- Email: [email protected]
The DcMaster Transposon Display maps polymorphic insertion sites in the carrot (Daucus carota L.) genome
Gene 390 (2007) 67 – 74 www.elsevier.com/locate/gene
The DcMaster Transposon Display maps polymorphic insertion sites in the carrot (Daucus carota L.) genome Dariusz Grzebelus a,⁎, Barbara Jagosz a , Philipp W. Simon b,⁎ a
b
Department of Genetics, Plant Breeding and Seed Science, Agricultural University of Krakow, Poland Vegetable Research Crop Unit, USDA-ARS, and Department of Horticulture, University of Wisconsin, Madison, WI, USA Received 7 June 2006; received in revised form 18 July 2006; accepted 20 July 2006 Available online 30 August 2006 Received by M. Batzer
Abstract DcMaster is a family of PIF/Harbinger-like class II transposable elements identified in carrot. We present a modified Transposon Display molecular marker system allowing amplification of genomic regions containing DcMaster elements. We scored 77 DcMaster Transposon Display (DcMTD) amplicons, of which 54 (70%) were segregating in the F2 progeny from the cross between wild and cultivated carrot. Segregating amplicons were incorporated into a previously developed molecular linkage map of carrot. Twenty-eight markers were attributed to the wild parent, 23 originated from the cultivated parent, and three markers remained unlinked. The markers were evenly distributed among the nine linkage groups. However, differences in the distribution pattern of DcMaster insertion sites in the genomes of the wild and cultivated parent were observed. Specificity of the obtained amplicons was confirmed by sequencing and three putative DcMaster subfamilies, differing in the sequence of their terminal inverted repeats, were revealed. Published by Elsevier B.V. Keywords: Linkage analysis; PIF/Harbinger-like; Splinkrette-PCR; Transposable elements
1. Introduction Transposable elements are capable of changing their genomic location. Transposon families usually consist of only a few autonomous elements, all of which carry structural components needed for transposition, a number of non-autonomous internally deleted elements which are able to transpose only after trans-mobilization by the related autonomous transposon, and other elements which include mutations making them Abbreviations: DcMTD; DcMaster Transposon Display; MITE; miniature inverted repeat transposable element; rs; reducing sugar locus; TIR; terminal inverted repeat; TSD; target site duplication. ⁎ Corresponding authors. Simon is to be contacted at USDA-ARS Vegetable Research Crops Unit and Department of Horticulture, University of Wisconsin– Madison, 1575 Linden Drive, Madison, WI 53706, USA. Fax: +1 608 262 4743. Grzebelus, Department of Genetics, Plant Breeding and Seed Science, Agricultural University of Krakow, Al. 29 Listopada 54, 31-425 Krakow, Poland. Fax: +48 12 662 5266. E-mail addresses: [email protected] (D. Grzebelus), [email protected] (P.W. Simon). 0378-1119/$ - see front matter. Published by Elsevier B.V. doi:10.1016/j.gene.2006.07.041
unable to transpose (Capy et al., 1998). Both autonomous and putatively mobile non-autonomous elements share identical sequences of their terminal regions, as they are essential for transposition. Each transposition event generates an insertion/ deletion polymorphism that can be detected using a range of molecular techniques. Such polymorphisms can be used as molecular markers for genetic mapping, genotype fingerprinting, and evaluation of genetic diversity. In addition, owing to a more defined character of variability, polymorphic insertion sites can be used as landmarks for evolutionary studies. Some transposon families are present in numerous copies in the host genome, thus potentially hundreds of markers can be generated. Several systems for identifying transposon insertion sites have been developed over the last ten years, including those based on a simple PCR: IRAP (Inter Retrotransposon Polymorphism) and REMAP (Retrotransposon Microsatellite Polymorphism, Kalendar et al., 1999); IMP (Inter MITE Polymorphism, Chang et al., 2001); those using an AFLP-like approach: SSAP (Site-Specific Amplified Polymorphism, Waugh et al., 1997) and Transposon Display (Casa et al., 2000; Biedler et al.,
68
D. Grzebelus et al. / Gene 390 (2007) 67–74
2003; Park et al., 2003; Kwon et al., 2005); and those identifying polymorphisms in the specific sequence-characterized regions: RBIP (Retrotransposon-Based Insertion Polymorphism, Flavell et al., 1998). DcMaster is a family of PIF/Harbinger-like class II transposable elements identified recently in carrot. The putative autonomous DcMaster-a element is 4.4 kb long, flanked by 22 bp imperfect terminal inverted repeats. It carries two open reading frames coding for a product similar to the orf1 characteristic for other PIF-like elements and a transposase containing the complete DDE domain. A PCR assay indicated that related elements were present in genomes of other Apiaceae, but failed to identify them outside that plant family (Grzebelus et al., 2006). A non-autonomous element DcMaster1 was identified as the causal agent for a knock-out mutation of the acid soluble invertase, isozyme II, resulting in the accumulation of sucrose, rather than glucose and fructose, in carrot roots (Yau and Simon, 2003; Grzebelus et al., 2006) indicating a likely recent transposition event. As our preliminary data suggested the presence of numerous polymorphic insertion sites between the wild and the cultivated carrot, we attempted to evaluate the level of polymorphism and to determine the localisation of DcMaster copies in the carrot genome. In the present paper we describe a Transposon Display technique tailored towards identification of DcMaster insertion sites and modified towards an increased product specificity. The DcMaster Transposon Display (DcMTD) markers were incorporated into a previously developed genetic linkage map of carrot.
GTTGTGGTTG, and the adaptor-specific primer tdP1: CGAATCGTAACCGTTCGTACGAGAA. The 10 μl reaction mixture consisted of 1 μl restriction/ligation DNA fragments, 2 mM MgCl2, 250 μM dNTPs, 1 μM each primer, 0.5 U TAQ, and 1 μl 10× PCR buffer (Promega). Cycling conditions were as followed: the initial denaturation at 94 °C/30 s, and then 40 cycles of 55 °C/30 s, and 68 °C/60 s, followed by the final elongation at 68 °C/5 min. Subsequently, the reaction mixture was diluted 1:50 and used as template for the second round of PCR amplification (selective amplification) using the nested P 33 -labeled DcMaster-specific primer DcMtd2m: GCTGCTGTTGTGGTTGGCAAC in combination with the nested adaptor-specific primer tdMse-NNN: TCCAACGAGC CAAGGTAANNN, where NNN stands for the three selective nucleotides. We used 15 combinations of selective nucleotides (Table 1). The 10 μl selective amplification mixture consisted of 1 μl diluted preamplification products, 2 mM MgCl2, 250 μM dNTPs, 0.5 μM each primer, 0.5 U TAQ and 1 μl 10× PCR buffer (Promega). Selective amplification cycling conditions started with denaturation at 94 °C/2 min followed by 5 cycles of touch down PCR (94 °C/30 s, 60 °C/30 s decreased by 1.0 °C per each subsequent cycle, and 68 °C/60 s), then 35 cycles of 94 °C/30 s, 55 °C/30 s, and 68 °C/60 s. Amplification was completed with the final elongation step at 68 °C/5 min and then kept at 4 °C. The overview of the DcMTD protocol is presented in Fig. 1. Products amplified in the course of selective amplification were separated on 6% denaturing polyacrylamide gels and visualized as described for AFLP products by Briard et al. (2000). 2.3. Rs locus
2. Materials and methods 2.1. Plant materials A genetic linkage map was constructed using a set of 159 F2 progeny from the cross between the wild (QAL) and the cultivated (line B493) carrot. Details concerning the production of the mapping population, plant cultivation, DNA extraction, and identification of AFLP, SCAR, SSR and gene specific markers were reported previously (Santos and Simon, 2002, 2004; Just, 2004).
