The cytosolic protein GRP1 facilitates abscisic acid- and darkness-induced stomatal closure in Salvia miltiorrhiza

Journal of Plant Physiology 245 (2020) 153112

Contents lists available at ScienceDirect

Journal of Plant Physiology journal homepage: www.elsevier.com/locate/jplph

The cytosolic protein GRP1 facilitates abscisic acid- and darkness-induced stomatal closure in Salvia miltiorrhiza

T

Yuanchu Liua,1, Wen Maa,1, Wen Zhoua, Lin Lia, Donghao Wanga, Bin Lia, Shiqiang Wanga, Yiqin Panb, Yaping Yana,*, Zhezhi Wanga,* a National Engineering Laboratory for Resource Development of Endangered Crude Drugs in Northwest China, Key Laboratory of Medicinal Resources and Natural Pharmaceutical Chemistry, Ministry of Education, College of Life Sciences, Shaanxi Normal University, Xi’an, Shaanxi, 710119, China b Gaofeng School, Shenzhen, Guangdong, 518109, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Salvia miltiorrhiza Bunge SmGRP1 Stomatal movement Glutamic acid-rich protein

By screening an expressed sequence tag (EST) library of Salvia miltiorrhiza, we detected an acidic protein, SmGRP1, with no significant similarities to the other sequences in public databases. SmGRP1 encodes a peptide of 151 amino acids, 33.77 % of which are glutamic acid residues, and the peptide was positive according to “stains-all” staining. Expression analysis revealed that SmGRP1 was expressed in all examined tissues of S. miltiorrhiza but was most highly expressed in the leaves and stems. Without a signal peptide, SmGRP1 localized to the cytoplasm in protoplasts in subcellular localization experiments. SmGRP1 expression was prominently enhanced by ABA and darkness treatments; the protein could also be induced by high temperature, NaCl, and dehydration treatments, while low temperature suppressed its expression. Furthermore, although there were no obvious phenotypic differences in SmGRP1 overexpression and SmGRP1 knockdown mutants compared with control plants under normal culture conditions, the stomata of the knockdown lines remained open when treated with ABA, darkness, NO, and H2O2. In addition, the water loss rate of the knockdown mutants was faster than that of the control lines and overexpression mutants when exposed to air. These observations indicate that SmGRP1 is a novel acidic protein with potential calcium-binding capability and is involved in stomatal movement and stress resistance.

1. Introduction Salvia miltiorrhiza Bunge is a well-known traditional Chinese herb. Its root contains hydrophilic caffeic acid-derived phenolic acids and various lipophilic tanshinones, which have been formulated and broadly used clinically for the treatment of various diseases (Zhou et al., 2005; Wang et al., 2006). Increased attention has been paid to S. miltiorrhiza due to its varied and diverse pharmacological properties (Song and Wang, 2009). To obtain a broad view of the genetic background of S. miltiorrhiza, we established a high-throughput gene transformation method and recently constructed a large-scale EST library of S. miltiorrhiza (Yan and Wang, 2007; Yan et al., 2010). The EST library and high-throughput gene transformation method constituted a good platform for S. miltiorrhiza genetic background analyses. Screening of the EST database of S. miltiorrhiza resulted in the

discovery and further characterization of many genes involved in stress responses; in addition, a highly expressed gene named SmGRP1 generated great interest because its sequence showed no significant similarities with sequences in public databases. According to bioinformatic analyses, this gene encodes a protein composed of 151 amino acid residues. Although no sequence similarity was found among public databases, the encoded protein of this gene has a unique character: it is rich in glutamic acid residues, as 51 of 151 amino acid residues are glutamic acid. In recent years, several glutamic acid-rich proteins in plants have been reported. In 1997, Liu et al. reported the first plant glutamic acidrich protein, the pollen-specific GARP protein from potato. In 2000, Yuasa and Maeshima cloned a novel glutamic acid-rich protein, RVCaP, from radish vacuoles. They reported that this protein has Ca2+-binding activity. Recently, RVCaB was suggested to be a naturally unstructured

⁎

Corresponding authors. E-mail addresses: [email protected] (Y. Liu), [email protected] (W. Ma), [email protected] (W. Zhou), [email protected] (L. Li), [email protected] (D. Wang), [email protected] (B. Li), [email protected] (S. Wang), [email protected] (Y. Pan), [email protected] (Y. Yan), [email protected] (Z. Wang). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.jplph.2019.153112 Received 21 August 2019; Received in revised form 25 December 2019; Accepted 26 December 2019 Available online 07 January 2020 0176-1617/ © 2019 Published by Elsevier GmbH.

Journal of Plant Physiology 245 (2020) 153112

Y. Liu, et al.

obtained a putative novel gene that was highly expressed in our EST database. Due to the 3’-poly (A) sequences listed for the unigene, we confirmed that the full sequence of the 3’ end had been obtained. To obtain the full-length sequence and its 5’ flanking region, genome walking was performed using a Universal Genome Walker Universal Kit (Clontech, USA) following the manufacturer’s instructions. Cloning of the upstream fragment of the known sequence consisted of two individual PCR amplifications, and each amplification consisted of two PCRs. The primary PCR used the outer adaptor primer AP1 provided in the kit and an outer gene-specific primer GSP1 that was designed based on the known sequences. Reactions were performed in a PTC-200 thermocycler (BioRad, USA) for 1 min at 94 °C; 7 cycles of 2 s at 94 °C and 3 min at 72 °C; and then 32 cycles of 2 s at 94 °C and 3 min at 67 °C. After the final cycle, the amplification was extended for 4 min at 67 °C. The primary PCR product mixture was then diluted at a ratio of 1:10 and used as a template for nested PCR with the nested adaptor primer AP2 provided in the kit and a nested gene-specific primer GSP2 designed from the known sequences. The reaction was performed as follows: 1 cycle (1 min predenaturation at 94 °C), 5 cycles (2 s denaturation at 94 °C and 3 min at 72 °C), 20 cycles (2 s denaturation at 94 °C and 3 min at 67 °C), and then an extension for 7 min at 67 °C. The PCR products were purified using a gel extraction kit (U-gene, China), cloned into a pGEM T-easy vector (Promega, USA) and then sequenced by TaKaRa Biotechnology Co., Ltd. (Dalian, China). According to the sequences of the primary DNA walking reactions, gene-specific primers for the second DNA walking reaction, GSP3 and GSP4, were designed and separately coupled with AP1 and AP2 for the second DNA walking process. The thermal profiles were the same as those described above.

