B and cytotoxin assays

Diagnostic Microbiology and Infectious Disease 43 (2002) 257–263

www.elsevier.com/locate/diagmicrobio

The diagnosis of Clostridium difficile-associated diarrhea: comparison of Triage® C. difficile panel, EIA for Tox A/B and cytotoxin assays M.J. Alfa*, B. Swan, B. VanDekerkhove, P. Pang, G.K.M. Harding St. Boniface General Hospital, Winnipeg, MB, Canada Received 31 October 2001; accepted 10 May 2002

Abstract This study prospectively compared; Triage® C. difficile test (TCT), TechLab C. difficile toxin A-B enzyme immuno-assay (EIA), and cell-culture cytotoxin test (CT). Of the 400 stools tested, 99 were positive by any test with 92, 41 and 58 detected by TCT, EIA and CT, respectively. Culture of discordant samples indicated that 52 contained C. difficile (42 toxigenic, 10 non-toxigenic), 10 contained Clostridium species and 2 had no detectable clostridium isolates. There were 21/42 toxigenic C. difficile isolates from 17 patients whose stools were negative when originally tested by CT. Review of available patient charts indicated that 12/14 did not previously or currently have C. difficile associated diarrhea, whereas 2 patients developed disease within a few days. Compared to CT as the gold standard, the sensitivity and specificity were; 93%, 89% and 66%, 99% for TCT and EIA respectively. The 8 stool samples with Toxin A(⫺) Toxin B(⫹) isolates were detected in 8, 4, and 6 samples by TCT, EIA and CT, respectively. In summary, TCT as a screening test allowed reliable reporting for 85% of stools on the day of receipt. For the 15% of stools requiring further testing we recommend the use of CT. © 2002 Elsevier Science Inc. All rights reserved.

1. Introduction Despite the recognition that Clostridium difficile-associated diarrhea is the most common infectious nosocomial diarrhea there has been limited progress in preventing or controlling this enteric pathogen. As with most nosocomially transmitted pathogens, a key parameter in effective control measures is the ability to rapidly diagnose the problem thereby facilitating rapid implementation of isolation precautions to reduce the likelihood of spread to other patients. Clinically significant disease occurs only for toxigenic strains of C. difficile that produce both Toxin A (enterotoxin) and Toxin B (cytotoxin) (Bartlett, 1992; Bradbury & Barrett, 1997; Cohen et al., 2000; Gerding et al., 1995; Johnson & Gerding, 1998; Knoop et al., 1993; Lyerly et al., 1988; von Eichel-Streiber et al., 1992). Recent reports indicate that there are a range of deletions, insertions and rearrangements in the PaLoc that codes for toxin production in strains of C. difficile isolated from humans (Al-Barrak et al., 1999; Alfa et al., 2000; Kato et al., 1998; Rupnik et al., 1998; 1997). Deletions in the Toxin A gene are more com* Corresponding author. Tel.: ⫹1-313-577-5399; fax: ⫹1-313-5775497. E-mail address: [email protected] (M.J. Alfa).

mon than deletions or insertions in the Toxin B gene (Rupnik et al., 1998). Previously, it was thought that C. difficile strains lacking Toxin A production were not clinically significant (Kato et al., 1998; Rupnik et al., 1998). Recently there have been reports of clinically significant isolates of C. difficile that are missing large segments of the Toxin A gene that code for the CROP (clostridial repetitive oligopeptide) region. The CROP region is responsible for binding to eukaryotic cells (Cohen et al., 2000; Johnson & Gerding, 1998; Rupnik et al., 1998; von Eichel-Streiber et al., 1992). These isolates apparently do not produce biologically active Toxin A but do produce the full range of CAD (Al-Barrak et al., 1999; Alfa et al., 2000). These have been referred to as Toxin A(⫺), Toxin B(⫹) strains of C. difficile. Samples from patients ill with such strains of C. difficile will be negative when tested by methods that use monoclonal antibodies that bind only the CROP region of Toxin A (Alfa et al., 2000). Diagnostic tests for CAD are usually performed on stool samples and include; culture for the organism with subsequent testing of the isolate for toxin production, antigen testing for toxin A and/or Toxin B by EIA or other antigen detection methods and cytotoxin testing using tissue culture (Fekety et al., 1997; Johnson & Gerding, 1998; Knoop et al., 1993; Lyerly et al., 1988). Since most strains associated