A DcMaster insertion polymorphism in the carrot acid soluble invertase isozyme II (Grzebelus et al., 2006) allowed amplification of Rs- and rs-specific products, as described by Yau et al. (2005), for all individuals used for mapping. Table 1 Number of products amplified using the DcMaster Transposon Display system from the wild × cultivated F2 (QAL × B493) carrot population with primers carrying different combinations of selective nucleotides Selective nucleotides
2.2. DcMaster Transposon Display Approximately 200 ng of DNA samples of 159 F2 plants was completely digested in 37 °C for 3 h in a 20 μl reaction mixture containing 5 u MseI (New England Biolabs) and 1× NEB buffer 2. MseI-compatible splinkrette type adaptors, modified from the adaptor sequences originally published by Devon et al. (1995) were ligated to restriction fragments using T4 DNA ligase (Promega). Adaptors were obtained through annealing of the two single stranded oligonucleotides — SplA1: CGAATCG TAACCGTTCGTACGAGAATGTCCTCTCCAACGAGC CAAGG, and SplA2: TACCTTGGCTCGTTTTTTTTTGCAA AAA. Ligation products were 5-fold diluted and subjected to the first round of PCR amplification (preamplification) with the DcMaster-specific primer DcMtd1m: TATCAAAAAGCTGCT
ACA ACT AGT CTA GTA CAT GAT CTT GTT CAA GAA AGA CAG TCA TGT Total
Number of amplicons
Number of sequenced products
Total
Polymorphic
Total
Specific
8 9 10 5 10 7 12 8 10 9 12 9 8 13 8 138
8 9 7 4 7 7 7 8 7 7 9 7 6 8 5 106
7 8 4 5 4 7 6 4 5 6 5 – – – – 61
6 6 3 4 4 7 5 4 5 5 5 – – – – 54
D. Grzebelus et al. / Gene 390 (2007) 67–74
69
Fig. 1. Schematic representation of the DcMaster Transposon Display system. Genomic DNA is digested with MseI, Splinkrette-type adaptors are ligated to restriction fragments, and two rounds of PCR amplification are performed resulting in the amplification of a subset of products containing the 5′ terminal region of DcMaster with the adjacent genomic flanking region of different lengths depending on the distance from the insertion site to the nearest MseI restriction site. For details see the Materials and methods, Section 2.2. Thick lines — genomic DNA, letters ‘ttaa’ — MseI restriction site, letters ‘nnn’ — three selective nucleotides, large open arrow — 5′ terminal region of DcMaster, dotted lines — adaptors, small arrows — primer annealing sites. The scheme is not drawn to scale.
2.4. DNA sequencing DcMTD products chosen for sequencing were cut out from dry gels, transferred to 100 μl sterile water and incubated for 30 min in room temperature. Subsequently, 2 μl of the solution was used as a template for reamplification of Transposon Display products using the same PCR conditions as those employed for the selective amplification. Amplicons obtained were separated on a 1% agarose gel, stained with ethidium bromide, cut out from the gel and purified with QIAquick Gel Extraction Kit™ (QIAgen) following the instructions provided by the manufacturer. Purified DNA fragments were then ligated into pGEM-T™ vector (Promega) for sequencing. Universal primers T7 and SP6 were used for sequencing both strands of the cloned products. Sequencing reaction was performed with ABI PRISM BigDye™ PCR (Applied Biosystems) and run on ABI Prism 377 DNA sequencer in the University of Wisconsin–Madison Biotechnology Center. DNA sequences were grouped, aligned and manipulated using BioEdit sequence alignment editor (Hall, 1999). 2.5. Construction of genetic linkage map Polymorphic DcMTD products were used to saturate the existing genetic linkage map of the F2 population QAL × B493 (Santos and Simon, 2002; Just, 2004). Separate maps were constructed for each parent to avoid problems related to the use of repulsion phase dominant markers, as described previously
(Santos and Simon, 2004). The maps were constructed with MAPMAKER 3.0 (Lander et al., 1987). Dominant markers from a single parent linked in coupling were used in conjunction with all codominant markers. The ‘two point’ command was used to establish linkage groups at LOD = 4.0. Three point analysis was then performed for each linkage group followed by the ‘order’ command. Remaining markers were added using the ‘try’ command. To test whether the mapped DcMTD markers were evenly distributed among the nine linkage groups, we used a χ2 test for goodness of fit, where the expected number of markers per linkage group was estimated from the proportion of the linkage group length related to the total length of the corresponding map. 3. Results 3.1. Identification of DcMTD markers Amplification of regions flanking the 5′ end of DcMaster insertion sites in the genome of Daucus carota using the DcMTD system with 15 combinations of selective nucleotides yielded in total 135 amplicons, ranging in length from 63 to 261 bp, of which 106 (76.8%) segregated in the F2 mapping population (Table 1). We obtained 5 to 13 (9.0 on average) scorable products per single reaction, of which 5 to 9 (7.1 on average) were polymorphic (Table 1, Fig. 2). As the DcMaster specific primer used for selective amplification was anchored in the 5′ subterminal region of the element, the nineteen 5′ terminal nucleotides served as the
70
D. Grzebelus et al. / Gene 390 (2007) 67–74
Fig. 2. An example of the DcMaster Transposon Display profile obtained with seven selective primer combinations. Lanes: 1 — (QAL × B493)F2#5, 2 — (QAL × B493)F2#6, 3 — (QAL × B493)F2#7, 4 — (QAL × B493)F2#8.