protein (i.e., an intrinsically unstructured protein) by biochemical and physical methods (Ishijima et al., 2007). Afterward, CCaP1 from Arabidopsis (Ide et al., 2007) and P54 and Pt2L4 from cassava (Zhang et al., 2003; de Souza et al., 2006, 2009) were also cloned. Although several plant glutamic acid-rich proteins have been reported, all the published sequences showed no sequence similarities except that their protein sequences were rich in glutamic acid residues. Most of the relevant literature mainly focused on the expression patterns of this type of protein; the functions of these types of genes remain unknown. Here, we report a novel acidic protein with a high glutamic acid residue composition via EST library screening. Its tissue-specific expression patterns and gene expression responses to physiological stimuli and light conditions were characterized. The functions of the various stress-related responses were revealed by “gain” and “loss” of function analyses. 2. Materials and methods 2.1. Plant material Mature seeds of S. miltiorrhiza were surface sterilized as described previously (Yan and Wang, 2007) and cultured on MS basal media (Murashige and Skoog, 1962) for germination. The cultures were maintained at 25 ± 2 °C under a 16 h light/8 h dark photoperiod, with light provided by cool-white fluorescent lamps at an intensity of 25 μmol m−2 s-1. One-month-old seedlings were used for DNA and RNA isolation and various stress treatments. 2.2. Treatments used for gene expression analysis For the abscisic acid (ABA) treatment, the seedlings were soaked at a final concentration of 10 μM and 100 μM ABA. Samples were collected after 0, 1, 3, 6, and 12 h. Dehydration was achieved by replacing the MS media with dry filter paper. Samples were collected at 0, 1, 3, 6, and 12 h. after treatment. For the dark treatment, seedlings were cultured in the dark and collected after 0, 1, 3, 6, and 12 h of treatment. High- and low-temperature treatment was carried out at 42 °C and 4 °C, respectively, and samples were collected at 0, 1, 3, 6, and 12 h after treatment. For the NaCl treatment, the roots of seedlings were soaked at a final concentration of 100 mM NaCl. Samples were collected after 0, 1, 3, 6, and 12 h of treatment. The wounding treatment was imposed on the leaves of seedlings by cutting. Samples were collected at 0, 0.5, 1, 2, and 3 h after wounding. All the samples and were immediately frozen in liquid nitrogen and stored at −80 °C before RNA purification.

2.5. Sequence analysis The amino acid sequence of SmGRP1 was deduced and analyzed with the ProtParam tool (http://cn.expasy.org/tools/protparam.html). Both DNA and protein sequences were analyzed regularly using online tools.

2.6. Recombinant, purification, and identification of calcium binding capacity of SmGRP1 cDNA of SmGRP1 was amplified by PCR with Recom primers using high-fidelity DNA polymerase (Vazyme), and the amplified DNA fragment was inserted into a pet-28a plasmid vector. The vector was introduced into E. coli BL21 (DE3). The transformants were grown in LB broth supplemented for 4 h at 30 °C after induction with 0.5 mM isopropylthio-b-D-galactopyranoside. The cells obtained by centrifugation of 50 ml of the induced culture were resuspended, shaken at 4 °C for 1 h, and then lysed by sonication on ice. The cellular debris was removed by centrifugation at 14,000 rpm for 30 min. The supernatant was subsequently loaded onto equilibrated resin. The column was then washed with 10 ml of wash buffer (40 mM imidazole, 50 mM NaH2PO4, 300 mM NaCl, pH 8.0), and the bound proteins were eluted with 2 ml of elution buffer (100 mM imidazole, 50 mM NaH2PO4, 300 mM NaCl, pH 8.0). The stains-all stain and gel electrophoresis analyses were performed as described previously (Moscatiello et al., 2015).

2.3. Isolation of DNA and RNA Genomic DNA was isolated from the leaves of one-month-old seedlings using the modified CTAB method (Doyle and Doyle, 1987). Total RNA was isolated from the seedlings of different treatments using Trizol reagent (BioFlux, China) according to the manufacturer’s instructions. The quality and concentration of genomic DNA and RNA were determined via 1.0 % agarose gel electrophoresis and spectrophotometry (Shimadzu UV-2450, Japan) analyses. 2.4. Cloning of the full-length SmGRP1 and its 5’-flanking region When screening the unigenes of S. miltiorrhiza we previously obtained, we found that a contig consisting of 11 separate ESTs had not been annotated. The eleven ESTs (GenBank accession numbers: CV170783, CV169581, CV168133, CV166426, CV165163, CV164089, CV164000, CV162550, CV167846, CV1164995, and CV166122) were retrieved from the database, after which the vector, adaptor, and primer sequences were removed manually. A contig was reassembled from overlapping ESTs using the EST Assembly Machine tool on WorldWide Web (http://www.tigem.it) (Borsani et al., 1998). Thus, we

2.7. Protoplast isolation and subcellular localization Arabidopsis plants were grown under 12 h light/12 h darkness for four weeks; fully expanded leaves were used to isolate protoplasts. The isolation and transient protoplast transformation were performed as described previously (Tian et al., 2015). 2

Journal of Plant Physiology 245 (2020) 153112

Y. Liu, et al.

acid (X-gluc), as described by Hull and Devic (1995). Leaves from the promoter-GUS transformants were cut and immersed in MES/KCl (10 mM MES/KOH, 50 mM KCl, 100 μM CaCl2, pH 6.15) buffer with different treatments (100 μM ABA or 300 mM NaCl under normal light conditions at 25 °C, 40 °C under normal light conditions for 3 h, 4 °C under normal light conditions for 12 h, or under darkened conditions at 25 °C for 24 h); leaves immersed in MES/KCl under normal light and temperature conditions were used as untreated controls. The separated organs were then immersed in a 1 mM X-gluc solution with 100 mM sodium phosphate (pH 7.0) and 0.1 % Triton X-100, and after vacuum was applied for 5 min, the tissues were incubated at 37 °C for 12 h. The tissues were then cleared by immersing them in 70 % ethanol. To circumvent differences in the different transformants, for each experiment, a few leaves from the same plant and at the same positions were used for the controls and treatments.

