- Email: [email protected]
The cyclooxygenase-2 inhibitor parecoxib inhibits surgery-induced proinflammatory cytokine expression in the hippocampus in aged rats
j o u r n a l o f s u r g i c a l r e s e a r c h 1 7 8 ( 2 0 1 2 ) e 1 ee 8
Available online at www.sciencedirect.com
journal homepage: www.JournalofSurgicalResearch.com
The cyclooxygenase-2 inhibitor parecoxib inhibits surgery-induced proinflammatory cytokine expression in the hippocampus in aged rats Mian Peng, MD,* Yan-Lin Wang, MD, Fei-Fei Wang, MD, Chang Chen, MD, and Cheng-Yao Wang, MD Department of Anesthesiology, Zhongnan Hospital of Wuhan University, Wuhan, China
article info
abstract
Article history:
Background: Neuroinflammatory response triggered by surgery has been increasingly
Received 10 June 2012
reported to be associated with postoperative cognitive dysfunction. Proinflammatory
Received in revised form
cytokines, such as interleukin 1b (IL-1b) and tumor necrosis factor a (TNF-a), play a pivotal
20 July 2012
role in mediating surgery-induced neuroinflammation. The role of cyclooxygenase-2
Accepted 15 August 2012
(COX-2), a critical regulator in inflammatory response, in surgery-induced neuro-
Available online 31 August 2012
inflammation is still unknown. The aim of the study was to investigate the changes of COX-2 expression and prostaglandin E2 (PGE2) production in the hippocampus in aged rats
Keywords:
following partial hepatectomy. The effects of selective COX-2 inhibitor (parecoxib) on
COX-2
hippocampal proinflammatory cytokine expression were also evaluated.
Hippocampus
Methods: Aged rats were randomly divided into three groups: control (n ¼ 10), surgery
Neuroinflammation
(n ¼ 30), and parecoxib (n ¼ 30). Control animals received sterile saline to control for the
Parecoxib
effects of injection stress. Rats in the surgery group received partial hepatectomy under
Cytokines
isoflurane anesthesia and sterile saline injection. Rats in the parecoxib group received surgery and anesthesia similar to surgery group rats, and parecoxib treatment. On postanesthetic days 1, 3, and 7, animals were euthanized to assess levels of hippocampal COX-2 expression, PGE2 production, and cytokines IL-1b and TNF-a expression. The effects of parecoxib on proinflammatory cytokine expression were also assessed. Results: Partial hepatectomy significantly increased COX-2 expression, PGE2 production, and proinflammatory cytokine expression in the hippocampus in aged rats on postoperative days 1 and 3. Parecoxib inhibited hippocampal IL-1b and TNF-a expression through downregulation of the COX-2/PGE2 pathway. Conclusion: COX-2 may play a critical role in surgery-induced neuroinflammation. The COX-2 inhibitor may be a promising candidate for treatment of neuroinflammation caused by surgical trauma. ª 2012 Elsevier Inc. All rights reserved.
1.
Introduction
Postoperative cognitive dysfunction (POCD) is a common complication after major surgery, especially in elderly
patients. It is characterized by a persistent decline of cognitive performance after surgery and is defined as a ‘‘deterioration of intellectual function presenting as impaired memory or concentration”[1,2]. Recent studies
* Corresponding author. Department of Anesthesiology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071, China. Tel.: þ86 15327262471; fax: þ86 2767813256. E-mail address: [email protected] (M. Peng). 0022-4804/$ e see front matter ª 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.jss.2012.08.030
e2
j o u r n a l o f s u r g i c a l r e s e a r c h 1 7 8 ( 2 0 1 2 ) e 1 ee 8
have shown that POCD is associated with an increased risk of mortality, inability to cope independently, premature unemployment, and possible permanent dementia [1,3,4]. Despite the clinical importance of POCD, the etiology remains elusive. Animal and human studies suggest that POCD is associated with neuroinflammatory response triggered by surgery [5e13]. In addition, a substantial body of evidence indicates that the proinflammatory cytokines, such as interleukin 1b (IL-1b) and tumor necrosis factor a (TNF-a), play a pivotal role in mediating surgery-induced neuroinflammation [7,8,11e13]. Prostaglandin E2 (PGE2) is the major arachidonic acid metabolite involved in modulation of immuno-inflammatory responses [14]. Cyclooxygenase (COX) enzymes are the ratelimiting enzymes of PGE2 synthesis [15,16]. There are two subtypes of COX: COX-1 is constitutive and relates to physiological functions, while COX-2 is inducible and plays a more important role in inflammation [16]. An increased expression of COX-2 and elevated PGE2 levels have been demonstrated in several neuroinflammation-related neurodegenerative diseases, such as multiple sclerosis, Parkinson disease, and Alzheimer disease [17e19]. However, the role of COX-2 in surgery-induced neuroinflammation is still unknown. Partial hepatectomy is a standardized surgical procedure known to result in hippocampal inflammation and cognitive function impairment in aged rats [7]. In the present study, we investigated the changes of COX-2 expression and PGE2 production in the hippocampus in aged rats following partial hepatectomy. In addition, the effects of selective COX-2 inhibitor (parecoxib) on expression of hippocampal proinflammatory cytokines IL-1b and TNF-a were also evaluated.
2.
Materials and methods
2.1.
Animals
Seventy Sprague-Dawley male rats (weighing 500e600 g, approximately 20 mo old) were housed individually in the animal room, and were allowed to acclimate to the environment of the animal room for 7 d before the onset of the experiment. Food and water were provided ad libitum throughout the course of the experiment. The temperature in the animal room was maintained at 20 C 2 C and the animals were maintained on a 12:12-h light/dark cycle. All experiments and procedures performed in this study were performed in accordance with the Declaration of the National Institutes of Health Guide for Care and Use of Laboratory Animals.
2.2.
Surgical and pharmacologic treatments
Rats underwent partial hepatectomy under general anesthesia (1.5%e2% isoflurane with intubation and mechanical ventilation). Partial hepatectomy was performed as previously described [7]. Briefly, the liver was exposed through a 1e2 cm midline abdominal incision. The left lateral lobes of the liver (approximately corresponding to 30% of liver) were
excised. The wound was then infiltrated with 0.25% bupivacaine and closed by sterile suture. Heart rate and pulse oximeter oxygen saturation (SpO2) were measured continuously during anesthesia and surgery. Our pilot study showed that no animals had an episode of hypoxia (defined as SpO2 <90%). In addition, heart rates could be maintained at relatively normal levels under careful adjustment of anesthesia (data not shown). Parecoxib group rats received intraperitoneal (i.p.) injections of parecoxib (Dynastat [Pfizer, Ballerup, Denmark] was freshly prepared by dissolving it in saline) 1 h prior to surgery (10 mg/kg) and once daily (2 mg/kg) until the sacrifice day. The administered dosages of parecoxib in this study were determined according to the previous study of Reksidler et al. [20].
2.3.
Experimental protocol
Sprague-Dawley male rats were randomly divided into three groups: control (n ¼ 10), surgery (n ¼ 30), and parecoxib (n ¼ 30). Control animals received sterile saline to control for the effects of injection stress. Rats in the surgery group received partial hepatectomy under isoflurane anesthesia. These rats also received i.p. injections of sterile saline. Rats in the parecoxib group received surgery and anesthesia similar to the surgery group rats. In addition, parecoxib (10 mg/kg) was injected intraperitoneally 1 h prior to partial hepatectomy, followed by once-daily (2 mg/kg) i.p. injection until the sacrifice day. Rats were sacrificed on postoperative days 1, 3, and 7 (n ¼ 10/time point) for hippocampal harvesting. For hippocampal samples, animals were rapidly asphyxiated and then decapitated. The hippocampal tissue was removed and immediately cooled in liquid nitrogen and stored at 80 C until they were used for assaying COX-2, PGE2, and proinflammatory cytokine expression.