control of the specificity of the obtained amplicons. We sequenced 61 products and 54 of them had the expected DcMaster sequence on their transposon end, thus indicating that these products originated from insertion sites, while the remaining seven amplicons did not show homology to DcMaster and were classified as non-specific (Table 1, Fig. 3). Closer inspection of the electrophoretic profiles revealed cosegregation of a number of same sized products obtained with different selective nucleotide combinations. Such products could be observed following amplification with two to four different primer combinations. Sequence analysis of 16 of those products showed that in all cases they were identical, except for the selective nucleotides. We assumed that all same sized, monomorphic or co-segregating amplicons were the result of crossamplification. This way we obtained a set of 77 non-redundant DcMTD fragments, including 54 (70%) polymorphic and 23 (30%) monomorphic amplicons, and used it for further analyses. Of the 54 polymorphic products, 29 markers originated from the wild parent QAL, while 25 were attributed to the cultivated
parent B493. Hence, the number of the identified DcMaster copies was 52 and 48, for QAL and B493, respectively. TIR sequences obtained for a subset of 26 non-redundant transposon-specific amplicons allowed to identify three putative DcMaster subfamilies (Fig. 3). Subfamily DcM-1 was represented by 14 elements distributed evenly in both genomes (9 in QAL and 7 in B493). Additionally, it included all sequenced monomorphic amplicons. Eight members of subfamily DcM-2 were identified, six in the wild and only two in the cultivated carrot, while subfamily DcM-3 was represented by two elements, both present in the B493 genome. 3.2. Mapping DcMaster insertion sites The segregating DcMTD products were incorporated into two previously developed genetic linkage maps of carrot for the wild and the cultivated parent of the F2 (QAL × B493) population (Fig. 4). The total size of the maps increased from 1055.7 cM and 1210.5 cM to 1297.9 cM (23% increase) and
D. Grzebelus et al. / Gene 390 (2007) 67–74
71
Fig. 3. DNA sequences of 100 bp long portion of eight specific and two non-specific DcMTD amplicons and consensus terminal inverted repeat sequences for three putative DcMaster subfamilies. Thick gray line — primer annealing site, black arrow — DcMaster TIR, TSD — target site duplication, DcM-a — DcMaster-a terminus and the sequence flanking insertion.
1504.2 cM (24% increase), for QAL and B493, respectively. DcMaster insertion sites were incorporated into all linkage groups but one from the B493 map. Results of the χ2 test indicated that the DcMaster insertions were evenly distributed among the nine linkage groups on both maps representing the parental genomes (χ2 = 7.6 and 10.2 for QAL and B493, respectively). However, some differences could be noticed when the two maps were compared. Linkage group 2 for QAL harbored eight, i.e. the highest number of DcMaster insertions, while for B493 no DcMTD markers were present on the same linkage group. Another, less pronounced difference was observed for linkage group 5, where two and six insertion sites were identified for QAL and B493, respectively. The codominant marker developed for the rs locus on the basis of the insertion polymorphism (Yau et al., 2005) showed complete co-segregation with one of the DcMTD markers, tdgat101 at the distal position of the linkage group 4 for parent B493. The sequence of td-gat101 was identical to that flanking the DcMaster1 insertion site at the rs locus. 4. Discussion 4.1. DcMaster insertion polymorphisms as molecular markers The efficiency of DcMTD to generate molecular markers was slightly lower than that reported for other transposon based marker systems, which was a result of a compromise between the copy number of DcMaster elements and the reliability and reproducibility of the technique. Rice Rim2/Hipa elements produced 60 to 80 bands per primer combination, when the adaptor-specific primer carried two selective nucleotides (Kwon et al., 2005). On average 52 Hbr markers per primer combination were obtained using Transposon Display for the MITE family Heartbreaker in maize, using only one selective nucleotide (Casa et al., 2000). Our attempts to use less than three selective nucleotides resulted in unclear electrophoretic profiles
(data not shown). Leigh et al. (2003) reported that the usefulness of different retrotransposon families to develop molecular marker systems may vary significantly. Sequencing of a subset of DcMTD amplicons proved that the technique is capable for efficient identification of multiple DcMaster insertion sites. The DcMTD system was optimised to tolerate small primer–template mismatches, to facilitate amplification from slightly altered DcMaster copies, and these less stringent conditions were the likely cause for the occurrence of cross-amplification. Even though the redundancy generated by cross-amplification may be viewed as a disadvantage, it is important to stress that all cross-amplified products resulted from the amplification of regions flanking DcMaster insertions. Reliability of the DcMTD system was further confirmed by the fact, that the DcMTD marker td-gat101 co-segregated with the specific, codominant marker designed for the rs locus (Yau et al., 2005). As expected, the sequence of td-gat101 was identical to that flanking the DcMaster1 insertion site. The percentage of polymorphic DcMTD markers (70%) was higher than that reported for the majority of other transposon families. Only Pegasus, a low copy element (less than 100 per genome) of Anopheles gambiae, showed higher polymorphism reaching 90%. In plant genomes, Heartbreaker insertions in maize were 60% polymorphic (Casa et al., 2000) and various retrotransposons in barley showed 10 to 25% polymorphism (Leigh et al., 2003). As reported previously, a MITE family Krak, represented by elements shorter than 400 bp and showing 80% sequence identity to DcMaster (when 100 bp terminal sequences were compared), is also present in the carrot genome and the estimated number of copies was over 3600 (Grzebelus et al., 2006). As we were primarily interested in identifying DcMaster insertion sites, the primers were designed not to be complementary to Krak elements. However, the DcMTD system could in principle be readily adopted to amplify Krak insertion sites allowing us to identify another, probably more robust set of transposon based markers for carrot.
72
D. Grzebelus et al. / Gene 390 (2007) 67–74
Fig. 4. Genetic linkage maps of the wild carrot parent QAL and the cultivated parent B493. AFLP markers are labeled grey, codominant markers used to connect the two maps are labeled blue and DcMTD markers are labeled red.