2.8. Construction of SmGRP1 overexpression and RNAi silencing vectors and plant transformation The full-length SmGRP1 cDNA was amplified from the cDNA template of 24-h dark-treated leaves of S. miltiorrhiza using the primer pair consisting of SmGRP1F, which contains a KpnI restriction site (underlined), and SmGRP1R, which contains a HindIII restriction site (underlined). The PCR products were then cloned into a pGEM T-easy cloning vector for sequencing. The appropriate DNA fragment was released from the T vector using KpnI and HindIII restriction enzymes and then ligated into a KpnI and HindIII double-digested pKANNIBAL vector. The inserted SmGRP1 coding region was linked to the cauliflower mosaic virus (CaMV) 35S promoter in pKANNIBAL (Wesley et al., 2001). The transformation cassette was spliced out of pKANNIBAL via a NotI digest and subcloned into the unique NotI site of the binary plasmid pART27 containing an NPTII selection marker gene. For SmGRP1 silencing vector construction, two PCR fragments of 270 bp each were generated from the SmGRP1 cDNA clone and cloned as XhoI/ KpnI and BamHI/ClaI fragments into the cloning sites of pKANNIBAL to create an inverted repeat transgene separated by a PDK intron. The primer pairs used in this experiment included RNAiSF and RNAiSR as well as RNAiRF and RNAiRR, which are listed in Table 1 (restriction sites underlined). The resulting plasmids pSmGRP1-OE and pSmGRPRNAi were transformed into Agrobacterium tumefaciens EHA105 by electroporation. All the constructs were then transformed into S. miltiorrhiza via the A. tumefaciens-mediated method we established previously (Yan and Wang, 2007).

2.10. Real-time PCR measurements RNA for real-time RT-PCR was prepared as described above, and 1 μg of total RNA was used for reverse transcription reactions with MMLV reverse transcriptase (Promega, USA). Quantitative PCR was carried out using a BioRad iCycler iQ5 apparatus in a 25 μl final volume. The standard thermal profile was as follows: 94 °C for 1 min, followed by 40 cycles of 95 °C for 10 s, 60 °C for 20 s, and 82 °C for 15 s to measure the fluorescence signal. Melting curve analysis was performed from 50 °C to 95 °C using Dissociation Curve software (BioRad iQ5 Optical System Software, release version 1.1.1442.0 FAS). Ubiquitin was used as a quantification control. Reactions with the cDNA template replaced by nuclease-free water were run with each primer pair as blank controls. Quantification consisted of at least three independent replicates. The specific primers SmGRP1RealF and SmGRP1RealR to amplify SmGRP1 and SmUbiRealF and SmUbiRealR to amplify ubiquitin are listed in Table 1.

2.9. Promoter-GUS reporter constructs and histochemical analysis The putative promoter of SmGRP1 (-1851 to +81 from the predicted transcription start site) was amplified from genomic DNA by PCR using the primers SmProF and SmProR. The resulting fragments were ligated into the cloning vector pGEM T-easy (Promega) for sequencing. The right clone was then digested by HindIII and NcoI and ligated to the binary vector pCAMBIA-1391Z, which contains the DNA sequence for β-glucuronidase (GUS). The chimeric constructs were subsequently introduced into Agrobacterium tumefaciens strain EHA105 by electroporation, which were then used to transform S. miltiorrhiza plants. T0 plants were used for GUS analysis. The β-glucuronidase (GUS) activity in the transgenic plants was analyzed by histochemical staining using the chromogenic substrate 5-bromo-4-chloro-3-β-D-glucuronic

2.11. Stomatal bioassays Stomatal opening and closing were monitored according to the method of McAinsh et al. (1996), with slight modifications. To study the function of the SmGRP1 protein in S. miltiorrhiza stomatal aperture, freshly prepared abaxial epidermis from randomly selected overexpression and knockdown T0 transformants was incubated in MES/ KCl buffer, which included various treatment reagents (100 μM ABA, 100 μM sodium nitroprusside (SNP), 100 μM H2O2 and 100 μM NaCl) under light (300 μmol m−2 s-1) conditions at 25 °C for 2 h or 3 h. Final stomatal apertures were determined with a light microscope and an eyepiece graticule previously calibrated with a stage micrometer. To study the effects of SmGRP1 on darkness-induced stomatal closure, preopened strips were incubated in MES/KCl buffer for 3 h in darkened conditions at 25 °C. Final stomatal apertures were recorded. The stomatal conductance analyses were performed as described previously (Sierla et al., 2018). To avoid any potential rhythmic effects on stomatal aperture, experiments were always started at the same time of day. In each experiment, we recorded 30–40 randomly selected apertures per replicate, and the treatments were repeated three times. The data presented are the means ± SEs.

Table 1 Primers used in the experiment. Primer name

Sequence (5’-3’)

AP1 AP2 GSP1 GSP2 GSP3 GSp4 SmGRP1F SmGRP1R RNAiSF RNAiSR RNAiRF RNAiRR SmProF SmProR SmGRP1RealF SmGRP1RealR SmUbiRealF SmUbiRealR SmGRP1-pet28aF SmGRP1-pet28aR SmGRP1-HBTF SmGRP1-HBTR

GTAATACGACTCACTATAGGGC ACTATAGGGCACGAGTGGT CTCGGCTTCAGCAACTGCAGCTTCCT GGTGCCTCAACTGGAGCGACGATCTCT GCACATGGTGGAGGCCAATTTCACAT CCTTTTTCTTGAACGGCTTCTTCTGGT CCGCTCGAGATGGCAGCAGTTGAGGTTGAATCA CCCAAGCTTTCACTCCTCAGCTTTCTCAACTGG CCGCTCGAGGCAGTTGAGGTTGAATCAGT GGGGTACCTGCCTCTTTCTCTGGGACA GGCGGATCCGCAGTTGAGGTTGAATCAGT GTATCGATTGCCTCTTTCTCTGGGACA CCAAGCTTCCAACCCCACCATTCTATCTCTTAA CACCATGGTGTAATGTGAAGAGTGGTGAAGGAGTAA AGCGGCGGTGACGGAAGAAGTAG CTCCTTTGTCTCGGCTGGCTCCTC ACCCTCACGGGGAAGACCATC ACCACGGAGACGGAGGACAAG CGGAATTCATGGCAGCAGTTGAGGTTGAAT CCAAGCTTCTCCTCAGCTTTCTCAACTG GGGGTACCATGGCAGCAGTTGAGGTTGAAT CACCATGGGCTCCTCAGCTTTCTCAACTGGG

2.12. Water loss measurements For water loss measurements, one-month-old randomly selected transformants were carefully removed from the culture media and immediately weighed, after which they were placed at 22 °C under continuous light and a RH of 50 %. Weights were measured at designated time intervals. There were three replicates for each transgenic line. The percent loss of fresh weight was calculated based on the initial weight of the plants. The experiment was carried out three times 3

Journal of Plant Physiology 245 (2020) 153112

Y. Liu, et al.

Fig. 1. (A) The predicted cis-elements, which represent the promoter sequences of SmGRP1, are labeled by a dark line,. The sense elements are located above the line, and the reverse elements are located below the line. (B) Expression of SmGRP1 under 10 and 100 μmol l−1 ABA, 100 mmol l−1 NaCl, dehydration, darkness, wounding, high and low temperature.