2.4. Quantitative real-time reverse transcription polymerase chain reaction for hippocampal COX-2, IL-1b, and TNF-a mRNA Total RNA was isolated from homogenization of 200 mg hippocampal tissue samples using the Trizol Reagent protocol (Invitrogen Life Science Co, Carlsbad, CA). A ReverTra Ace Reverse Transcription Kit (Toyobo Co, Osaka, Japan) was used for cDNA synthesis according to the manufacturer instructions. Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) with SYBR Green was performed on a SLAN Real-Time PCR System (Shanghai Hongshi Medical Technology Co, Shanghai, China). PCR reactions were performed at the following conditions: 95 C for 1 min, followed by 40 cycles of 95 C for 15 s, 58 C for 40 s, and 72 C for 45 s. A housekeeping gene, b-actin, was used as an internal control. Measurements were independently repeated three times to ensure the reproducibility of results. The RNA level of COX-2, IL-1b, and TNF-a in each experimental sample was normalized by comparison with the internal control using the previously described method of Livak and Schmittgen [21]. The gene activity in the control group was arbitrarily assigned as 1 to serve as a reference. The primer sequences are given in Table.
e3
j o u r n a l o f s u r g i c a l r e s e a r c h 1 7 8 ( 2 0 1 2 ) e 1 ee 8
Table e Primer sequences used for qRT-PCR. Gene
Forward primer (50 -30 )
Reverse primer (50 -30 )
COX-2 IL-1b TNF-a b-actin
CCTTGAACACGGACTTGCTC ACTATGGCAACTGTCCCTGAAC CCACCACGCTCTTCTGTCTACTG CGTTGACATCCGTAAAGACCTC
AGGTTTCAGGGAGAAGCGTT GTGCTTGGGTCCTCATCCTG CTTGGTGGTTTGCTACGACG TAGGAGCCAGGGCAGTAATCT
2.5. Western blotting for hippocampal COX-2, IL-1b, and TNF-a protein Hippocampi were homogenized with protein extraction solution and lysed by 60 min incubation on ice. The lysate was centrifuged for 15 min at 11,000g at 4 C. Protein concentrations were determined using the bicinchoninic acid assay. Normalized protein samples were denatured in Laemmli buffer at 100 C for 5 min, separated on polyacrylamide minigels, and electrophoretically transferred to nitrocellulose membranes. Membranes were blocked with 5% skim milk in Tris-buffered saline/Tween-20 (10 mM Tris [pH 8.0] and 150 mM NaCl solution containing 0.05% Tween-20) for 2 h. The membrane was incubated with anti-COX-2 (1:2000, Cayman, Ann Arbor, MI), anti-IL-1b (1:1000; Sigma, St.Louis, MO), or anti-TNF-a (1:800; Sigma) overnight at 4 C. Immunoreactivity was detected using goat anti-rabbit horseradish peroxidaseeconjugated secondary antibody (Sigma) followed by enhanced chemiluminescence system (ECL; Amersham Biosciences, Piscataway, NJ). The membrane blots were stripped and reprobed with polyclonal anti-b-actin (20e33; Sigma). Relative expression levels of COX-2, IL-1b, and TNFa protein were normalized by the ratio of target protein (COX2, IL-1b, and TNF-a) to b-actin.
2.6. Enzyme-linked immunosorbent assay for hippocampal PGE2 Each 100 mg of hippocampus samples was homogenized in 1 mL saline. The homogenate was then centrifuged at 4000 r/ min for 15 min at 4 C and supernatants were collected. Hippocampal PGE2 was measured using an enzyme-linked immunosorbent assay kit (R&D Systems Co, Minneapolis, MN) and all procedures conformed to the manufacturer’s protocol. The concentration of PGE2 was expressed in pg/mL of total protein content.
52% (P < 0.05) and 47% (P < 0.05), respectively, when compared with the control group. Protein expression of COX-2 was significantly increased, by 75% (P < 0.001) and 66% (P < 0.01), respectively, on the first and third postsurgical day. The COX-2 selective inhibitor parecoxib significantly suppressed COX-2 mRNA, by 47% (P < 0.05) and 48% (P < 0.05), respectively, on postoperative days 1 and 3, when compared with the surgery group. Parecoxib treatment also markedly inhibited COX-2 protein expression, by 46% (P < 0.05) and 60% (P < 0.05), respectively, on postoperative days 1 and 3 (P < 0.05) (Fig. 1).
3.2.
The level of hippocampal PGE2 was significantly increased, by 62% (P < 0.001) and 56% (P < 0.01), respectively, on postoperative days 1 and 3, compared with the control group. Parecoxib treatment significantly inhibited PGE2 expression, by 42% (P < 0.05) and 48% (P < 0.05), respectively, on postoperative days 1 and 3, in comparison with the surgery group (Fig. 2).
3.3.
Parecoxib and hippocampal IL-1b expression
The expression of hippocampal IL-1b mRNA was upregulated by 44% (P < 0.01) and 37% (P < 0.05), respectively, on postoperative days 1 and 3, and improved on day 7 (P > 0.05). Similar findings were seen for IL-1b protein expression, which remained upregulated from postoperative day 1 (P < 0.001) until day 3 (P < 0.001). Parecoxib treatment significantly inhibited IL-1b mRNA expression, by 33% on postoperative day 1 (P < 0.05) and 36% on postoperative day 3 (P < 0.05), in comparison with the surgery group. Parecoxib treatment also markedly inhibited IL-1b protein expression, by 29% (P < 0.05) and 39% (P < 0.05), respectively, on postoperative days 1 and 3 (Fig. 3).
3.4. 2.7.
Parecoxib and hippocampal PGE2 production
Parecoxib and hippocampal TNF-a expression
Statistical analysis
All data are presented as mean SD. The data were analyzed with 1-way analysis of variance, followed by Bonferroni post hoc test. A P value <0.05 was considered to be statistically significant.
3.
Results
3.1.
Parecoxib and hippocampal COX-2 expression
On days 1 and 3 after partial hepatectomy, the level of hippocampal COX-2 mRNA was significantly increased, by
Hippocampal TNF-a mRNA and protein expression increased by 44% (P < 0.01) and 70% (P < 0.001), respectively, only on postoperative day 1. The expression of TNF-a mRNA and protein were significantly suppressed, by 37% (P < 0.05) and 55% (P < 0.01), respectively, in the parecoxib group on day 1 postoperatively, compared with the surgery group (Fig. 4).
4.
Discussion
The findings of this study indicate that surgery significantly increased COX-2 expression, PGE2 production, and
e4
j o u r n a l o f s u r g i c a l r e s e a r c h 1 7 8 ( 2 0 1 2 ) e 1 ee 8
Fig. 1 e Parecoxib suppressed hippocampal COX-2 mRNA (A) and protein (B) expression enhanced by surgical trauma. Hippocampal COX-2 mRNA and protein were measured on days 1, 3, and 7 postoperatively. Data were expressed as mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001, versus control group; #P < 0.05, versus surgery group, at the same time point. C: control group; S1, S3, S7: surgery group on days 1, 3, and 7 postoperatively; P1, P3, P7: parecoxib group on days 1, 3, and 7 postoperatively.
proinflammatory cytokine expression in the hippocampus in aged rats. COX-2 inhibitor parecoxib inhibited surgeryinduced hippocampal proinflammatory cytokine expression through downregulation of the COX-2/PGE2 pathway.
Several large-scale patient studies have consistently found increasing age to be the most relevant risk factor in the development of POCD [1,22,23]. Animal studies also revealed an agerelated increase in susceptibility to hippocampal inflammation
Fig. 2 e Parecoxib suppressed hippocampal PGE2 production enhanced by surgical trauma. Hippocampal PGE2 was measured on days 1, 3, and 7 postoperatively. Data were expressed as mean ± SD. **P < 0.01, ***P < 0.001, versus control group; #P < 0.05, versus surgery group, at the same time point. C: control group; S1, S3, S7: surgery group on days 1, 3, and 7 postoperatively; P1, P3, P7: parecoxib group on days 1, 3, and 7 postoperatively.
j o u r n a l o f s u r g i c a l r e s e a r c h 1 7 8 ( 2 0 1 2 ) e 1 ee 8
e5
Fig. 3 e Parecoxib inhibited hippocampal IL-1b mRNA (A) and protein (B) level enhanced by surgery. Hippocampal IL-1b mRNA and protein were measured on days 1, 3, and 7 postoperatively. Data were expressed as mean ± SD. **P < 0.01, ***P < 0.001, versus control group; #P < 0.05, versus surgery group at the same time point. C: control group; S1, S3, S7: surgery group on days 1, 3, and 7 postoperatively; P1, P3, P7: parecoxib group on days 1, 3, and 7 postoperatively.