0732-8893/02/$ – see front matter © 2002 Elsevier Science Inc. All rights reserved. PII: S 0 7 3 2 - 8 8 9 3 ( 0 2 ) 0 0 4 1 3 - 3

258

M.J. Alfa et al. / Diagnostic Microbiology and Infectious Disease 43 (2002) 257–263

with clinically significant disease were thought to produce both toxin A and toxin B, it was assumed that diagnostic tests would be adequate if they detected one or other of the toxins. Recently, the inadequacy of diagnostic tests based solely on toxin A has been reported for an outbreak of CAD due to a toxin A(⫺) toxin B(⫹) strain of C. difficile (AlBarrak et al., 1999; Alfa et al., 2000), as well as studies of CAD in children (McGowan & Kader, 1999). Rapid results and high sensitivity are the hallmarks of an ideal screening test. Unless a patient has toxic megacolon or pseudomembranous colitis, diagnostic testing for CAD may not be viewed as requiring immediate turn-around times. Emperic antibiotic therapy is often started where clinically warranted for CAD prior to availability of diagnostic test results. However, when one considers the delays in implementation of infection control precautions, patient-transfer issues and unecessary antibiotic treatment that occur while test results are pending, the value of a rapid diagnostic test for screening becomes apparent. Recently a rapid C. difficile screening test has become commercially available. The Triage C. difficile test (TCT) is based on detection of Toxin A as well as the surface antigen glutamate dehydrogenase (GD) in direct stool samples from patients suspected of having CAD. The objective of this study was to compare the TCT to an EIA that detects toxin A and B as well as the direct cytotoxin test using tissue culture (CT) to determine the applicability of TCT as a screening test in a geographic location where clinically significant Toxin A(⫺), Toxin B(⫹) strains of C. difficile have been detected.

2. Materials and methods 2.1. Specimen collection All stools from our 650 bed tertiary care teaching hospital that were submitted for CAD testing between June 1, 1999 and April 30, 2000 were included in the evaluation. Rejection criteria included; inadequate volume to perform all three diagnostic tests (⬍3 mls), or formed stool. All formed stools are rejected as part of our routine protocol unless the physician calls with clinically relevant information that would warrant processing of the stool. Each stool sample was set up to all three diagnostic tests at the same time. The majority of stool samples were processed within 24 h of receipt (except weekends when stool samples may be held up to 48 h at 4°C prior to testing). Two aliquots of each original stool samples that had discordant diagnostic test results were stored at ⫺20°C for further testing including culture and subsequent genetic analysis of clostridial isolates. 2.2. Diagnostic testing of stool samples Each stool sample was assayed on the same day using; an EIA (Techlabs Inc., Blacksburg, VI) that detected both