(U42640), and Populus trichocarpa (A9P8H5). Multialignment analysis by Clustal W indicated that these kinds of proteins showed very small similarities to each other (approximately 30 %). In addition, the functions of all the proteins were annotated as just unknown proteins or expressed proteins. The most commonly shared characteristic of these proteins is their abundant glutamic acid residue composition (more than 30 % of the amino acid residues are glutamic acid), especially for S. miltiorrhiza, in which 51 of 151 amino acid residues are glutamic acid. The gene cloned in this experiment was therefore designated as SmGRP1 (Salvia miltiorrhiza Glutamic acid-Rich Protein 1). ExPASy software (http://www.expasy.org) was used to calculate the theoretical isoelectric point (pI) and the molecular weight (MW) of the SmGRP1 protein, which were predicted to be 3.79 and 15.801 kDa, respectively, with an instability index of 103.93, implying that SmGRP1 is an unstable acidic protein. The Self-optimized Prediction Method with Alignment (SOPMA) web-based tool (http://npsa-pbil.ibcp.fr/cgibin/npsa_automat.pl?page=/NPSA/npsa_sopma.html) revealed that SmGRP1 was a predominantly α-helical protein that mainly consisted of ɑ-helices (61.59) and random coils (31.13 %), while sheets (5.03 %) and beta-turns (1.99 %) also were present. Furthermore, a ProtScale analysis (http://www.expasy.ch/tools/protscale.html) showed that SmGRP1 is a hydrophilic protein, and via analyses involving the SignalP 3.0 Server (http://www.cbs.dtu.dk/services/SignalP) and the TMHMM 2.0 Server (http://www.cbs.dtu.dk/services/TMHMM), it was determined that there is no signal peptide or transmembrane segment in SmGRP1. When the above predictions were combined, it was determined that SmGRP1 is a novel gene highly expressed in the S. miltiorrhiza stressrelated EST library. Determining its functional properties will be helpful for elucidating the mechanisms used by plants to adapt to the environment. Given the paucity of information on the functional characteristics of SmGRP1, as a first step, bioinformatic tools were used to analyze the cis-acting elements within the 5’-flanking region of SmGRP1

independently. 3. Results 3.1. Identification of the SmGRP1 gene By screening the stress-related EST library of S. miltiorrhiza, we found a highly expressed unigene. The high expression level of this putative gene implied that it might be a novel stress-related gene, given that most stress-related genes were highly expressed in the library (unpublished data). After manually removing the vector, adaptor, and primer sequences of the 11 retrieved ESTs, a 696 bp long sequence was obtained from overlapping ESTs; this sequence contained a 456 bp long ORF and had a putative poly (A) signal in the putative 3’UTR. Based on the preliminary sequence data, the full-length DNA sequence of this gene was obtained via genome walking technology. The sequence was 2949 bp in size and consisted of a 1932 bp long 5’ flanking region, a 181 bp long 3’ UTR, and 837 bp long coding regions that were composed of two exons and an intron of 381 bp. Moreover, the intron had typical characteristics of plant introns, being rich in A + T (64.8 %) and having a standard GT/AG splicing site. The sequence was deposited in GenBank, and the accession number is DQ868769. Additionally, the complete cDNA sequence was amplified by primers designed from the gene. The full-length cDNA sequence contains a 456 bp ORF encoding a 151-amino acid protein. BlastX searches in the NCBI and WU-BLAST databases revealed that there was no significant similarity within the databases. When using Fasta3 to perform homology searches against PDB sequences, we found 10 low-similaritymatched sequences; these gene sequences were from Oryza sativa (AK073885), a Saccharum hybrid cultivar (AY781900), Capsicum annuum (AY466602), Arabidopsis thaliana (AY086900), Beta vulgaris subsp. Vulgaris (AJ278989), Vitis vinifera (AJ237987), Prunus armeniaca (AF134731), Fagopyrum esculentum (D87983), Hevea brasiliensis 4

Journal of Plant Physiology 245 (2020) 153112

Y. Liu, et al.

in vitro treatment with 100 μM ABA (Fig. 2A and B). GUS activity was also highly increased in response to darkness (Fig. 2C and D). The expression of SmGRP1 in different root, stem, and leaf tissues was first tested using real-time qPCR analysis. The expression levels of SmGRP1 in the leaves and stems were nearly the same but were 13-fold higher than those in the roots. The results indicated that SmGRP1 was expressed most highly in the leaves and stems compared with roots. Treatment with ABA and darkness increased the SmGRP1 expression in leaves and stems; however, the increase was not observed in the roots, indicating that the SmGRP1 was inducible in leaves and stems (Fig. 2E and F). Both of the results confirmed our hypothesis that SmGRP1 is a stress-related protein in S. miltiorrhiza and may have a role in the process that helps plants resist stress conditions. However, the functional profile of this novel protein as well as how SmGRP1 participates in the stress resistance process remains unknown.

to obtain information on the gene’s expression properties. A 2000 bplong 5’-flanking fragment upstream from the start codon of SmGRP1 was obtained from S. miltiorrhiza genomic DNA. By the use of Neural Network Promoter Prediction Analysis software, the putative transcription start site of this gene was identified and defined as “+1”; it is located 81 bp upstream from the start codon ATG. The MatInspector database search program was then used to predict the putative transcription factor binding sites in this region. The locations of the predicted cis-elements are shown in Fig. 1A. Most importantly, the MatInspector analysis revealed that there are three main groups of cis-acting elements related to abiotic or biotic stress, hormone responses, and light regulation, such as ABRE-motifs, DRE2-motifs, ABRE-like ERD-motifs, DRE/CRT-motifs, and W-boxes. All the predicted cis-element information revealed that the expression of SmGRP1 may be regulated by stress treatments or signals, such as light, ABA, wounding, dehydration, and high or low temperature. These results provide substantial information on the expression pattern analysis of SmGRP1.