D. Grzebelus et al. / Gene 390 (2007) 67–74
4.2. Distribution of the DcMaster insertion sites Despite the fact that only a limited number of DcMaster insertion sites were revealed in the present investigation, it seems unlikely that the differences in their distribution in the genomes of the wild and the cultivated carrot could be solely attributed to random sampling from the total population of DcMaster copies. Interestingly, linkage groups 2 and 5, for which differences in the number of DcMaster insertion sites were the most pronounced, were previously identified as those carrying the most important QTLs for carotenoid content, including total carotenoids and βcarotene (Santos and Simon, 2002; Just, 2004). Root color was for decades one of the major factors taken into account in the carrot breeding process, thus it is tempting to speculate that the observed differences may reflect the selective pressure resulting in the development of the cultivated orange carrot, as opposed to its wild relative. The high level of identified intraspecific polymorphism of DcMaster insertion sites and other indirect evidences (Grzebelus et al., 2006) indicate that elements from the DcMaster family might have still been transpositionally active in the recent past. As the orange rooted carrot probably first appeared in the XVII century (Banga, 1963) and the trait was then fixed through selection by breeders, transposition events might in part be responsible for that new phenotype. Copies of DcMaster seem to be uniformly scattered throughout the genome. The only apparent cluster of the elements, containing three insertion sites separated only by 5.3 cM, could be seen on the QAL linkage group 9. The uniform distribution pattern may be a general feature of all elements belonging to the PIF/Harbinger superfamily, which, unlike most other transposable elements, do not show affinity to non-coding pericentromeric regions. A similar pattern of insertion site distribution was reported by Casa et al. (2000) for the miniature transposable element Heartbreaker in the maize genome. The presence and number of DcMaster subfamilies have to be further investigated. The limited data presented here suggest that at least three subfamilies, probably differing in the number of copies, are present in the carrot genome. Subfamily DcM-3 seems to be rare, and perhaps it is present only in the genome of cultivated carrot. One of the two representatives of the subfamily DcM-3 was identified by the td-gat101 marker, which as described above, represented the insertion of DcMaster1 in the rs locus. Also, DcMaster-a harbors TIRs specific to that subfamily (Fig. 3). As the increase of the copy number leads to inhibition of transposon activity, it is possible that subfamily DcM-3 groups a small number of potentially active DcMaster elements. 4.3. Possible applications of the DcMTD marker system DcMTD markers can be used for evaluation of genetic diversity in the wild and the cultivated Daucus and for fingerprinting of carrot cultivars and breeding materials. Transposon insertion based markers represent a more defined type of variability as compared to simple arbitrary markers such as RAPD or AFLP. Polymorphisms identified using arbitrary marker systems may be of very different nature, from single nucleotide substitutions to massive genomic rearrangements, including those related to the activity of
73
transposable elements. However, a cause of the particular polymorphism is usually not known. On the other hand, transposon based marker systems in principle identify a well-defined and heritable genomic change, i.e. the transposition event, and therefore we expect that a more structured dataset can be generated. Previous studies on D. carota diversity and fingerprinting using arbitrary marker systems were sometimes ambiguous (Bradeen et al., 2002; Grzebelus et al., 2001), hence the DcMTD system might provide an opportunity for better characterization of genetic diversity in carrot, as shown for the Hbr markers in maize (Casa et al., 2002). References Banga, O.,1963. Main types of the western carotene carrot and their origin. N.V. Uitgevers-Maatschappij W.E.J. TjeenkWillink, Publisher, Zwolle, the Netherlands. Biedler, J., Qi, Y., Holligan, D., della Torre, A., Wessler, S., Tu, Z., 2003. Transposable element (TE) display and rapid detection of TE insertion polymorphism in the Anopheles gambiae species complex. Insect Mol. Biol. 12, 211–216. Bradeen, J.M., et al., 2002. Molecular diversity analysis of cultivated carrot (Daucus carota L.) and wild Daucus populations reveals a genetically nonstructured composition. J. Am. Soc. Hortic. Sci. 127, 383–391. Briard, M., Le Clerc, V., Grzebelus, D., Senalik, D., Simon, P.W., 2000. Modified protocols for rapid carrot genomic DNA extraction and AFLP™ analysis using silver stain or radioisotopes. Plant. Mol. Biol. Report. 18, 235–241. Capy, P., Bazin, C., Higuet, D., Langin, T., 1998. Dynamics and Evolution of Transposable Elements. Chapman and Hall, New York. 197 pp. Casa, A.M., et al., 2000. The MITE family Heartbreaker (Hbr): molecular markers in maize. Proc. Natl. Acad. Sci. U. S. A. 97, 10083–10089. Casa, A.M., Mitchell, S.E., Smith, O.S., Register III, J.C., Wessler, S.R., Kresovich, S., 2002. Evaluation of Hbr (MITE) markers for assessment of genetic relationships among maize (Zea mays L.) inbred lines. Theor. Appl. Genet. 104, 104–110. Chang, R.Y., O'Donoughue, L.S., Bureau, T.E., 2001. Inter-MITE polymorphisms (IMP): a high throughput transposon-based genome mapping and fingerprinting approach. Theor. Appl. Genet. 102, 773–781. Devon, R.S., Porteous, D.J., Brookes, A.J., 1995. Splinkerettes — improved vectorettes for greater efficiency in PCR walking. Nucleic Acids Res. 23, 1644–1645. Flavell, A.J., Knox, M.R., Pearce, S.R., Ellis, T.H.N., 1998. Retrotransposonbased insertion polymorphisms (RBIP) for high throughput marker analysis. Plant J. 16, 643–650. Grzebelus, D., Senalik, D., Jagosz, B., Simon, P.W., Michalik, B., 2001. The use of AFLP markers for the identification of carrot breeding lines and F1 hybrids. Plant Breed. 120, 526–528. Grzebelus, D., Yau, Y.-Y., Simon, P.W., 2006. Master: a novel family of PIF/ Harbinger-like transposable elements identified in carrot (Daucus carota L.). Mol. Genet. Genom. 275, 450–459. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98. Just, B.J., 2004. Genetic mapping of carotenoid pathway structural genes and major gene QTLs for carotenoid accumulation in wild and domesticated carrot (Daucus carota L.). University of Wisconsin–Madison, PhD dissertation. Kalendar, R., Grob, T., Regina, M., Suoniemi, A., Schulman, A., 1999. IRAP and REMAP: two new retrotransposon-based DNA fingerprinting techniques. Theor. Appl. Genet. 98, 704–711. Kwon, S.J., Park, K.C., Kim, J.H, Lee, J.K., Kim, N.S., 2005. Rim2/Hipa CACTA transposon display; a new genetic marker technique in Oryza species. BMC Genetics 6: 15, doi:10.1186/1471-2156-6-15. Lander, E.S., et al., 1987. MAPMAKER: an interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 1, 174–181.
74
D. Grzebelus et al. / Gene 390 (2007) 67–74
Leigh, F., Kalendar, R., Lea, V., Lee, D., Donini, P., Schulman, A.H., 2003. Comparison of the utility of barley retrotransposon families for genetic analysis by molecular marker techniques. Mol. Genet. Genom. 269, 464–474. Park, K.C., Kim, N.H., Cho, Y.S., Kang, K.H., Lee, J.K., Kim, N.S., 2003. Genetic variations of AA genome Oryza species measured by MITE-AFLP. Theor. Appl. Genet. 107, 203–209. Santos, C.A.F., Simon, P.W., 2002. QTL analyses reveal clustered loci for accumulation of major provitamin A carotenes and lycopene in carrot roots. Mol. Genet. Genom. 268, 122–129. Santos, C.A.F., Simon, P.W., 2004. Merging carrot linkage groups based on conserved dominant AFLP markers in F2 populations. J. Am. Soc. Hortic. Sci. 129, 211–217.
Waugh, R., et al., 1997. Genetic distribution of BARE-1 retrotransposable elements in the barley genome revealed by sequence-specific amplification polymorphisms (S-SAP). Mol. Genet. Genom. 253, 687–694. Yau, Y.-Y., Simon, P.W., 2003. A 2.5-kb insert eliminates acid soluble invertase isozyme II transcript in carrot (Daucus carota L.) roots, causing high sucrose accumulation. Plant Mol. Biol. 53, 151–162. Yau, Y.-Y., Santos, K., Simon, P.W., 2005. Molecular tagging and selection for sugar type in carrot roots using co-dominant, PCR-based markers. Mol. Breed. 16, 1–10.