following surgical trauma [7,24]. Therefore, in the present study, we chose the aged SD rats as objective animals. The hippocampus is known to play a major role in learning and memory. Recent studies have shown that POCD associates with hippocampal inflammatory response triggered by surgical trauma [7,8,10e13]. Cao et al. [7] found that partial hepatectomy, rather than isoflurane anesthesia, induced hippocampal inflammation, as reflected by the increased expression of proinflammatory cytokines IL-1b, TNF-a, and interleukin 6 (IL-6) and glial cell activation in the hippocampus in aged rats, and resulted in cognitive function impairment. Therefore, in the current work, partial hepatectomy was used to induce neuroinflammation in the hippocampus. The role of COX-2 in partial hepatectomyeinduced hippocampal inflammation was evaluated. COX-2 is a critical regulator in inflammatory disease. The inhibition of COX-2 activity could suppress the inflammatory response and reduce the expression of inflammatory cytokines [25,26]. Our data indicate that surgery significantly increased COX-2 expression, PGE2 production, and IL-1b and
TNF-a expression in the hippocampus in aged rats on postoperative days 1 and 3. Importantly, parecoxib, a selective COX-2 inhibitor, significantly reduced IL-1b and TNFa expression in the hippocampus through downregulation of the COX-2/PGE2 pathway. These results suggest that COX-2 may play a key role in surgery-induced hippocampal inflammation. In addition, proinflammatory cytokine IL-1b and TNF-a may be downstream signaling molecules of the COX-2/PGE2 pathway in the inflammatory process. In recent years, data concerning the contributions of COX-2 to neuroinflammation have been controversial. On one hand, COX-2 is strongly suggested to play a detrimental role in neurodegeneration and stimulation of an inflammatory process that is followed by neuronal death [27e29]. On the other hand, some studies imply that COX-2 may play a neuroprotective role in the central nervous system and its inhibition may aggravate the neuroinflammatory response to central or systemic administration of lipopolysaccharide [30,31]. In the present study, the beneficial effect of COX-2 selective inhibitor on alleviation of the surgery-induced hippocampal
e6
j o u r n a l o f s u r g i c a l r e s e a r c h 1 7 8 ( 2 0 1 2 ) e 1 ee 8
Fig. 4 e Parecoxib inhibited hippocampal TNF-a mRNA (A) and protein (B) level enhanced by surgery. Hippocampal TNF-a mRNA and protein were measured on days 1, 3, and 7 postoperatively. Data were expressed as mean ± SD. **P < 0.01, ***P < 0.001, versus control group; #P < 0.05, ##P < 0.01, versus surgery group, at the same time point. C: control group; S1, S3, S7: surgery group on days 1, 3, and 7 postoperatively; P1, P3, P7: parecoxib group on days 1, 3, and 7 postoperatively.
inflammation implies that COX-2 plays a proinflammatory role in surgery-induced neuroinflammation. Surgery induces not only peripheral inflammatory response, but also neuroinflammatory response. Terrando et al. [12] found that surgical trauma engages the innate immune system through nuclear factor-kBedependent signaling to release cytokines that disrupt blood-brain barrier (BBB) integrity. Through a permeable BBB, peripheral macrophages migrate into the hippocampus, promoting neuroinflammation that upregulates the proinflammatory cytokine expression. A series of evidences indicates that proinflammatory cytokines play a pivotal role in the neuroinflammatory response to surgical trauma [6e13]. Wan et al. [13] recently reported a key role for IL-1b and TNF-a in mediating surgery-induced neuroinflammation in splenectomized rats. Human studies also demonstrated the upregulation of IL-6 in cerebrospinal fluid
after total hip replacement [6]. Other studies have indicated that elevated expression of proinflammatory cytokines results in impairments in long-term potentiation [32,33] and performance deficits in hippocampal-mediated cognitive tests [34,35]. These studies demonstrated the role of proinflammatory cytokines in regulating behavioral and cognitive changes. Therefore, inhibition of the proinflammatory cytokine release in the brain may attenuate the surgery-induced neuroinflammation and prevent POCD. Parecoxib, a selective inhibitor of COX-2, is frequently used for postoperative analgesia. Valdecoxib is the active metabolite of parecoxib. Human studies demonstrated that parecoxib penetrated BBB as early as 15 min and cerebrospinal fluid valdecoxib concentration rapidly reached half maximal inhibitory concentration (1.57 ng/mL) by 17 min after single intravenous injection of parecoxib [36,37]. In the current study, parecoxib treatment inhibited hippocampal proinflammatory
j o u r n a l o f s u r g i c a l r e s e a r c h 1 7 8 ( 2 0 1 2 ) e 1 ee 8
cytokine expression following partial hepatectomy through downregulation of the COX-2/PGE2 pathway. Therefore, parecoxib may be a promising candidate for treatment of surgeryinduced neuroinflammation. There are some limitations in the current work. First, our study emphasized the surgery-induced neuroinflammation in the hippocampus. We did not investigate the changes in cognitive function caused by surgical trauma. Thus, further behavioral investigations are needed to clarify the role of COX2 in POCD. Second, in the present study, we found that COX-2 plays a critical role in surgery-induced neuroinflammation. However, recent studies indicate that COX-1 may also be a major player in the neuroinflammatory process. A proinflammatory role of COX-1 has been reported in several neurodegenerative diseases, including Alzheimer disease [38,39] and Parkinson disease [28]. Therefore, COX-1 may be involved in neuroinflammation induced by surgical trauma. Further studies are needed on this point. Third, parecoxib is a selective inhibitor of COX-2 available for postoperative intravenous analgesia. A series of studies demonstrated that postoperative [40,41] or preoperative administration [42e46] of parecoxib is effective for postoperative pain control after various types of surgery. In our study, we administered parecoxib 1 h prior to hepatectomy to mimic the clinical setting of preoperative administration. However, we did not determine whether postoperative administration of parecoxib would have similar inhibition effects on surgery-induced hippocampal proinflammatory cytokine expression. This question awaits further study. Fourth, in the current study, we focused on the effects of parecoxib on surgery-induced hippocampal proinflammatory cytokine expression. We did not measure the plasma proinflammatory cytokine expression. To evaluate the effects of parecoxib on systemic inflammation induced by surgery would help to elucidate fully the inhibition effects of parecoxib on neuroinflammation. In conclusion, the present study showed that surgery significantly increased COX-2 expression, PGE2 production, and proinflammatory cytokine expression in the hippocampus in aged rats. COX-2 inhibitor parecoxib inhibited surgery-induced hippocampal proinflammatory cytokine expression through downregulation of the COX-2/PGE2 pathway. These results suggested that COX-2 may play a critical role in surgery-induced neuroinflammation, and the COX2 inhibitor may be a promising candidate for treatment of neuroinflammation caused by surgical trauma.
Acknowledgment This work was supported by the National Natural Science Foundation of China (30901393).
references
[1] Moller JT, Cluitmans P, Rasmussen LS, et al. Long-term postoperative dysfunction in the elderly: ISPOCD 1 study. Lancet 1998;351:857.