3.3. SmGRP1 is a potential calcium-binding protein in the cytoplasm To determine whether SmGRP1 has calcium-binding capabilities, the SmGRP1 protein was purified through the prokaryotic expression system, and the SmGRP1 CDS sequence lacking a termination codon was amplified and then inserted into a pET-28a vector, which was subsequently transformed in a BL21 (DE3) host cell. The SmGRP1 recombinant protein was expressed by the induction of IPTG. The SmGRP1 protein in the supernatant and the protein purified with a 6x His label were analyzed by SDS-PAGE. After being separated by SDSPAGE electrophoresis, the SmGRP1 recombinant protein dyed red in the stains-all experiment (Fig. 3A). The positive result suggested that SmGRP1 is a calcium-binding protein that is analogous to RVCaB (Ishijima et al., 2007). The sequence of the SmGRP1-GFP fusion protein was amplified and inserted into an HBT-GFP-NOS vector, which was then transfected into Arabidopsis thaliana protoplasts. As a potential calcium buffer protein, SmGRP1-GRP is located in the cytoplasm, and the subcellular localization of SmGRP1 determines its main function in the calcium signaling pathway (Fig. 3B). To confirm whether SmGRP1 has the capacity to bind Ca2+, the test gel electrophoresis method was performed. The SmGRP1 protein was separated in 12.5 % SDS-PAGE gel in the presence of 1 mM EGTA or 1 mM CaCl2. The AtCCaP1 protein served as a positive control. In the presence of Ca2+, the SmGRP1 and AtCCaP1 migrated slightly slower than in the gel with EGTA. The slower migration of SmGRP1 and AtCCaP1 in Ca2+ compared to the proteins in Ca2+ chelator indicated that these proteins may

3.2. Expression pattern of SmGRP1 and its responses to stress In view of the cis-element prediction results mentioned above, it appears that SmGRP1 expression correlates closely with some stresses. The transcript level of SmGRP1 was upregulated by ABA, NaCl, dehydration, dark, wounding, and high temperature but was downregulated by low temperature. Most interestingly, the expression level of SmGRP1 was highly regulated by ABA and darkness. Treatment with 10 μM and 100 μM ABA for 6 h and 12 h both increased the expression level. The differences were statistically significant compared to the control groups; dark treatment for 12 h had similar effects. The expression of SmGRP1 was also up-regulated by 100 mM NaCl in 1 h and dehydration in 3 h and 6 h. SmGRP1 expression increased rapidly in 0.5 h after the wounding. SmGRP1 increasingly expressed under the high-temperature treatment in 1 h and 6 h. On the contrary, the expression was suppressed by low temperature (Fig. 1B). To determine the expression pattern in detail, the 1932 bp DNA fragment upstream of the SmGRP1 ATG start codon was fused to the β-D-glucuronidase (GUS) gene, after which the construct was transformed into S. miltiorrhiza. Histochemical staining revealed that GUS activity was detected in the leaves which were cultured routinely. Therefore, in subsequent experiments, leaves were selected as the target organ to test the effects of different treatments on GUS activity. GUS activity increased in the leaves after 3 h of

Fig. 2. Expression of SmGRP1 under different treatments as revealed by GUS staining analysis of promoter-GUS transformants. To circumvent differences in different transformants, for each comparison set, a few leaves from the same plant and at the same positions were used for the controls and treatments. (A, B) Control and treated with 100 μM ABA for 3 h; (C, D) Control and treated with darkness for 24 h. The scale bar represents 50 mm. (E, F) Expression of SmGRP1 in different tissue under 100 μM ABA and darkness.

5

Journal of Plant Physiology 245 (2020) 153112

Y. Liu, et al.

Fig. 3. (A) Recombinant SmGRP1 expressed in BL21 cells transformed with the cDNA of GRP1 and treated with 10 mM IPTG. The supernatant of the lysate (lane 1) and purified protein (lane 2) was subjected to SDS-PAGE, and the gel was stained with “stains-all”, M: Marker. (B) Subcellular localization of SmGRP1 in Arabidopsis mesophyll protoplasts. 35S::GRP1GFP was transiently expressed in Arabidopsis mesophyll protoplasts. Scale bars, 10 mm. (C) Purified (left) proteins and supernatant (right) were electrophoresed on 12.5 % SDS-PAGE in the presence of 1 mM EGTA or 1 mM CaCl2; the SmGRP1 shifted slower in Ca2+ compared with that in EDTA; AtCCaP1 was used as a positive control.

be capable of binding Ca2+ (Fig. 3C).

described in the Methods section to investigate whether there are differences between SmGRP1 knockdown or overexpression transgenic lines and controls. As shown in Fig. 5A, when exposed to the environment, water in the overexpression lines was lost more slowly than that in the controls, while the knockdown transgenic lines lost water more rapidly. Thus, overexpression of SmGRP1 can enhance drought tolerance, while knockdown of SmGRP1 can decrease drought tolerance. These results thus suggest that SmGRP1 plays a role in plant drought responses, perhaps helping plants resist stress conditions by slowing the rate of water loss. To investigate whether the expression of SmGRP1 was associated with drought tolerance, stomatal conductance was tested in WT, overexpression, and RNAi lines in different days of drought stress. At one day of drought treatment, the transgenic lines and WT showed similar stomatal conductance. At three days, a slower decline of stomatal conductance in RNAi lines was observed (Fig. 5B). The higher conductance in RNAi lines indicated that the SmGRP1

3.4. Growth phenotypes of SmGRP1 knockdown and overexpression plants To determine the in vivo functions of SmGRP1, we applied reverse genetics (RNAi technology) and overexpression approaches. All transgenic plants were confirmed by real-time PCR for SmGRP1 knockdown or overexpression (Fig. 4). Some of the SmGRP1 knockdown or overexpression transgenic lines were randomly selected for phenotypic analysis. In MS growth media, no obvious differences were observed between the wild type and the knockdown or overexpression transgenic lines (data not shown). Due to the expression pattern of SmGRP1, which is mostly expressed in the leaves and induced by various stress treatments, it was expected that the overexpression and knockdown plants would have altered responses to water-deficit conditions. To test this hypothesis, we performed water-loss-measurement experiments as

Fig. 4. Changes in SmGRP1 expression in different randomly selected overexpression or knockdown transgenic lines. (A) Knockdown transgenic lines (RNAi); (B) Overexpression transgenic lines (OE). 6

Journal of Plant Physiology 245 (2020) 153112

Y. Liu, et al.

Fig. 5. (A) Water loss rates of different transgenic lines of S. miltiorrhiza, including control, RNAi-1, RNA-6, RNAi-12, OE-1, OE-4, and OE-20 lines. (B) Stomatal conductance of control, RNAi-1, and OE-1 lines under the drought stress.