The DcMaster Transposon Display maps polymorphic insertion sites in the carrot (Daucus carota L.) genome Dariusz Grzebelus a,⁎, Barbara Jagosz a , Philipp W. Simon b,⁎ a
b
Department of Genetics, Plant Breeding and Seed Science, Agricultural University of Krakow, Poland Vegetable Research Crop Unit, USDA-ARS, and Department of Horticulture, University of Wisconsin, Madison, WI, USA Received 7 June 2006; received in revised form 18 July 2006; accepted 20 July 2006 Available online 30 August 2006 Received by M. Batzer
Abstract DcMaster is a family of PIF/Harbinger-like class II transposable elements identified in carrot. We present a modified Transposon Display molecular marker system allowing amplification of genomic regions containing DcMaster elements. We scored 77 DcMaster Transposon Display (DcMTD) amplicons, of which 54 (70%) were segregating in the F2 progeny from the cross between wild and cultivated carrot. Segregating amplicons were incorporated into a previously developed molecular linkage map of carrot. Twenty-eight markers were attributed to the wild parent, 23 originated from the cultivated parent, and three markers remained unlinked. The markers were evenly distributed among the nine linkage groups. However, differences in the distribution pattern of DcMaster insertion sites in the genomes of the wild and cultivated parent were observed. Specificity of the obtained amplicons was confirmed by sequencing and three putative DcMaster subfamilies, differing in the sequence of their terminal inverted repeats, were revealed. Published by Elsevier B.V. Keywords: Linkage analysis; PIF/Harbinger-like; Splinkrette-PCR; Transposable elements
1. Introduction Transposable elements are capable of changing their genomic location. Transposon families usually consist of only a few autonomous elements, all of which carry structural components needed for transposition, a number of non-autonomous internally deleted elements which are able to transpose only after trans-mobilization by the related autonomous transposon, and other elements which include mutations making them Abbreviations: DcMTD; DcMaster Transposon Display; MITE; miniature inverted repeat transposable element; rs; reducing sugar locus; TIR; terminal inverted repeat; TSD; target site duplication. ⁎ Corresponding authors. Simon is to be contacted at USDA-ARS Vegetable Research Crops Unit and Department of Horticulture, University of Wisconsin– Madison, 1575 Linden Drive, Madison, WI 53706, USA. Fax: +1 608 262 4743. Grzebelus, Department of Genetics, Plant Breeding and Seed Science, Agricultural University of Krakow, Al. 29 Listopada 54, 31-425 Krakow, Poland. Fax: +48 12 662 5266. E-mail addresses: [email protected] (D. Grzebelus), [email protected] (P.W. Simon). 0378-1119/$ - see front matter. Published by Elsevier B.V. doi:10.1016/j.gene.2006.07.041
unable to transpose (Capy et al., 1998). Both autonomous and putatively mobile non-autonomous elements share identical sequences of their terminal regions, as they are essential for transposition. Each transposition event generates an insertion/ deletion polymorphism that can be detected using a range of molecular techniques. Such polymorphisms can be used as molecular markers for genetic mapping, genotype fingerprinting, and evaluation of genetic diversity. In addition, owing to a more defined character of variability, polymorphic insertion sites can be used as landmarks for evolutionary studies. Some transposon families are present in numerous copies in the host genome, thus potentially hundreds of markers can be generated. Several systems for identifying transposon insertion sites have been developed over the last ten years, including those based on a simple PCR: IRAP (Inter Retrotransposon Polymorphism) and REMAP (Retrotransposon Microsatellite Polymorphism, Kalendar et al., 1999); IMP (Inter MITE Polymorphism, Chang et al., 2001); those using an AFLP-like approach: SSAP (Site-Specific Amplified Polymorphism, Waugh et al., 1997) and Transposon Display (Casa et al., 2000; Biedler et al.,
68
D. Grzebelus et al. / Gene 390 (2007) 67–74
2003; Park et al., 2003; Kwon et al., 2005); and those identifying polymorphisms in the specific sequence-characterized regions: RBIP (Retrotransposon-Based Insertion Polymorphism, Flavell et al., 1998). DcMaster is a family of PIF/Harbinger-like class II transposable elements identified recently in carrot. The putative autonomous DcMaster-a element is 4.4 kb long, flanked by 22 bp imperfect terminal inverted repeats. It carries two open reading frames coding for a product similar to the orf1 characteristic for other PIF-like elements and a transposase containing the complete DDE domain. A PCR assay indicated that related elements were present in genomes of other Apiaceae, but failed to identify them outside that plant family (Grzebelus et al., 2006). A non-autonomous element DcMaster1 was identified as the causal agent for a knock-out mutation of the acid soluble invertase, isozyme II, resulting in the accumulation of sucrose, rather than glucose and fructose, in carrot roots (Yau and Simon, 2003; Grzebelus et al., 2006) indicating a likely recent transposition event. As our preliminary data suggested the presence of numerous polymorphic insertion sites between the wild and the cultivated carrot, we attempted to evaluate the level of polymorphism and to determine the localisation of DcMaster copies in the carrot genome. In the present paper we describe a Transposon Display technique tailored towards identification of DcMaster insertion sites and modified towards an increased product specificity. The DcMaster Transposon Display (DcMTD) markers were incorporated into a previously developed genetic linkage map of carrot.
GTTGTGGTTG, and the adaptor-specific primer tdP1: CGAATCGTAACCGTTCGTACGAGAA. The 10 μl reaction mixture consisted of 1 μl restriction/ligation DNA fragments, 2 mM MgCl2, 250 μM dNTPs, 1 μM each primer, 0.5 U TAQ, and 1 μl 10× PCR buffer (Promega). Cycling conditions were as followed: the initial denaturation at 94 °C/30 s, and then 40 cycles of 55 °C/30 s, and 68 °C/60 s, followed by the final elongation at 68 °C/5 min. Subsequently, the reaction mixture was diluted 1:50 and used as template for the second round of PCR amplification (selective amplification) using the nested P 33 -labeled DcMaster-specific primer DcMtd2m: GCTGCTGTTGTGGTTGGCAAC in combination with the nested adaptor-specific primer tdMse-NNN: TCCAACGAGC CAAGGTAANNN, where NNN stands for the three selective nucleotides. We used 15 combinations of selective nucleotides (Table 1). The 10 μl selective amplification mixture consisted of 1 μl diluted preamplification products, 2 mM MgCl2, 250 μM dNTPs, 0.5 μM each primer, 0.5 U TAQ and 1 μl 10× PCR buffer (Promega). Selective amplification cycling conditions started with denaturation at 94 °C/2 min followed by 5 cycles of touch down PCR (94 °C/30 s, 60 °C/30 s decreased by 1.0 °C per each subsequent cycle, and 68 °C/60 s), then 35 cycles of 94 °C/30 s, 55 °C/30 s, and 68 °C/60 s. Amplification was completed with the final elongation step at 68 °C/5 min and then kept at 4 °C. The overview of the DcMTD protocol is presented in Fig. 1. Products amplified in the course of selective amplification were separated on 6% denaturing polyacrylamide gels and visualized as described for AFLP products by Briard et al. (2000). 2.3. Rs locus
2. Materials and methods 2.1. Plant materials A genetic linkage map was constructed using a set of 159 F2 progeny from the cross between the wild (QAL) and the cultivated (line B493) carrot. Details concerning the production of the mapping population, plant cultivation, DNA extraction, and identification of AFLP, SCAR, SSR and gene specific markers were reported previously (Santos and Simon, 2002, 2004; Just, 2004).