e7
[2] Rasmussen LS. Postoperative cognitive dysfunction: incidence and prevention. Best Pract Res Clin Anaesthesiol 2006;20:315. [3] Newman MF, Kirchner JL, Phillips-Bute B, et al. Neurological Outcome Research Group and the Cardiothoracic Anesthesiology Research Endeavors Investigators. Longitudinal assessment of neurocognitive function after coronary-artery bypass surgery. N Engl J Med 2001;344:395. [4] Steinmetz J, Christensen KB, Lund T, Lohse N, Rasmussen LS. ISPOCD Group. Long-term consequences of postoperative cognitive dysfunction. Anesthesiology 2009;110:548. [5] Beloosesky Y, Hendel D, Weiss A, et al. Cytokines and C-reactive protein production in hip-fracture-operated elderly patients. J Gerontol A Biol Sci Med Sci 2007;62:420. [6] Buvanendran A, Kroin JS, Berger RA, et al. Upregulation of prostaglandin E2 and interleukins in the central nervous system and peripheral tissue during and after surgery in humans. Anesthesiology 2006;104:403. [7] Cao XZ, Ma H, Wang JK, et al. Postoperative cognitive deficits and neuroinflammation in the hippocampus triggered by surgical trauma are exacerbated in aged rats. Prog Neuropsychopharmacol Biol Psychiatry 2010;34:1426. [8] Cibelli M, Fidalgo AR, Terrando N, et al. Role of interleukin1beta in postoperative cognitive dysfunction. Ann Neurol 2010;68:360. [9] Ka´lma´n J, Juha´sz A, Boga´ts G, et al. Elevated levels of inflammatory biomarkers in the cerebrospinal fluid after coronary artery bypass surgery are predictors of cognitive decline. Neurochem Int 2006;48:177. [10] Rosczyk HA, Sparkman NL, Johnson RW. Neuroinflammation and cognitive function in aged mice following minor surgery. Exp Gerontol 2008;43:840. [11] Terrando N, Monaco C, Ma D, Foxwell BM, Feldmann M, Maze M. Tumor necrosis factor-alpha triggers a cytokine cascade yielding postoperative cognitive decline. Proc Natl Acad Sci U S A 2010;107:20518. [12] Terrando N, Eriksson LI, Ryu JK, et al. Resolving postoperative neuroinflammation and cognitive decline. Ann Neurol 2011;70:986. [13] Wan Y, Xu J, Ma D, Zeng Y, Cibelli M, Maze M. Postoperative impairment of cognitive function in rats: a possible role for cytokine-mediated inflammation in the hippocampus. Anesthesiology 2007;106:436. [14] Vane JR, Bakhl YS, Botting RM. Cyclooxygenases 1 and 2. Annu Rev Pharmacol Toxicol 1998;38:97. [15] Kobayashi Y, Mizoguchi T, Take I, Kurihara S, Udagawa N, Takahashi N. Prostaglandin E2 enhances osteoclastic differentiation of precursor cells through protein kinase Adependent phosphorylation of TAK1. J Biol Chem 2005;280: 11395. [16] Herschman HR. Prostaglandin synthesis 2. Biochim Biophys Acta 1996;1229:125. [17] McGeer PL, McGeer EG. Inflammation and the degenerative disease of aging. Ann N Y Acad Sci 2004;1035:104. [18] Minghetti L. Cyclooxygenase-2 (COX-2) in inflammatory and degenerative brain diseases. J Neuropathol Exp Neurol 2004; 63:901. [19] Minghetti L. Role of COX-2 in inflammatory and degenerative brain diseases. Subcell Biochem 2007;42:127. [20] Reksidler AB, Lima MM, Zanata SM, et al. The COX-2 inhibitor parecoxib produces neuroprotective effects in MPTP-lesioned rats. Eur J Pharmacol 2007;560:163. [21] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402. [22] Melnikova T, Savonenko A, Wang Q, et al. Cycloxygenase-2 activity promotes cognitive deficits but not increased
e8
[23]
[24]
[25]
[26] [27]
[28]
[29]
[30]
[31]
[32]
[33]
[34]
[35]
j o u r n a l o f s u r g i c a l r e s e a r c h 1 7 8 ( 2 0 1 2 ) e 1 ee 8
amyloid burden in a model of Alzheimer’s disease in a sex-dimorphic pattern. Neuroscience 2006;141:1149. Monk TG, Weldon BC, Garvan CW, et al. Predictors of cognitive dysfunction after major noncardiac surgery. Anesthesiology 2008;108:18. Culley DJ, Baxter M, Yukhananov R, Crosby G. The memory effects of general anesthesia persist for weeks in young and aged rat. Anesth Analg 2003;96:1004. Matsuda K, Nakamura S, Matsushita T. Dynastat inhibits nitric oxide production in chondrocytes of ligamentdamaged osteoarthritic rat joints. Rheumatol Int 2006;26:991. Votta BJ, Bertolini DR. Cytokine suppressive anti-inflammatory compounds inhibit bone resorption in vitro. Bone 1994;15:533. Hoozemans JJ, Veerhuis R, Janssen I, van Elk EJ, Rozemuller AJ, Eikelenboom P. The role of cyclooxygenase 1 and 2 activity in prostaglandin E2 secretion by cultured human adult microglia: implications for Alzheimer’s disease. Brain Res 2002;951:218. Teismann P, Tieu K, Choi DK, et al. Cyclooxygenase-2 is instrumental in Parkinson’s disease neurodegeneration. Proc Natl Acad Sci U S A 2003;100:5473. McCoy MK, Martinez TN, Ruhn KA, et al. Blocking soluble tumor necrosis factor signaling with dominant-negative tumor necrosis factor inhibitor attenuates loss of dopaminergic neurons in models of Parkinson’s disease. J Neurosci 2006;37:9365. Aid S, Langenbach R, Bosetti F. Neuroinflammatory response to lipopolysaccharide is exacerbated in mice genetically deficient in cyclooxygenase-2. J Neuroinflammation 2008;5:17. Blais V, Turrin NP, Rivest S. Cyclooxygenase 2 (COX-2) inhibition increases the inflammatory response in the brain during systemic immune stimuli. J Neurochem 2005; 95:1563. Pickering M, Cumiskey D, O’Connor JJ. Actions of TNF-alpha on glutamatergic synaptic transmission in the central nervous system. Exp Physiol 2005;90:663. Perry VH, Cunningham C, Holmes C. Systemic infections and inflammation affect chronic neurodegeneration. Nat Rev Immunol 2007;7:161. Tanaka S, Ide M, Shibutani T, et al. Lipopolysaccharideinduced microglial activation induces learning and memory deficits without neuronal cell death in rats. J Neurosci Res 2006;83:557. Sparkman NL, Kohman RA, Scott VJ, Boehm GW. Bacterial endotoxin-induced behavioral alterations in two variations of the Morris water maze. Physiol Behav 2005;86:244.
[36] Dembo G, Park SB, Kharasch ED. Central nervous system concentrations of cyclooxygenase-2 inhibitors in humans. Anesthesiology 2005;102:409. [37] Mehta V, Johnston A, Cheung R, Bello A, Langford RM. Intravenous parecoxib rapidly leads to COX-2 inhibitory concentration of valdecoxib in the central nervous system. Clin Pharmacol Ther 2008;83:430. [38] Yermakova AV, Rollins J, Callahan LM, Rogers J, O’Banion MK. Cyclooxygenase-1 in human Alzheimer and control brain: quantitative analysis of expression by microglia and CA3 hippocampal neurons. J Neuropathol Exp Neurol 1999;58:1135. [39] Rogers J, Kirby LC, Hempelman SR, et al. Clinical trial of indomethacin in Alzheimer’s disease. Neurology 1993; 43:1609. [40] Tang J, Li S, White PF, et al. Effect of parecoxib, a novel intravenous cyclooxygenase type-2 inhibitor, on the postoperative opioid requirement and quality of pain control. Anesthesiology 2002;96:1305. [41] Malan TP Jr, Marsh G, Hakki SI, Grossman E, Traylor L, Hubbard RC. Parecoxib sodium, a parenteral cyclooxygenase 2 selective inhibitor, improves morphine analgesia and is opioid-sparing following total hip arthroplasty. Anesthesiology 2003;98:950. [42] Desjardins PJ, Grossman EH, Kuss ME, et al. The injectable cyclooxygenase-2-specific inhibitor parecoxib sodium has analgesic efficacy when administered preoperatively. Anesth Analg 2001;93:721. [43] Gan TJ, Joshi GP, Zhao SZ, Hanna DB, Cheung RY, Chen C. Presurgical intravenous parecoxib sodium and follow-up oral valdecoxib for pain management after laparoscopic cholecystectomy surgery reduces opioid requirements and opioid-related adverse effects. Acta Anaesthesiol Scand 2004; 48:1194. [44] Gan TJ, Joshi GP, Viscusi E, et al. Preoperative parenteral parecoxib and follow-up oral valdecoxib reduce length of stay and improve quality of patient recovery after laparoscopic cholecystectomy surgery. Anesth Analg 2004; 98:1665. [45] Bajaj P, Ballary CC, Dongre NA, Baliga VP, Desai AA. Role of parecoxib in pre-emptive analgesia: comparison of the efficacy and safety of pre- and postoperative parecoxib in patients undergoing general surgery. J Indian Med Assoc 2004;102:272. [46] Neuss H, Koplin G, Haase O, Reetz C, Mall JW. Preemptive analgesia reduces pain after radical axillary lymph node dissection. J Surg Res 2010;162:88.