All of the above results suggest that SmGRP1 is one of the most important elements involved in ABA-, darkness-, and stress-induced stomatal movement pathways. SmGRP1 expression is necessary for ABA-, darkness-, and some stress signal-induced stomatal closure; thus, SmGRP1 can protect plants against stress conditions by regulating stomatal movement. Thus, SmGRP1 is a novel acidic protein involved in stomatal movement and is presumed to play important roles in plant stress resistance.

participated in the stomatal closure at the early stage of drought stress.

3.5. SmGRP1 plays a role in ABA- and darkness-induced stomatal closure SmGRP1 is highly expressed in the leaves; ABA and darkness can greatly increase SmGRP1 expression levels; SmGRP1 transcription is upregulated by some drought-related conditions (dehydration and NaCl); and SmGRP1 is necessary for slowing the rate of water loss in plants under stress conditions. Combining these results, we propose that SmGRP1 may play a role in regulating the stomatal movement in S. miltiorrhiza under stress conditions. The difference in the water loss rates of SmGRP1 overexpression and knockdown plants could be attributed, at least in part, to stomata-controlled transpiration. Thus, the leaves of some SmGRP1 overexpression and knockdown S. miltiorrhiza transgenic lines were examined to determine the stomatal aperture status under ABA and darkness treatments. Stomatal closure is a key ABA-controlled process that determines the rate of transpiration under water-deficit conditions (Chinnusamy et al., 2008; Bari and Jones, 2009). To investigate whether SmGRP1 is involved in ABA-related stomatal closure, we treated leaves of three genotypes with ABA to analyze their stomatal aperture. Indeed, testing the leaf epidermis of 35S-SmGRP1 plants with ABA caused complete closure of the stomata (Fig. 6A); even without ABA treatment, the stomata of 35S-SmGRP1 plants were much smaller than those of the wild type and remained closed. When compared to those of wild-type plants, the stomata of SmGRP1 knockdown plants remained nearly fully open. Salinity stress generated a similar phenotypic consequence. Treatment with 100 mM NaCl, the knockdown plants abolished the closure (Fig. 6J). Thus, SmGRP1 may play a crucial role in NaCl- and ABA-mediated guard cell control. Darkness is also one of the main factors in inducing stomatal closure. Because the SmGRP1 expression level is closely related to darkness treatment, the roles played by SmGRP1 in darkness-induced stomatal closure were also tested. Similar results compared with those from ABA treatment were obtained. In the wild-type controls, the stomata closed after darkness treatment, while the stomata of the SmGRP1 knockdown transgenic lines remained open (Fig. 7), suggesting that SmGRP1 may also play an important role in darkness-mediated stomatal closure. Moreover, a great body of accumulating evidence suggests that H2O2 and NO function as signaling molecules in plants, mediating a range of responses to environmental stress (Bright et al., 2006). In particular, both NO and H2O2 can affect stomatal movement. They can induce stomatal closure and enhance plant adaptive responses against drought stresses. They are both necessary and involved in ABA and light/dark-regulated stomatal movement. Exogenous SNP (an NO supplier) and H2O2 can induce stomatal closure. As shown in this experiment, SmGRP1 may play a crucial role in ABA- and darkness-induced stomatal closure. When treated with H2O2 or SNP for 3 h, the stomata of wild-type control plants closed, while the stomata of SmGRP1 knockdown transgenic lines remained open (Fig. 6H and I).

4. Discussion By screening the EST library combined with genetic methods, we identified a novel protein, SmGRP1. Sequence analysis showed that SmGRP1 lacks putative localization signals for organelles such as the ER, mitochondrion, plastid, vacuole, or nucleus. As a strongly acidic protein, it seemed not to enter into the nucleus after translation, strongly suggesting its localization to the cytosol according to sequence analysis with PSORT (http://psort.ims.u-tokyo.ac.jp). The abundance of glutamic acid residues supports the helical structure of the polypeptide, as estimated by the Chou-Fasman method (Argos et al., 1978); however, SmGRP1 was suggested to be an unstructured (unfolded) protein by FoldIndex (http://bip.weizmann.ac.il/fldbin/findex) (Prilusky et al., 2005) and DisEMBL 1.4 (http://dis.embl.de) (Linding et al., 2003) analyses. BlastX in the NCBI database or WU-BLAST on the EBI website revealed no significant matches, which implies that SmGRP1 is a completely novel gene. Because it is highly expressed in our EST library, we think SmGRP1 plays a functional role in plant growth and development. Several matched sequences were found in different plant species. Although identities were very low between different matched sequences, they showed a similar sequence composition characteristic, i.e. richness in glutamic acid residues; more than 30 % of the amino acid residues were glutamic acid in all of the proteins. Interestingly, when the gene structure of SmGRP1-like genes present in two important model plants, Arabidopsis thaliana and Oryza sativa, were analyzed, it was found that they are both composed of two exons and one intron; the first exon encodes only five amino acids. The gene structure of SmGRP1 is the same as that of SmGRP1-like genes. The sequence similarity of the matched genes suggests that SmGRP1-like genes may ubiquitously exist within the entire plant kingdom. Because all of these genes showed no conserved motifs or functional domains, they may play functional roles through their common characteristic: richness in glutamic acid residues. The first reported protein with such a unique sequence was RVCaB (Yussa and Maeshima, 2000). The properties of the primary sequence of SmGRP1 were similar to those of RVCaB. Recently, RVCaB was suggested to be a naturally unstructured protein on the basis of biochemical and physical methods (Ishijima et al., 2007). Furthermore, another group of glutamic-acid-rich proteins of rod photoreceptors was reported to be natively unfolded (BatraSafferling et al., 2006). This intrinsically unfolded state probably serves as an elongated tether that secures the cGMP-gated channel to the disc 7

Journal of Plant Physiology 245 (2020) 153112

Y. Liu, et al.

Fig. 6. Role of SmGRP1 in exogenous ABA-induced stomatal movement of S. miltiorrhiza. Isolated epidermal strips of control and different transgenic lines incubated at 25 °C in MES/KCl or containing 100 μM ABA. After 3 h, the stomatal aperture was recorded (A). (B–G) are representative figures of control (B), ABA-treated control (C), RNAi-6 (D) ABA-treated RNAi-6 (E), OE-4 (F), and ABA-treated OE-4 (G) plants. Scale bar, 10 μm. Role of SmGRP1 in 100 μM H2O2 (H)-, 100 μM SNP (I)-, and 100 μM NaCl (J)-induced stomatal movement of S. miltiorrhiza.