A DcMaster insertion polymorphism in the carrot acid soluble invertase isozyme II (Grzebelus et al., 2006) allowed amplification of Rs- and rs-specific products, as described by Yau et al. (2005), for all individuals used for mapping. Table 1 Number of products amplified using the DcMaster Transposon Display system from the wild × cultivated F2 (QAL × B493) carrot population with primers carrying different combinations of selective nucleotides Selective nucleotides
2.2. DcMaster Transposon Display Approximately 200 ng of DNA samples of 159 F2 plants was completely digested in 37 °C for 3 h in a 20 μl reaction mixture containing 5 u MseI (New England Biolabs) and 1× NEB buffer 2. MseI-compatible splinkrette type adaptors, modified from the adaptor sequences originally published by Devon et al. (1995) were ligated to restriction fragments using T4 DNA ligase (Promega). Adaptors were obtained through annealing of the two single stranded oligonucleotides — SplA1: CGAATCG TAACCGTTCGTACGAGAATGTCCTCTCCAACGAGC CAAGG, and SplA2: TACCTTGGCTCGTTTTTTTTTGCAA AAA. Ligation products were 5-fold diluted and subjected to the first round of PCR amplification (preamplification) with the DcMaster-specific primer DcMtd1m: TATCAAAAAGCTGCT
ACA ACT AGT CTA GTA CAT GAT CTT GTT CAA GAA AGA CAG TCA TGT Total
Number of amplicons
Number of sequenced products
Total
Polymorphic
Total
Specific
8 9 10 5 10 7 12 8 10 9 12 9 8 13 8 138
8 9 7 4 7 7 7 8 7 7 9 7 6 8 5 106
7 8 4 5 4 7 6 4 5 6 5 – – – – 61
6 6 3 4 4 7 5 4 5 5 5 – – – – 54
D. Grzebelus et al. / Gene 390 (2007) 67–74
69
Fig. 1. Schematic representation of the DcMaster Transposon Display system. Genomic DNA is digested with MseI, Splinkrette-type adaptors are ligated to restriction fragments, and two rounds of PCR amplification are performed resulting in the amplification of a subset of products containing the 5′ terminal region of DcMaster with the adjacent genomic flanking region of different lengths depending on the distance from the insertion site to the nearest MseI restriction site. For details see the Materials and methods, Section 2.2. Thick lines — genomic DNA, letters ‘ttaa’ — MseI restriction site, letters ‘nnn’ — three selective nucleotides, large open arrow — 5′ terminal region of DcMaster, dotted lines — adaptors, small arrows — primer annealing sites. The scheme is not drawn to scale.
2.4. DNA sequencing DcMTD products chosen for sequencing were cut out from dry gels, transferred to 100 μl sterile water and incubated for 30 min in room temperature. Subsequently, 2 μl of the solution was used as a template for reamplification of Transposon Display products using the same PCR conditions as those employed for the selective amplification. Amplicons obtained were separated on a 1% agarose gel, stained with ethidium bromide, cut out from the gel and purified with QIAquick Gel Extraction Kit™ (QIAgen) following the instructions provided by the manufacturer. Purified DNA fragments were then ligated into pGEM-T™ vector (Promega) for sequencing. Universal primers T7 and SP6 were used for sequencing both strands of the cloned products. Sequencing reaction was performed with ABI PRISM BigDye™ PCR (Applied Biosystems) and run on ABI Prism 377 DNA sequencer in the University of Wisconsin–Madison Biotechnology Center. DNA sequences were grouped, aligned and manipulated using BioEdit sequence alignment editor (Hall, 1999). 2.5. Construction of genetic linkage map Polymorphic DcMTD products were used to saturate the existing genetic linkage map of the F2 population QAL × B493 (Santos and Simon, 2002; Just, 2004). Separate maps were constructed for each parent to avoid problems related to the use of repulsion phase dominant markers, as described previously
(Santos and Simon, 2004). The maps were constructed with MAPMAKER 3.0 (Lander et al., 1987). Dominant markers from a single parent linked in coupling were used in conjunction with all codominant markers. The ‘two point’ command was used to establish linkage groups at LOD = 4.0. Three point analysis was then performed for each linkage group followed by the ‘order’ command. Remaining markers were added using the ‘try’ command. To test whether the mapped DcMTD markers were evenly distributed among the nine linkage groups, we used a χ2 test for goodness of fit, where the expected number of markers per linkage group was estimated from the proportion of the linkage group length related to the total length of the corresponding map. 3. Results 3.1. Identification of DcMTD markers Amplification of regions flanking the 5′ end of DcMaster insertion sites in the genome of Daucus carota using the DcMTD system with 15 combinations of selective nucleotides yielded in total 135 amplicons, ranging in length from 63 to 261 bp, of which 106 (76.8%) segregated in the F2 mapping population (Table 1). We obtained 5 to 13 (9.0 on average) scorable products per single reaction, of which 5 to 9 (7.1 on average) were polymorphic (Table 1, Fig. 2). As the DcMaster specific primer used for selective amplification was anchored in the 5′ subterminal region of the element, the nineteen 5′ terminal nucleotides served as the
70
D. Grzebelus et al. / Gene 390 (2007) 67–74
Fig. 2. An example of the DcMaster Transposon Display profile obtained with seven selective primer combinations. Lanes: 1 — (QAL × B493)F2#5, 2 — (QAL × B493)F2#6, 3 — (QAL × B493)F2#7, 4 — (QAL × B493)F2#8.