Available online at www.sciencedirect.com
journal homepage: www.JournalofSurgicalResearch.com
The cyclooxygenase-2 inhibitor parecoxib inhibits surgery-induced proinflammatory cytokine expression in the hippocampus in aged rats Mian Peng, MD,* Yan-Lin Wang, MD, Fei-Fei Wang, MD, Chang Chen, MD, and Cheng-Yao Wang, MD Department of Anesthesiology, Zhongnan Hospital of Wuhan University, Wuhan, China
article info
abstract
Article history:
Background: Neuroinflammatory response triggered by surgery has been increasingly
Received 10 June 2012
reported to be associated with postoperative cognitive dysfunction. Proinflammatory
Received in revised form
cytokines, such as interleukin 1b (IL-1b) and tumor necrosis factor a (TNF-a), play a pivotal
20 July 2012
role in mediating surgery-induced neuroinflammation. The role of cyclooxygenase-2
Accepted 15 August 2012
(COX-2), a critical regulator in inflammatory response, in surgery-induced neuro-
Available online 31 August 2012
inflammation is still unknown. The aim of the study was to investigate the changes of COX-2 expression and prostaglandin E2 (PGE2) production in the hippocampus in aged rats
Keywords:
following partial hepatectomy. The effects of selective COX-2 inhibitor (parecoxib) on
COX-2
hippocampal proinflammatory cytokine expression were also evaluated.
Hippocampus
Methods: Aged rats were randomly divided into three groups: control (n ¼ 10), surgery
Neuroinflammation
(n ¼ 30), and parecoxib (n ¼ 30). Control animals received sterile saline to control for the
Parecoxib
effects of injection stress. Rats in the surgery group received partial hepatectomy under
Cytokines
isoflurane anesthesia and sterile saline injection. Rats in the parecoxib group received surgery and anesthesia similar to surgery group rats, and parecoxib treatment. On postanesthetic days 1, 3, and 7, animals were euthanized to assess levels of hippocampal COX-2 expression, PGE2 production, and cytokines IL-1b and TNF-a expression. The effects of parecoxib on proinflammatory cytokine expression were also assessed. Results: Partial hepatectomy significantly increased COX-2 expression, PGE2 production, and proinflammatory cytokine expression in the hippocampus in aged rats on postoperative days 1 and 3. Parecoxib inhibited hippocampal IL-1b and TNF-a expression through downregulation of the COX-2/PGE2 pathway. Conclusion: COX-2 may play a critical role in surgery-induced neuroinflammation. The COX-2 inhibitor may be a promising candidate for treatment of neuroinflammation caused by surgical trauma. ª 2012 Elsevier Inc. All rights reserved.
1.
Introduction
Postoperative cognitive dysfunction (POCD) is a common complication after major surgery, especially in elderly
patients. It is characterized by a persistent decline of cognitive performance after surgery and is defined as a ‘‘deterioration of intellectual function presenting as impaired memory or concentration”[1,2]. Recent studies
* Corresponding author. Department of Anesthesiology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071, China. Tel.: þ86 15327262471; fax: þ86 2767813256. E-mail address: [email protected] (M. Peng). 0022-4804/$ e see front matter ª 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.jss.2012.08.030
e2
j o u r n a l o f s u r g i c a l r e s e a r c h 1 7 8 ( 2 0 1 2 ) e 1 ee 8
have shown that POCD is associated with an increased risk of mortality, inability to cope independently, premature unemployment, and possible permanent dementia [1,3,4]. Despite the clinical importance of POCD, the etiology remains elusive. Animal and human studies suggest that POCD is associated with neuroinflammatory response triggered by surgery [5e13]. In addition, a substantial body of evidence indicates that the proinflammatory cytokines, such as interleukin 1b (IL-1b) and tumor necrosis factor a (TNF-a), play a pivotal role in mediating surgery-induced neuroinflammation [7,8,11e13]. Prostaglandin E2 (PGE2) is the major arachidonic acid metabolite involved in modulation of immuno-inflammatory responses [14]. Cyclooxygenase (COX) enzymes are the ratelimiting enzymes of PGE2 synthesis [15,16]. There are two subtypes of COX: COX-1 is constitutive and relates to physiological functions, while COX-2 is inducible and plays a more important role in inflammation [16]. An increased expression of COX-2 and elevated PGE2 levels have been demonstrated in several neuroinflammation-related neurodegenerative diseases, such as multiple sclerosis, Parkinson disease, and Alzheimer disease [17e19]. However, the role of COX-2 in surgery-induced neuroinflammation is still unknown. Partial hepatectomy is a standardized surgical procedure known to result in hippocampal inflammation and cognitive function impairment in aged rats [7]. In the present study, we investigated the changes of COX-2 expression and PGE2 production in the hippocampus in aged rats following partial hepatectomy. In addition, the effects of selective COX-2 inhibitor (parecoxib) on expression of hippocampal proinflammatory cytokines IL-1b and TNF-a were also evaluated.
2.
Materials and methods
2.1.
Animals
Seventy Sprague-Dawley male rats (weighing 500e600 g, approximately 20 mo old) were housed individually in the animal room, and were allowed to acclimate to the environment of the animal room for 7 d before the onset of the experiment. Food and water were provided ad libitum throughout the course of the experiment. The temperature in the animal room was maintained at 20 C 2 C and the animals were maintained on a 12:12-h light/dark cycle. All experiments and procedures performed in this study were performed in accordance with the Declaration of the National Institutes of Health Guide for Care and Use of Laboratory Animals.
2.2.
Surgical and pharmacologic treatments
Rats underwent partial hepatectomy under general anesthesia (1.5%e2% isoflurane with intubation and mechanical ventilation). Partial hepatectomy was performed as previously described [7]. Briefly, the liver was exposed through a 1e2 cm midline abdominal incision. The left lateral lobes of the liver (approximately corresponding to 30% of liver) were
excised. The wound was then infiltrated with 0.25% bupivacaine and closed by sterile suture. Heart rate and pulse oximeter oxygen saturation (SpO2) were measured continuously during anesthesia and surgery. Our pilot study showed that no animals had an episode of hypoxia (defined as SpO2 <90%). In addition, heart rates could be maintained at relatively normal levels under careful adjustment of anesthesia (data not shown). Parecoxib group rats received intraperitoneal (i.p.) injections of parecoxib (Dynastat [Pfizer, Ballerup, Denmark] was freshly prepared by dissolving it in saline) 1 h prior to surgery (10 mg/kg) and once daily (2 mg/kg) until the sacrifice day. The administered dosages of parecoxib in this study were determined according to the previous study of Reksidler et al. [20].
2.3.
Experimental protocol
Sprague-Dawley male rats were randomly divided into three groups: control (n ¼ 10), surgery (n ¼ 30), and parecoxib (n ¼ 30). Control animals received sterile saline to control for the effects of injection stress. Rats in the surgery group received partial hepatectomy under isoflurane anesthesia. These rats also received i.p. injections of sterile saline. Rats in the parecoxib group received surgery and anesthesia similar to the surgery group rats. In addition, parecoxib (10 mg/kg) was injected intraperitoneally 1 h prior to partial hepatectomy, followed by once-daily (2 mg/kg) i.p. injection until the sacrifice day. Rats were sacrificed on postoperative days 1, 3, and 7 (n ¼ 10/time point) for hippocampal harvesting. For hippocampal samples, animals were rapidly asphyxiated and then decapitated. The hippocampal tissue was removed and immediately cooled in liquid nitrogen and stored at 80 C until they were used for assaying COX-2, PGE2, and proinflammatory cytokine expression.