SmGRP1 was detected in one-month-old whole plants but was strongly expressed in the leaves and stems, and these results were confirmed by promoter-GUS analysis. The most interesting finding was that SmGRP1 was markedly induced by a period of darkness and that

rim, thus providing a unique geometric arrangement of the channel. The tertiary structure of SmGRP1 remains to be determined by crystallography and/or biochemical methods. Structural information might provide insights into the biochemical mechanism of its function.

Fig. 7. Role of SmGRP1 in darknessinduced stomatal movement of S. miltiorrhiza. Isolated epidermal strips of control and the knockdown transgenic RNAi-1 line incubated at 25 °C in MES/ KCl under normal light or darkness. At 3 h later, the stomatal aperture was recorded (A). (B–E) are representative figures of control (B) and darkness-induced control (C), and RNAi-1 (D) plants as well as a darkness-induced RNAi-1 (E) plant. Scale bars, 10 mm.

8

Journal of Plant Physiology 245 (2020) 153112

Y. Liu, et al.

SmGRP1 still requires further confirmation by other methods. Much information is needed before we can fully understand the location of SmGRP1 in the signaling pathways of ABA- and darkness-induced stomatal closure. Additional experiments should be designed and performed to discover its molecular functional mechanisms. In conclusion, in this report, we cloned and identified a novel gene named SmGRP1, which is highly expressed in the leaves. Its expression is markedly induced by ABA, darkness, and some stress-related conditions such as drought, NaCl, and high temperature, and its expression is suppressed by low temperature. Properly expressed SmGRP1 proteins protect plants from drought by slowing the rate of water loss. Further study revealed that SmGRP1 is necessary and may play vital roles in ABA-, darkness-, or various stress-induced stomatal closure, but its functional mechanisms still need clarification. This is the first report of the experimentally confirmed functional roles of SmGRP1-like glutamic acid-rich proteins. However, from the reported expression analysis, we can see that this kind of protein exhibits very different expression patterns, implying that its functions may be varied and complex. This report will draw attention to these novel proteins. Determining their functional roles and functional mechanisms will be helpful in understanding how plants adapt to or resist stress conditions. In addition, this kind of gene has the potential to be a putative target or candidate gene for genetic modifications to obtain plants that are of higher value.

mRNA levels increased continuously during the long period of darkness, reaching a maximum after 24 h. ABA is another factor that can strongly induce SmGRP1 transcription levels. ABA is a very important hormone that regulates many plant growth and development processes, such as germination, lateral root development, seeding growth, seed development, seed dormancy, transition from the vegetative to reproductive phase, and abiotic stress tolerance (Chinnusamy et al., 2008; Bari and Jones, 2009). These results suggest that SmGRP1 may play important roles in ABA-regulated biological processes. The SmGRP1 expression level was also regulated by drought, NaCl, and temperature. The results of the real-time qPCR analysis of the mRNA levels were roughly consistent with those of the promoter-GUS assay. The response to these stress-related conditions revealed a possible function of SmGRP1 in plant stress resistance. Apart from that of SmGRP1, the expression pattern of three other SmGRP1-like genes was discussed: CCaP1 from Arabidopsis (Ide et al., 2007) and P54 and Pt2L4 from cassava (Zhang et al., 2003; de Souza et al., 2006, 2009). C54 and Pt2L4 were specifically isolated from cassava storage roots and were predominantly active in the phloem, cambium, and xylem vessels of vascular tissues from the leaves, stems, and root system. Strong GUS activity was detected in starch-rich parenchyma cells of transgenic storage roots. The results showed that these two genes are related to the secondary growth of storage roots in cassava. Arabidopsis CCaP1 was identified as a petiole-specific gene. The mRNA level of CCaP1 was measured in the shoots and roots of three-week-old plants, and it was predominantly abundant in the petiole and slightly abundant in the roots. High expression was observed around the petiole, such as the shoot apex, hypocotyls, and leaf main vein. CCaP1 expression was enhanced in darkness but suppressed by high concentrations of Ca2+ and other metal ions. It was concluded that CCaP1 may function as a mediator in response to continuous darkness or gibberellic acid. Comparing these newly reported four SmGRP1-like genes, we found that although they have some common sequence characteristics, their expression patterns varied, demonstrating the functional complexity of this kind of gene in plant growth and development. After determining the expression pattern of SmGRP1, we can surmise that SmGRP1 may be an important stress-related novel gene, but its actual functional role and how it functions needs further exploration. We used the RNAi method to obtain SmGRP1 knockdown transformants and used 35S-SmGRP1 to obtain overexpression transformants. By characterizing the different transgenic lines, we found that SmGRP1 plays a very important role in ABA- and darkness-induced stomatal closure. It seemed that SmGRP1 was required for dehydration or stressrelated responses, which means that SmGRP1 is very important for plants to adapt to or resist stress conditions. This is the first report examining the functional roles of SmGRP1-like genes in plants. Although the regulation of stomatal movement under ABA and light/ darkness stimuli has been well studied, there are still some molecular mechanisms awaiting further exploration. As mentioned above, as predicted, these groups of SmGRP1-like proteins have difficulty folding and do not readily form higher structures; also, the functional roles of this kind of protein, which shows no conserved functional motifs or domains, may be performed by its common characteristic: a high content of glutamic acid residues. Several plant glutamic acid-rich proteins have been reported, some of which have been defined as photoreceptors which transduce the absorption of light into an electrical signal (Batra-Safferling et al., 2006), some of which have been reported as dehydrin-like proteins (Danyluk et al., 1994), and some of which have been mentioned as Ca2+ buffers or as Ca2+- or metal ion-binding proteins (Ide et al., 2007; Yuasa and Maeshima, 2000). All of the proteins share the common features of having Ca2+-binding ability. It has been reported that the EE structure, which is abundantly present in SmGRP1-like proteins, can capture Ca2+. Our primary results confirmed that in vitro-expressed SmGRP1 proteins can bind Ca2+ on the basis of “stains-all” staining analysis (data not shown). However, the calcium-binding ability of