control of the specificity of the obtained amplicons. We sequenced 61 products and 54 of them had the expected DcMaster sequence on their transposon end, thus indicating that these products originated from insertion sites, while the remaining seven amplicons did not show homology to DcMaster and were classified as non-specific (Table 1, Fig. 3). Closer inspection of the electrophoretic profiles revealed cosegregation of a number of same sized products obtained with different selective nucleotide combinations. Such products could be observed following amplification with two to four different primer combinations. Sequence analysis of 16 of those products showed that in all cases they were identical, except for the selective nucleotides. We assumed that all same sized, monomorphic or co-segregating amplicons were the result of crossamplification. This way we obtained a set of 77 non-redundant DcMTD fragments, including 54 (70%) polymorphic and 23 (30%) monomorphic amplicons, and used it for further analyses. Of the 54 polymorphic products, 29 markers originated from the wild parent QAL, while 25 were attributed to the cultivated
parent B493. Hence, the number of the identified DcMaster copies was 52 and 48, for QAL and B493, respectively. TIR sequences obtained for a subset of 26 non-redundant transposon-specific amplicons allowed to identify three putative DcMaster subfamilies (Fig. 3). Subfamily DcM-1 was represented by 14 elements distributed evenly in both genomes (9 in QAL and 7 in B493). Additionally, it included all sequenced monomorphic amplicons. Eight members of subfamily DcM-2 were identified, six in the wild and only two in the cultivated carrot, while subfamily DcM-3 was represented by two elements, both present in the B493 genome. 3.2. Mapping DcMaster insertion sites The segregating DcMTD products were incorporated into two previously developed genetic linkage maps of carrot for the wild and the cultivated parent of the F2 (QAL × B493) population (Fig. 4). The total size of the maps increased from 1055.7 cM and 1210.5 cM to 1297.9 cM (23% increase) and
D. Grzebelus et al. / Gene 390 (2007) 67–74
71
Fig. 3. DNA sequences of 100 bp long portion of eight specific and two non-specific DcMTD amplicons and consensus terminal inverted repeat sequences for three putative DcMaster subfamilies. Thick gray line — primer annealing site, black arrow — DcMaster TIR, TSD — target site duplication, DcM-a — DcMaster-a terminus and the sequence flanking insertion.
1504.2 cM (24% increase), for QAL and B493, respectively. DcMaster insertion sites were incorporated into all linkage groups but one from the B493 map. Results of the χ2 test indicated that the DcMaster insertions were evenly distributed among the nine linkage groups on both maps representing the parental genomes (χ2 = 7.6 and 10.2 for QAL and B493, respectively). However, some differences could be noticed when the two maps were compared. Linkage group 2 for QAL harbored eight, i.e. the highest number of DcMaster insertions, while for B493 no DcMTD markers were present on the same linkage group. Another, less pronounced difference was observed for linkage group 5, where two and six insertion sites were identified for QAL and B493, respectively. The codominant marker developed for the rs locus on the basis of the insertion polymorphism (Yau et al., 2005) showed complete co-segregation with one of the DcMTD markers, tdgat101 at the distal position of the linkage group 4 for parent B493. The sequence of td-gat101 was identical to that flanking the DcMaster1 insertion site at the rs locus. 4. Discussion 4.1. DcMaster insertion polymorphisms as molecular markers The efficiency of DcMTD to generate molecular markers was slightly lower than that reported for other transposon based marker systems, which was a result of a compromise between the copy number of DcMaster elements and the reliability and reproducibility of the technique. Rice Rim2/Hipa elements produced 60 to 80 bands per primer combination, when the adaptor-specific primer carried two selective nucleotides (Kwon et al., 2005). On average 52 Hbr markers per primer combination were obtained using Transposon Display for the MITE family Heartbreaker in maize, using only one selective nucleotide (Casa et al., 2000). Our attempts to use less than three selective nucleotides resulted in unclear electrophoretic profiles
(data not shown). Leigh et al. (2003) reported that the usefulness of different retrotransposon families to develop molecular marker systems may vary significantly. Sequencing of a subset of DcMTD amplicons proved that the technique is capable for efficient identification of multiple DcMaster insertion sites. The DcMTD system was optimised to tolerate small primer–template mismatches, to facilitate amplification from slightly altered DcMaster copies, and these less stringent conditions were the likely cause for the occurrence of cross-amplification. Even though the redundancy generated by cross-amplification may be viewed as a disadvantage, it is important to stress that all cross-amplified products resulted from the amplification of regions flanking DcMaster insertions. Reliability of the DcMTD system was further confirmed by the fact, that the DcMTD marker td-gat101 co-segregated with the specific, codominant marker designed for the rs locus (Yau et al., 2005). As expected, the sequence of td-gat101 was identical to that flanking the DcMaster1 insertion site. The percentage of polymorphic DcMTD markers (70%) was higher than that reported for the majority of other transposon families. Only Pegasus, a low copy element (less than 100 per genome) of Anopheles gambiae, showed higher polymorphism reaching 90%. In plant genomes, Heartbreaker insertions in maize were 60% polymorphic (Casa et al., 2000) and various retrotransposons in barley showed 10 to 25% polymorphism (Leigh et al., 2003). As reported previously, a MITE family Krak, represented by elements shorter than 400 bp and showing 80% sequence identity to DcMaster (when 100 bp terminal sequences were compared), is also present in the carrot genome and the estimated number of copies was over 3600 (Grzebelus et al., 2006). As we were primarily interested in identifying DcMaster insertion sites, the primers were designed not to be complementary to Krak elements. However, the DcMTD system could in principle be readily adopted to amplify Krak insertion sites allowing us to identify another, probably more robust set of transposon based markers for carrot.
72
D. Grzebelus et al. / Gene 390 (2007) 67–74
Fig. 4. Genetic linkage maps of the wild carrot parent QAL and the cultivated parent B493. AFLP markers are labeled grey, codominant markers used to connect the two maps are labeled blue and DcMTD markers are labeled red.