2.4. Quantitative real-time reverse transcription polymerase chain reaction for hippocampal COX-2, IL-1b, and TNF-a mRNA Total RNA was isolated from homogenization of 200 mg hippocampal tissue samples using the Trizol Reagent protocol (Invitrogen Life Science Co, Carlsbad, CA). A ReverTra Ace Reverse Transcription Kit (Toyobo Co, Osaka, Japan) was used for cDNA synthesis according to the manufacturer instructions. Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) with SYBR Green was performed on a SLAN Real-Time PCR System (Shanghai Hongshi Medical Technology Co, Shanghai, China). PCR reactions were performed at the following conditions: 95 C for 1 min, followed by 40 cycles of 95 C for 15 s, 58 C for 40 s, and 72 C for 45 s. A housekeeping gene, b-actin, was used as an internal control. Measurements were independently repeated three times to ensure the reproducibility of results. The RNA level of COX-2, IL-1b, and TNF-a in each experimental sample was normalized by comparison with the internal control using the previously described method of Livak and Schmittgen [21]. The gene activity in the control group was arbitrarily assigned as 1 to serve as a reference. The primer sequences are given in Table.
e3
j o u r n a l o f s u r g i c a l r e s e a r c h 1 7 8 ( 2 0 1 2 ) e 1 ee 8
Table e Primer sequences used for qRT-PCR. Gene
Forward primer (50 -30 )
Reverse primer (50 -30 )
COX-2 IL-1b TNF-a b-actin
CCTTGAACACGGACTTGCTC ACTATGGCAACTGTCCCTGAAC CCACCACGCTCTTCTGTCTACTG CGTTGACATCCGTAAAGACCTC
AGGTTTCAGGGAGAAGCGTT GTGCTTGGGTCCTCATCCTG CTTGGTGGTTTGCTACGACG TAGGAGCCAGGGCAGTAATCT
2.5. Western blotting for hippocampal COX-2, IL-1b, and TNF-a protein Hippocampi were homogenized with protein extraction solution and lysed by 60 min incubation on ice. The lysate was centrifuged for 15 min at 11,000g at 4 C. Protein concentrations were determined using the bicinchoninic acid assay. Normalized protein samples were denatured in Laemmli buffer at 100 C for 5 min, separated on polyacrylamide minigels, and electrophoretically transferred to nitrocellulose membranes. Membranes were blocked with 5% skim milk in Tris-buffered saline/Tween-20 (10 mM Tris [pH 8.0] and 150 mM NaCl solution containing 0.05% Tween-20) for 2 h. The membrane was incubated with anti-COX-2 (1:2000, Cayman, Ann Arbor, MI), anti-IL-1b (1:1000; Sigma, St.Louis, MO), or anti-TNF-a (1:800; Sigma) overnight at 4 C. Immunoreactivity was detected using goat anti-rabbit horseradish peroxidaseeconjugated secondary antibody (Sigma) followed by enhanced chemiluminescence system (ECL; Amersham Biosciences, Piscataway, NJ). The membrane blots were stripped and reprobed with polyclonal anti-b-actin (20e33; Sigma). Relative expression levels of COX-2, IL-1b, and TNFa protein were normalized by the ratio of target protein (COX2, IL-1b, and TNF-a) to b-actin.
2.6. Enzyme-linked immunosorbent assay for hippocampal PGE2 Each 100 mg of hippocampus samples was homogenized in 1 mL saline. The homogenate was then centrifuged at 4000 r/ min for 15 min at 4 C and supernatants were collected. Hippocampal PGE2 was measured using an enzyme-linked immunosorbent assay kit (R&D Systems Co, Minneapolis, MN) and all procedures conformed to the manufacturer’s protocol. The concentration of PGE2 was expressed in pg/mL of total protein content.
52% (P < 0.05) and 47% (P < 0.05), respectively, when compared with the control group. Protein expression of COX-2 was significantly increased, by 75% (P < 0.001) and 66% (P < 0.01), respectively, on the first and third postsurgical day. The COX-2 selective inhibitor parecoxib significantly suppressed COX-2 mRNA, by 47% (P < 0.05) and 48% (P < 0.05), respectively, on postoperative days 1 and 3, when compared with the surgery group. Parecoxib treatment also markedly inhibited COX-2 protein expression, by 46% (P < 0.05) and 60% (P < 0.05), respectively, on postoperative days 1 and 3 (P < 0.05) (Fig. 1).
3.2.
The level of hippocampal PGE2 was significantly increased, by 62% (P < 0.001) and 56% (P < 0.01), respectively, on postoperative days 1 and 3, compared with the control group. Parecoxib treatment significantly inhibited PGE2 expression, by 42% (P < 0.05) and 48% (P < 0.05), respectively, on postoperative days 1 and 3, in comparison with the surgery group (Fig. 2).
3.3.
Parecoxib and hippocampal IL-1b expression
The expression of hippocampal IL-1b mRNA was upregulated by 44% (P < 0.01) and 37% (P < 0.05), respectively, on postoperative days 1 and 3, and improved on day 7 (P > 0.05). Similar findings were seen for IL-1b protein expression, which remained upregulated from postoperative day 1 (P < 0.001) until day 3 (P < 0.001). Parecoxib treatment significantly inhibited IL-1b mRNA expression, by 33% on postoperative day 1 (P < 0.05) and 36% on postoperative day 3 (P < 0.05), in comparison with the surgery group. Parecoxib treatment also markedly inhibited IL-1b protein expression, by 29% (P < 0.05) and 39% (P < 0.05), respectively, on postoperative days 1 and 3 (Fig. 3).
3.4. 2.7.
Parecoxib and hippocampal PGE2 production
Parecoxib and hippocampal TNF-a expression
Statistical analysis
All data are presented as mean SD. The data were analyzed with 1-way analysis of variance, followed by Bonferroni post hoc test. A P value <0.05 was considered to be statistically significant.
3.
Results
3.1.
Parecoxib and hippocampal COX-2 expression
On days 1 and 3 after partial hepatectomy, the level of hippocampal COX-2 mRNA was significantly increased, by
Hippocampal TNF-a mRNA and protein expression increased by 44% (P < 0.01) and 70% (P < 0.001), respectively, only on postoperative day 1. The expression of TNF-a mRNA and protein were significantly suppressed, by 37% (P < 0.05) and 55% (P < 0.01), respectively, in the parecoxib group on day 1 postoperatively, compared with the surgery group (Fig. 4).
4.
Discussion
The findings of this study indicate that surgery significantly increased COX-2 expression, PGE2 production, and
e4
j o u r n a l o f s u r g i c a l r e s e a r c h 1 7 8 ( 2 0 1 2 ) e 1 ee 8
Fig. 1 e Parecoxib suppressed hippocampal COX-2 mRNA (A) and protein (B) expression enhanced by surgical trauma. Hippocampal COX-2 mRNA and protein were measured on days 1, 3, and 7 postoperatively. Data were expressed as mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001, versus control group; #P < 0.05, versus surgery group, at the same time point. C: control group; S1, S3, S7: surgery group on days 1, 3, and 7 postoperatively; P1, P3, P7: parecoxib group on days 1, 3, and 7 postoperatively.
proinflammatory cytokine expression in the hippocampus in aged rats. COX-2 inhibitor parecoxib inhibited surgeryinduced hippocampal proinflammatory cytokine expression through downregulation of the COX-2/PGE2 pathway.
Several large-scale patient studies have consistently found increasing age to be the most relevant risk factor in the development of POCD [1,22,23]. Animal studies also revealed an agerelated increase in susceptibility to hippocampal inflammation
Fig. 2 e Parecoxib suppressed hippocampal PGE2 production enhanced by surgical trauma. Hippocampal PGE2 was measured on days 1, 3, and 7 postoperatively. Data were expressed as mean ± SD. **P < 0.01, ***P < 0.001, versus control group; #P < 0.05, versus surgery group, at the same time point. C: control group; S1, S3, S7: surgery group on days 1, 3, and 7 postoperatively; P1, P3, P7: parecoxib group on days 1, 3, and 7 postoperatively.
j o u r n a l o f s u r g i c a l r e s e a r c h 1 7 8 ( 2 0 1 2 ) e 1 ee 8
e5
Fig. 3 e Parecoxib inhibited hippocampal IL-1b mRNA (A) and protein (B) level enhanced by surgery. Hippocampal IL-1b mRNA and protein were measured on days 1, 3, and 7 postoperatively. Data were expressed as mean ± SD. **P < 0.01, ***P < 0.001, versus control group; #P < 0.05, versus surgery group at the same time point. C: control group; S1, S3, S7: surgery group on days 1, 3, and 7 postoperatively; P1, P3, P7: parecoxib group on days 1, 3, and 7 postoperatively.