Author contribution statement YY and ZW conceived and designed research; YL, WM, WZ, and LL conducted experiments; DW, BL, SW, and YP contributed reagents and analyzed the data; YY wrote the manuscript. All authors approved the submission of the manuscript. Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. The authors have declared that no competitive or conflicting interests exist. Acknowledgements This research was financially supported by the Project of the National Key Technologies R & D Program for Modernization of Traditional Chinese Medicine (2017YFC1701300, 2017YFC1700706), The National Natural Science Foundation of China (31670299, 31900254, 31870276), Key Scientific and Technological Innovation Team Project in Shaanxi Province (2019TD-033), Fundamental Research Funds for the Central Universities (GK201806006), Major Project of Shaanxi Province, China (Grant No.2017ZDXM-SF-005), and The Youth Innovation Team of Shaanxi Universities. References Argos, P., Hanei, M., Garavito, R.M., 1978. The Chou-Fasman secondary structure prediction method with an extended data base. FEBS Lett. 93 (1), 19–24. Bari, R., Jones, H.D., 2009. Roles of plant hormones in plant defense responses. Plant Mol. Biol. 69 (4), 473–488. Batra-Safferling, R., Abarca-Heidemann, K., Körschen, H.G., et al., 2006. Glutamic acidrich proteins of rod photoreceptors are natively unfolded. J. Biol. Chem. 281 (3), 1449–1460. Borsani, G., Ballabio, A., Banfi, S., 1998. A practical guide to orient yourself in the labyrinth of genome databses. Hum. Mol. Genet. 7 (10), 1641–1648. Bright, J., Desikan, R., Hancock, J.T., et al., 2006. ABA-induced NO generation and stomatal closure in Arabidopsis are dependent on H2O2 synthesis. Plant J. 45, 113–122. Chinnusamy, V., Gong, Z., Zhu, J.-K., 2008. Abscisic acid-mediated epigenetic processes in plant development and stress responses. J. Integr. Plant Biol. 50 (10), 1187–1195. Danyluk, J., Houde, M., Rassart, E., et al., 1994. Differential expression of a gene encoding an acidic dehydrin in chilling sensitive and freezing tolerant gramineae species. FEBS Lett. 344 (1), 20–24.

9

Journal of Plant Physiology 245 (2020) 153112

Y. Liu, et al.

Murashige, T., Skoog, F., 1962. A revised medium for rapid growth and bioassay with tobacco tissue culture. Physiol. Plant. 15, 473–497. Prilusky, J., Felder, C.E., Zeev-Ben-Mordehai, T., et al., 2005. FoldIndex: a simple tool to predict whether a given protein sequence is intrinsically unfolded. Bioinformatics 21 (16), 3435–3438. Sierla, M., Hõrak, H., Overmyer, K., et al., 2018. The receptor-like pseudokinase GHR1 is required for stomatal closure. Plant Cell 30, 2813–2837. Song, J., Wang, Z.Z., 2009. Molecular cloning, expression and characterization of a phenylalanine ammonia-lyase gene (SmPAL1) from Salvia miltiorrhiza. Mol. Biol. Rep. 36 (5), 939–952. Tian, W., Hou, C., Ren, Z., et al., 2015. A molecular pathway for co2 response in arabidopsis guard cells. Nat. Commun. 6, 6057. Wang, X., Morris-Natschke, S.L., Lee, K.H., 2006. New developments in the chemistry and biology of the bioactive constituents of Tanshen. Med. Res. Rev. 27, 133–148. Wesley, S.V., Helliwell, C., Smith, N.A., et al., 2001. Constructs for efficient, effective and high throughput gene silencing in plants. Plant J. 27, 581–590. Yan, Y.P., Wang, Z.Z., 2007. Genetic transformation of the medicinal plant Salvia miltiorrhiza by Agrobacterium tumefaciens-mediated method. Plant Cell Tissue Organ Cult. 88 (2), 175–184. Yan, Y.P., Wang, Z.Z., Tian, W., et al., 2010. Generation and analysis of expressed sequence tags from the medicinal plant Salvia miltiorrhiza. Sci. China Life Sci. 53, 273–285. Yuasa, K., Maeshima, M., 2000. Purification, properties, and molecular cloning of a novel Ca(2+)-binding protein in radish vacuoles. Plant Physiol. 124 (3), 1069–1078. Zhang, P., Bohl-Zenger, S., Puonti-Kaerlas, J., et al., 2003. Two cassava promoters related to vascular expression and storage root formation. Planta 218 (2), 192–203. Zhou, L., Zuo, Z., Chow, M.S., 2005. Danshen: an overview of its chemistry, pharmacology, pharmacokinetics, and clinical use. J. Clin. Pharmacol. 45, 1345–1359.

de Souza, C.R., Carvalho, L.J., et al., 2006d. A cDNA sequence coding for a glutamic acidrich protein is differentially expressed in cassava storage roots. Protein Pept. Lett. 13 (7), 653–657. de Souza, C.R., Aragão, et al., 2009d. Isolation and characterization of the promoter sequence of a cassava gene coding for Pt2L4, a glutamic acid-rich protein differentially expressed in storage roots. Genet. Mol. Res. 8 (1), 334–344. Doyle, J.J., Doyle, J.L., 1987. A rapid DNA isolation procedure from small quantities of fresh leaf tissue. Phytochem. Bull 19, 11–15. Hull, G.A., Devic, M., 1995. The beta-glucuronidase (gus) reporter gene system. Gene fusions; spectrophotometric, fluorometric, and histochemical detection. Methods Mol. Biol. 49, 125–141. Ide, Y., Tomioka, R., Ouchi, Y., et al., 2007. Transcriptional induction of two genes for CCaPs, novel cytosolic proteins, in Arabidopsis thaliana in the dark. Plant Cell Physiol. 48 (1), 54–65. Ishijima, J., Nagasaki, N., Maeshima, M., et al., 2007. RVCaB, a calcium-binding protein in radish vacuoles, is predominantly an unstructured protein with a polyproline type II helix. J. Biochem. 142 (2), 201–211. Linding, R., Jensen, L.J., Diella, F., et al., 2003. Protein disorder prediction: implications for structural proteomics. Structure 11 (11), 1453–1459. Liu, J.Q., Seul, U., Thompson, R., 1997. Cloning and characterization of a pollen-specific cDNA encoding a glutamic-acid-rich protein (GARP) from potato Solanum berthaultii. Plant Mol. Biol. 33, 291–300. McAinsh, M.R., Clayton, H., Mansfield, T.A., et al., 1996. Changes in stomatal behaviour and guard cell cytosolic free calcium in response to oxidative stress. Plant Physiol. 111, 1031–1042. Moscatiello, R., Zaccarin, M., Ercolin, et al., 2015. Identification of ferredoxin II as a major calcium binding protein in the nitrogen-fixing symbiotic bacterium Mesorhizobium loti. BMC Microbiol. 15, 16.

10