposal for the biosynthetic pathway of carotenoids. Plant Cell Physiol. 46, 497–504. [5] Ferna´ndez-Gonza´lez, B., Sandmann, G. and Vioque, A. (1997) A new type of asymmetrically acting b-carotene ketolase is required for the synthesis of echinenone in the cyanobacterium Synechocystis sp. PCC 6803. J. Biol. Chem. 272, 9728–9733. [6] Steiger, S. and Sandmann, G. (2004) Cloning of two carotenoid ketolase genes from Nostoc punctiforme for the heterologous production of canthaxanthin and astaxanthin. Biotechnol. Lett. 26, 813–817. [7] Tsuchiya, T., Takaichi, S., Misawa, N., Maoka, T., Miyashita, H. and Mimuro, M. (2005) The cyanobacterium Gloeobacter violaceus PCC 7421 uses bacterial-type phytoene desaturase in carotenoid biosynthesis. FEBS Lett. 579, 2125–2129. [8] Elhai, J., Vepritskiy, A., Muro-Pastor, A.M., Flores, E. and Wolk, C.P. (1997) Reduction of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain PCC 7120. J. Bacteriol. 179, 1998–2005. [9] Elhai, J. and Work, C.P. (1988) A versatile class of positiveselection vectors based on the nonviability of palindrome-
M. Mochimaru et al. / FEBS Letters 579 (2005) 6111–6114
[10] [11]
[12]
[13] [14] [15] [16]
[17] [18]
containing plasmids that allows cloning into long polylinkers. Gene 68, 119–138. Thiel, T. and Wolk, C.P. (1987) Conjugal transfer of plasmids to cyanobacteria. Methods Enzymol. 153, 232–243. Masukawa, H., Mochimaru, M. and Sakurai, H. (2002) Disruption of the uptake hydrogenase gene, but not of the bidirectional hydrogenase gene, leads to enhanced photobiological hydrogen production by the nitrogen-fixing cyanobacterium Anabaena sp. PCC 7120. Appl. Microbial. Biotechnol. 58, 618–624. Tamagnini, P., Troshina, O., Oxelfelt, F., Salema, R. and Lindblad, P. (1997) Hydrogenases in Nostoc sp. PCC 73102, a strain lacking a bidirectional enzyme. Appl. Environ. Microbiol. 63, 1801–1807. Yanisch-Perron, C., Vieira, J. and Messing, J. (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103–119. Black, T.A., Cai, Y. and Wolk, C.P. (1993) Spatial expression and autoregulation of hetR, a gene involved in the control of heterocyst development in Anabaena. Mol. Microbiol. 9, 77–84. Omata, T. and Murata, N. (1984) Isolation and characterization of three types of membranes from the cyanobacterium (blue-green alga) Synechocystis PCC 6714. Arch. Microbiol. 139, 113–116. Takaichi, S., Maoka, T. and Masamoto, K. (2001) Myxoxanthophyll in Synechocystis sp. PCC 6803 is myxol 2 0 -dimethylfucoside, (3R,2 0 S)-myxol 2 0 -(2,4-di-O-methyl-a-L -fucoside), not rhamnoside. Plant Cell Physiol. 42, 756–762. Tao, L. and Cheng, Q. (2004) Novel b-carotene ketolases from non-photosynthetic bacteria for canthaxanthin synthesis. Mol. Genet. Genomics 272, 530–537. Masamoto, K., Misawa, N., Kaneko, T., Kikuno, R. and Toh, H. (1998) b-Carotene hydroxylase gene from the cyanobacterium Synechocystis sp. PCC6803. Plant Cell Physiol. 39, 560–564.