following surgical trauma [7,24]. Therefore, in the present study, we chose the aged SD rats as objective animals. The hippocampus is known to play a major role in learning and memory. Recent studies have shown that POCD associates with hippocampal inflammatory response triggered by surgical trauma [7,8,10e13]. Cao et al. [7] found that partial hepatectomy, rather than isoflurane anesthesia, induced hippocampal inflammation, as reflected by the increased expression of proinflammatory cytokines IL-1b, TNF-a, and interleukin 6 (IL-6) and glial cell activation in the hippocampus in aged rats, and resulted in cognitive function impairment. Therefore, in the current work, partial hepatectomy was used to induce neuroinflammation in the hippocampus. The role of COX-2 in partial hepatectomyeinduced hippocampal inflammation was evaluated. COX-2 is a critical regulator in inflammatory disease. The inhibition of COX-2 activity could suppress the inflammatory response and reduce the expression of inflammatory cytokines [25,26]. Our data indicate that surgery significantly increased COX-2 expression, PGE2 production, and IL-1b and
TNF-a expression in the hippocampus in aged rats on postoperative days 1 and 3. Importantly, parecoxib, a selective COX-2 inhibitor, significantly reduced IL-1b and TNFa expression in the hippocampus through downregulation of the COX-2/PGE2 pathway. These results suggest that COX-2 may play a key role in surgery-induced hippocampal inflammation. In addition, proinflammatory cytokine IL-1b and TNF-a may be downstream signaling molecules of the COX-2/PGE2 pathway in the inflammatory process. In recent years, data concerning the contributions of COX-2 to neuroinflammation have been controversial. On one hand, COX-2 is strongly suggested to play a detrimental role in neurodegeneration and stimulation of an inflammatory process that is followed by neuronal death [27e29]. On the other hand, some studies imply that COX-2 may play a neuroprotective role in the central nervous system and its inhibition may aggravate the neuroinflammatory response to central or systemic administration of lipopolysaccharide [30,31]. In the present study, the beneficial effect of COX-2 selective inhibitor on alleviation of the surgery-induced hippocampal
e6
j o u r n a l o f s u r g i c a l r e s e a r c h 1 7 8 ( 2 0 1 2 ) e 1 ee 8
Fig. 4 e Parecoxib inhibited hippocampal TNF-a mRNA (A) and protein (B) level enhanced by surgery. Hippocampal TNF-a mRNA and protein were measured on days 1, 3, and 7 postoperatively. Data were expressed as mean ± SD. **P < 0.01, ***P < 0.001, versus control group; #P < 0.05, ##P < 0.01, versus surgery group, at the same time point. C: control group; S1, S3, S7: surgery group on days 1, 3, and 7 postoperatively; P1, P3, P7: parecoxib group on days 1, 3, and 7 postoperatively.
inflammation implies that COX-2 plays a proinflammatory role in surgery-induced neuroinflammation. Surgery induces not only peripheral inflammatory response, but also neuroinflammatory response. Terrando et al. [12] found that surgical trauma engages the innate immune system through nuclear factor-kBedependent signaling to release cytokines that disrupt blood-brain barrier (BBB) integrity. Through a permeable BBB, peripheral macrophages migrate into the hippocampus, promoting neuroinflammation that upregulates the proinflammatory cytokine expression. A series of evidences indicates that proinflammatory cytokines play a pivotal role in the neuroinflammatory response to surgical trauma [6e13]. Wan et al. [13] recently reported a key role for IL-1b and TNF-a in mediating surgery-induced neuroinflammation in splenectomized rats. Human studies also demonstrated the upregulation of IL-6 in cerebrospinal fluid
after total hip replacement [6]. Other studies have indicated that elevated expression of proinflammatory cytokines results in impairments in long-term potentiation [32,33] and performance deficits in hippocampal-mediated cognitive tests [34,35]. These studies demonstrated the role of proinflammatory cytokines in regulating behavioral and cognitive changes. Therefore, inhibition of the proinflammatory cytokine release in the brain may attenuate the surgery-induced neuroinflammation and prevent POCD. Parecoxib, a selective inhibitor of COX-2, is frequently used for postoperative analgesia. Valdecoxib is the active metabolite of parecoxib. Human studies demonstrated that parecoxib penetrated BBB as early as 15 min and cerebrospinal fluid valdecoxib concentration rapidly reached half maximal inhibitory concentration (1.57 ng/mL) by 17 min after single intravenous injection of parecoxib [36,37]. In the current study, parecoxib treatment inhibited hippocampal proinflammatory
j o u r n a l o f s u r g i c a l r e s e a r c h 1 7 8 ( 2 0 1 2 ) e 1 ee 8
cytokine expression following partial hepatectomy through downregulation of the COX-2/PGE2 pathway. Therefore, parecoxib may be a promising candidate for treatment of surgeryinduced neuroinflammation. There are some limitations in the current work. First, our study emphasized the surgery-induced neuroinflammation in the hippocampus. We did not investigate the changes in cognitive function caused by surgical trauma. Thus, further behavioral investigations are needed to clarify the role of COX2 in POCD. Second, in the present study, we found that COX-2 plays a critical role in surgery-induced neuroinflammation. However, recent studies indicate that COX-1 may also be a major player in the neuroinflammatory process. A proinflammatory role of COX-1 has been reported in several neurodegenerative diseases, including Alzheimer disease [38,39] and Parkinson disease [28]. Therefore, COX-1 may be involved in neuroinflammation induced by surgical trauma. Further studies are needed on this point. Third, parecoxib is a selective inhibitor of COX-2 available for postoperative intravenous analgesia. A series of studies demonstrated that postoperative [40,41] or preoperative administration [42e46] of parecoxib is effective for postoperative pain control after various types of surgery. In our study, we administered parecoxib 1 h prior to hepatectomy to mimic the clinical setting of preoperative administration. However, we did not determine whether postoperative administration of parecoxib would have similar inhibition effects on surgery-induced hippocampal proinflammatory cytokine expression. This question awaits further study. Fourth, in the current study, we focused on the effects of parecoxib on surgery-induced hippocampal proinflammatory cytokine expression. We did not measure the plasma proinflammatory cytokine expression. To evaluate the effects of parecoxib on systemic inflammation induced by surgery would help to elucidate fully the inhibition effects of parecoxib on neuroinflammation. In conclusion, the present study showed that surgery significantly increased COX-2 expression, PGE2 production, and proinflammatory cytokine expression in the hippocampus in aged rats. COX-2 inhibitor parecoxib inhibited surgery-induced hippocampal proinflammatory cytokine expression through downregulation of the COX-2/PGE2 pathway. These results suggested that COX-2 may play a critical role in surgery-induced neuroinflammation, and the COX2 inhibitor may be a promising candidate for treatment of neuroinflammation caused by surgical trauma.
Acknowledgment This work was supported by the National Natural Science Foundation of China (30901393).
references
[1] Moller JT, Cluitmans P, Rasmussen LS, et al. Long-term postoperative dysfunction in the elderly: ISPOCD 1 study. Lancet 1998;351:857.