D. Grzebelus et al. / Gene 390 (2007) 67–74
4.2. Distribution of the DcMaster insertion sites Despite the fact that only a limited number of DcMaster insertion sites were revealed in the present investigation, it seems unlikely that the differences in their distribution in the genomes of the wild and the cultivated carrot could be solely attributed to random sampling from the total population of DcMaster copies. Interestingly, linkage groups 2 and 5, for which differences in the number of DcMaster insertion sites were the most pronounced, were previously identified as those carrying the most important QTLs for carotenoid content, including total carotenoids and βcarotene (Santos and Simon, 2002; Just, 2004). Root color was for decades one of the major factors taken into account in the carrot breeding process, thus it is tempting to speculate that the observed differences may reflect the selective pressure resulting in the development of the cultivated orange carrot, as opposed to its wild relative. The high level of identified intraspecific polymorphism of DcMaster insertion sites and other indirect evidences (Grzebelus et al., 2006) indicate that elements from the DcMaster family might have still been transpositionally active in the recent past. As the orange rooted carrot probably first appeared in the XVII century (Banga, 1963) and the trait was then fixed through selection by breeders, transposition events might in part be responsible for that new phenotype. Copies of DcMaster seem to be uniformly scattered throughout the genome. The only apparent cluster of the elements, containing three insertion sites separated only by 5.3 cM, could be seen on the QAL linkage group 9. The uniform distribution pattern may be a general feature of all elements belonging to the PIF/Harbinger superfamily, which, unlike most other transposable elements, do not show affinity to non-coding pericentromeric regions. A similar pattern of insertion site distribution was reported by Casa et al. (2000) for the miniature transposable element Heartbreaker in the maize genome. The presence and number of DcMaster subfamilies have to be further investigated. The limited data presented here suggest that at least three subfamilies, probably differing in the number of copies, are present in the carrot genome. Subfamily DcM-3 seems to be rare, and perhaps it is present only in the genome of cultivated carrot. One of the two representatives of the subfamily DcM-3 was identified by the td-gat101 marker, which as described above, represented the insertion of DcMaster1 in the rs locus. Also, DcMaster-a harbors TIRs specific to that subfamily (Fig. 3). As the increase of the copy number leads to inhibition of transposon activity, it is possible that subfamily DcM-3 groups a small number of potentially active DcMaster elements. 4.3. Possible applications of the DcMTD marker system DcMTD markers can be used for evaluation of genetic diversity in the wild and the cultivated Daucus and for fingerprinting of carrot cultivars and breeding materials. Transposon insertion based markers represent a more defined type of variability as compared to simple arbitrary markers such as RAPD or AFLP. Polymorphisms identified using arbitrary marker systems may be of very different nature, from single nucleotide substitutions to massive genomic rearrangements, including those related to the activity of
73
transposable elements. However, a cause of the particular polymorphism is usually not known. On the other hand, transposon based marker systems in principle identify a well-defined and heritable genomic change, i.e. the transposition event, and therefore we expect that a more structured dataset can be generated. Previous studies on D. carota diversity and fingerprinting using arbitrary marker systems were sometimes ambiguous (Bradeen et al., 2002; Grzebelus et al., 2001), hence the DcMTD system might provide an opportunity for better characterization of genetic diversity in carrot, as shown for the Hbr markers in maize (Casa et al., 2002). References Banga, O.,1963. Main types of the western carotene carrot and their origin. N.V. Uitgevers-Maatschappij W.E.J. TjeenkWillink, Publisher, Zwolle, the Netherlands. Biedler, J., Qi, Y., Holligan, D., della Torre, A., Wessler, S., Tu, Z., 2003. Transposable element (TE) display and rapid detection of TE insertion polymorphism in the Anopheles gambiae species complex. Insect Mol. Biol. 12, 211–216. Bradeen, J.M., et al., 2002. Molecular diversity analysis of cultivated carrot (Daucus carota L.) and wild Daucus populations reveals a genetically nonstructured composition. J. Am. Soc. Hortic. Sci. 127, 383–391. Briard, M., Le Clerc, V., Grzebelus, D., Senalik, D., Simon, P.W., 2000. Modified protocols for rapid carrot genomic DNA extraction and AFLP™ analysis using silver stain or radioisotopes. Plant. Mol. Biol. Report. 18, 235–241. Capy, P., Bazin, C., Higuet, D., Langin, T., 1998. Dynamics and Evolution of Transposable Elements. Chapman and Hall, New York. 197 pp. Casa, A.M., et al., 2000. The MITE family Heartbreaker (Hbr): molecular markers in maize. Proc. Natl. Acad. Sci. U. S. A. 97, 10083–10089. Casa, A.M., Mitchell, S.E., Smith, O.S., Register III, J.C., Wessler, S.R., Kresovich, S., 2002. Evaluation of Hbr (MITE) markers for assessment of genetic relationships among maize (Zea mays L.) inbred lines. Theor. Appl. Genet. 104, 104–110. Chang, R.Y., O'Donoughue, L.S., Bureau, T.E., 2001. Inter-MITE polymorphisms (IMP): a high throughput transposon-based genome mapping and fingerprinting approach. Theor. Appl. Genet. 102, 773–781. Devon, R.S., Porteous, D.J., Brookes, A.J., 1995. Splinkerettes — improved vectorettes for greater efficiency in PCR walking. Nucleic Acids Res. 23, 1644–1645. Flavell, A.J., Knox, M.R., Pearce, S.R., Ellis, T.H.N., 1998. Retrotransposonbased insertion polymorphisms (RBIP) for high throughput marker analysis. Plant J. 16, 643–650. Grzebelus, D., Senalik, D., Jagosz, B., Simon, P.W., Michalik, B., 2001. The use of AFLP markers for the identification of carrot breeding lines and F1 hybrids. Plant Breed. 120, 526–528. Grzebelus, D., Yau, Y.-Y., Simon, P.W., 2006. Master: a novel family of PIF/ Harbinger-like transposable elements identified in carrot (Daucus carota L.). Mol. Genet. Genom. 275, 450–459. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98. Just, B.J., 2004. Genetic mapping of carotenoid pathway structural genes and major gene QTLs for carotenoid accumulation in wild and domesticated carrot (Daucus carota L.). University of Wisconsin–Madison, PhD dissertation. Kalendar, R., Grob, T., Regina, M., Suoniemi, A., Schulman, A., 1999. IRAP and REMAP: two new retrotransposon-based DNA fingerprinting techniques. Theor. Appl. Genet. 98, 704–711. Kwon, S.J., Park, K.C., Kim, J.H, Lee, J.K., Kim, N.S., 2005. Rim2/Hipa CACTA transposon display; a new genetic marker technique in Oryza species. BMC Genetics 6: 15, doi:10.1186/1471-2156-6-15. Lander, E.S., et al., 1987. MAPMAKER: an interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 1, 174–181.
74
D. Grzebelus et al. / Gene 390 (2007) 67–74
Leigh, F., Kalendar, R., Lea, V., Lee, D., Donini, P., Schulman, A.H., 2003. Comparison of the utility of barley retrotransposon families for genetic analysis by molecular marker techniques. Mol. Genet. Genom. 269, 464–474. Park, K.C., Kim, N.H., Cho, Y.S., Kang, K.H., Lee, J.K., Kim, N.S., 2003. Genetic variations of AA genome Oryza species measured by MITE-AFLP. Theor. Appl. Genet. 107, 203–209. Santos, C.A.F., Simon, P.W., 2002. QTL analyses reveal clustered loci for accumulation of major provitamin A carotenes and lycopene in carrot roots. Mol. Genet. Genom. 268, 122–129. Santos, C.A.F., Simon, P.W., 2004. Merging carrot linkage groups based on conserved dominant AFLP markers in F2 populations. J. Am. Soc. Hortic. Sci. 129, 211–217.
Waugh, R., et al., 1997. Genetic distribution of BARE-1 retrotransposable elements in the barley genome revealed by sequence-specific amplification polymorphisms (S-SAP). Mol. Genet. Genom. 253, 687–694. Yau, Y.-Y., Simon, P.W., 2003. A 2.5-kb insert eliminates acid soluble invertase isozyme II transcript in carrot (Daucus carota L.) roots, causing high sucrose accumulation. Plant Mol. Biol. 53, 151–162. Yau, Y.-Y., Santos, K., Simon, P.W., 2005. Molecular tagging and selection for sugar type in carrot roots using co-dominant, PCR-based markers. Mol. Breed. 16, 1–10.