e7
[2] Rasmussen LS. Postoperative cognitive dysfunction: incidence and prevention. Best Pract Res Clin Anaesthesiol 2006;20:315. [3] Newman MF, Kirchner JL, Phillips-Bute B, et al. Neurological Outcome Research Group and the Cardiothoracic Anesthesiology Research Endeavors Investigators. Longitudinal assessment of neurocognitive function after coronary-artery bypass surgery. N Engl J Med 2001;344:395. [4] Steinmetz J, Christensen KB, Lund T, Lohse N, Rasmussen LS. ISPOCD Group. Long-term consequences of postoperative cognitive dysfunction. Anesthesiology 2009;110:548. [5] Beloosesky Y, Hendel D, Weiss A, et al. Cytokines and C-reactive protein production in hip-fracture-operated elderly patients. J Gerontol A Biol Sci Med Sci 2007;62:420. [6] Buvanendran A, Kroin JS, Berger RA, et al. Upregulation of prostaglandin E2 and interleukins in the central nervous system and peripheral tissue during and after surgery in humans. Anesthesiology 2006;104:403. [7] Cao XZ, Ma H, Wang JK, et al. Postoperative cognitive deficits and neuroinflammation in the hippocampus triggered by surgical trauma are exacerbated in aged rats. Prog Neuropsychopharmacol Biol Psychiatry 2010;34:1426. [8] Cibelli M, Fidalgo AR, Terrando N, et al. Role of interleukin1beta in postoperative cognitive dysfunction. Ann Neurol 2010;68:360. [9] Ka´lma´n J, Juha´sz A, Boga´ts G, et al. Elevated levels of inflammatory biomarkers in the cerebrospinal fluid after coronary artery bypass surgery are predictors of cognitive decline. Neurochem Int 2006;48:177. [10] Rosczyk HA, Sparkman NL, Johnson RW. Neuroinflammation and cognitive function in aged mice following minor surgery. Exp Gerontol 2008;43:840. [11] Terrando N, Monaco C, Ma D, Foxwell BM, Feldmann M, Maze M. Tumor necrosis factor-alpha triggers a cytokine cascade yielding postoperative cognitive decline. Proc Natl Acad Sci U S A 2010;107:20518. [12] Terrando N, Eriksson LI, Ryu JK, et al. Resolving postoperative neuroinflammation and cognitive decline. Ann Neurol 2011;70:986. [13] Wan Y, Xu J, Ma D, Zeng Y, Cibelli M, Maze M. Postoperative impairment of cognitive function in rats: a possible role for cytokine-mediated inflammation in the hippocampus. Anesthesiology 2007;106:436. [14] Vane JR, Bakhl YS, Botting RM. Cyclooxygenases 1 and 2. Annu Rev Pharmacol Toxicol 1998;38:97. [15] Kobayashi Y, Mizoguchi T, Take I, Kurihara S, Udagawa N, Takahashi N. Prostaglandin E2 enhances osteoclastic differentiation of precursor cells through protein kinase Adependent phosphorylation of TAK1. J Biol Chem 2005;280: 11395. [16] Herschman HR. Prostaglandin synthesis 2. Biochim Biophys Acta 1996;1229:125. [17] McGeer PL, McGeer EG. Inflammation and the degenerative disease of aging. Ann N Y Acad Sci 2004;1035:104. [18] Minghetti L. Cyclooxygenase-2 (COX-2) in inflammatory and degenerative brain diseases. J Neuropathol Exp Neurol 2004; 63:901. [19] Minghetti L. Role of COX-2 in inflammatory and degenerative brain diseases. Subcell Biochem 2007;42:127. [20] Reksidler AB, Lima MM, Zanata SM, et al. The COX-2 inhibitor parecoxib produces neuroprotective effects in MPTP-lesioned rats. Eur J Pharmacol 2007;560:163. [21] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402. [22] Melnikova T, Savonenko A, Wang Q, et al. Cycloxygenase-2 activity promotes cognitive deficits but not increased
e8
[23]
[24]
[25]
[26] [27]
[28]
[29]
[30]
[31]
[32]
[33]
[34]
[35]
j o u r n a l o f s u r g i c a l r e s e a r c h 1 7 8 ( 2 0 1 2 ) e 1 ee 8
amyloid burden in a model of Alzheimer’s disease in a sex-dimorphic pattern. Neuroscience 2006;141:1149. Monk TG, Weldon BC, Garvan CW, et al. Predictors of cognitive dysfunction after major noncardiac surgery. Anesthesiology 2008;108:18. Culley DJ, Baxter M, Yukhananov R, Crosby G. The memory effects of general anesthesia persist for weeks in young and aged rat. Anesth Analg 2003;96:1004. Matsuda K, Nakamura S, Matsushita T. Dynastat inhibits nitric oxide production in chondrocytes of ligamentdamaged osteoarthritic rat joints. Rheumatol Int 2006;26:991. Votta BJ, Bertolini DR. Cytokine suppressive anti-inflammatory compounds inhibit bone resorption in vitro. Bone 1994;15:533. Hoozemans JJ, Veerhuis R, Janssen I, van Elk EJ, Rozemuller AJ, Eikelenboom P. The role of cyclooxygenase 1 and 2 activity in prostaglandin E2 secretion by cultured human adult microglia: implications for Alzheimer’s disease. Brain Res 2002;951:218. Teismann P, Tieu K, Choi DK, et al. Cyclooxygenase-2 is instrumental in Parkinson’s disease neurodegeneration. Proc Natl Acad Sci U S A 2003;100:5473. McCoy MK, Martinez TN, Ruhn KA, et al. Blocking soluble tumor necrosis factor signaling with dominant-negative tumor necrosis factor inhibitor attenuates loss of dopaminergic neurons in models of Parkinson’s disease. J Neurosci 2006;37:9365. Aid S, Langenbach R, Bosetti F. Neuroinflammatory response to lipopolysaccharide is exacerbated in mice genetically deficient in cyclooxygenase-2. J Neuroinflammation 2008;5:17. Blais V, Turrin NP, Rivest S. Cyclooxygenase 2 (COX-2) inhibition increases the inflammatory response in the brain during systemic immune stimuli. J Neurochem 2005; 95:1563. Pickering M, Cumiskey D, O’Connor JJ. Actions of TNF-alpha on glutamatergic synaptic transmission in the central nervous system. Exp Physiol 2005;90:663. Perry VH, Cunningham C, Holmes C. Systemic infections and inflammation affect chronic neurodegeneration. Nat Rev Immunol 2007;7:161. Tanaka S, Ide M, Shibutani T, et al. Lipopolysaccharideinduced microglial activation induces learning and memory deficits without neuronal cell death in rats. J Neurosci Res 2006;83:557. Sparkman NL, Kohman RA, Scott VJ, Boehm GW. Bacterial endotoxin-induced behavioral alterations in two variations of the Morris water maze. Physiol Behav 2005;86:244.
[36] Dembo G, Park SB, Kharasch ED. Central nervous system concentrations of cyclooxygenase-2 inhibitors in humans. Anesthesiology 2005;102:409. [37] Mehta V, Johnston A, Cheung R, Bello A, Langford RM. Intravenous parecoxib rapidly leads to COX-2 inhibitory concentration of valdecoxib in the central nervous system. Clin Pharmacol Ther 2008;83:430. [38] Yermakova AV, Rollins J, Callahan LM, Rogers J, O’Banion MK. Cyclooxygenase-1 in human Alzheimer and control brain: quantitative analysis of expression by microglia and CA3 hippocampal neurons. J Neuropathol Exp Neurol 1999;58:1135. [39] Rogers J, Kirby LC, Hempelman SR, et al. Clinical trial of indomethacin in Alzheimer’s disease. Neurology 1993; 43:1609. [40] Tang J, Li S, White PF, et al. Effect of parecoxib, a novel intravenous cyclooxygenase type-2 inhibitor, on the postoperative opioid requirement and quality of pain control. Anesthesiology 2002;96:1305. [41] Malan TP Jr, Marsh G, Hakki SI, Grossman E, Traylor L, Hubbard RC. Parecoxib sodium, a parenteral cyclooxygenase 2 selective inhibitor, improves morphine analgesia and is opioid-sparing following total hip arthroplasty. Anesthesiology 2003;98:950. [42] Desjardins PJ, Grossman EH, Kuss ME, et al. The injectable cyclooxygenase-2-specific inhibitor parecoxib sodium has analgesic efficacy when administered preoperatively. Anesth Analg 2001;93:721. [43] Gan TJ, Joshi GP, Zhao SZ, Hanna DB, Cheung RY, Chen C. Presurgical intravenous parecoxib sodium and follow-up oral valdecoxib for pain management after laparoscopic cholecystectomy surgery reduces opioid requirements and opioid-related adverse effects. Acta Anaesthesiol Scand 2004; 48:1194. [44] Gan TJ, Joshi GP, Viscusi E, et al. Preoperative parenteral parecoxib and follow-up oral valdecoxib reduce length of stay and improve quality of patient recovery after laparoscopic cholecystectomy surgery. Anesth Analg 2004; 98:1665. [45] Bajaj P, Ballary CC, Dongre NA, Baliga VP, Desai AA. Role of parecoxib in pre-emptive analgesia: comparison of the efficacy and safety of pre- and postoperative parecoxib in patients undergoing general surgery. J Indian Med Assoc 2004;102:272. [46] Neuss H, Koplin G, Haase O, Reetz C, Mall JW. Preemptive analgesia reduces pain after radical axillary lymph node dissection. J Surg Res 2010;162:88.