Toxin A and Toxin B, the Triage® C. difficile test (Biosite Diagnostics, San Diego, CA), and cytotoxin testing as previously described (Alfa et al., 2000). Samples showing discordant results for these diagnostic tests were cultured for any detectable Clostridium species. 2.3. EIA Samples were diluted 1:5 and processed as per the manufacturer’s guidelines (Techlabs Inc., Blacksburg, VI). Color development was determined by an Emax Precision Microplate reader (Molecular Devices Corp., Menlo Park, CA) using a 450 nm wavelength. Tests having absorbance values ⱖ0.120 were considered positive, and absorbance values ⬍0.120 were considered negative. 2.4. Triage® C. difficile test Samples were diluted 1:10 and processed as per the manufacturer’s recommendations. Briefly, this involved placing the diluted stool sample into a filter device and centrifuging it. The filtrate was then inoculated onto the surface of the test cartridge and substrate added. The test was held at room temperature for 10 min. The appropriate reactions for both the positive and negative controls were required, otherwise the test was repeated (in this study, controls reacted appropriately for all tests and no repeats due to improper control reactions were required for the entire study period). Stool samples that showed a colored band (any amount of color development detected visually was considered positive) for both the Toxin A and GD antigens were considered positive. If only one of theToxin A or GD antigens showed a color reaction, this was considered discordant, and no color reaction for either Toxin A or GD antigens was considered a negative test result. 2.5. Tissue culture cytotoxin assay Human foreskin fibroblasts (HFF) were used for this assay. The Human Foreskin Fibroblast (HFF) cell line was maintained in-house and monolayers of this cell line in 96-well trays were used for cytotoxin testing. The stool sample was diluted 1:10, centrifuged to pellet debris and organisms and the supernatant was filtered through a 0.45 ␮m syringe filter unit. The filtered sample with and without polyclonal anti-C. difficile toxin B anti-toxin (Techlabs Inc.) was inoculated into separate wells of the 96-well tissue culture tray where each well contained a confluent HFF monolayer. The final dilution in the well was 1:24. Cytopathic effect (CPE) that was characterized by rounding of at least 50% of the HFF cells within 48 h that was neutralized by anti-toxin was considered positive for the presence of C. difficile cytotoxin. C. difficile toxin B (Techlabs Inc.) with and without anti-C. difficile anti-toxin (Techlabs Inc) were used as the positive and negative controls, respectively.

M.J. Alfa et al. / Diagnostic Microbiology and Infectious Disease 43 (2002) 257–263

2.6. Culture All stools showing discordant diagnostic test results (i.e., one or more of the three tests showing a different reaction) were further evaluated by culture to isolate any Clostridium species present in the stool. For culture, a 1 mL aliquot of the stool was mixed with an equal volume of 95% alcohol, mixed thoroughly and then held at room temperature for 40 min. The bacteria were pelleted by centrifuging the sample at 2,500⫻ g for 5 min and the alcohol supernatant was decanted. A swab was used to inoculate the pellet onto blood agar containing hemin and vitamin K (BAK), which was then incubated anaerobically in either an anaerobic chamber or an anaerobic jar. Any Clostidium species detected was identified using standard microbiology procedures (Clinical Microbiology Handbook, 1994). Species confirmation for C. difficile included; characteristic horsemanure odour, fluorescence under UV, lack of hemolysis on BAK, Gram stain, and latex agglutination using Microscreen latex agglutination (Microgen Bioproducts, Camberley, United Kingdom) for C. difficile antigen. C. difficile isolates were grown in Fastidious Anaerobe Broth (Basal medium contains peptone mixture and yeast extract, from Lab M, Bury, England) until visibly turbid (minimum of 48 h) and then the supernatant fluid was tested for toxin using C. difficile Triage® test, and cytotoxin testing. Other species requiring identification were evaluated using API An-Ident Rapid anaerobic identification panels (BioMerieux Vitek Inc., Hazelwood, MO). In addition, all clostridial isolates were tested using PCR to determine if the genes for Toxin A and/or B were present (see PCR protocol). 2.7. PCR detection of toxin A, toxin B To determine the genetic characteristics of the organisms isolated, all clostridial isolates were tested by PCR for the presence of Toxin A, Toxin B and for defects in the Toxin A gene that code for the CROP region. To detect whether the organisms contained the genes for Toxin A and Toxin B, a primer set (A-B) was selected to amplify a region common to both toxins A and B. The A-B primer sequences were; Primer 1; 5⬘TTATTGGTCATGGTAAAGATG3⬘ and Primer 2; 5⬘TTTCTTCTTTATTTATCCATT3⬘. The expected PCR amplicon was 350 bp. The PCR primers, used for evaluation of defects in the Toxin A gene that codes for the CROP region, were based on Rupnick et al.’s (1997) analysis of the A3 region. The expected amplicon size for the A3 primer set is 3.1 kb if the CROP coding region of the gene has no major deletions. In our geographic area, the most common defect is a 1.8 kb deletion of the Toxin A gene that codes for the CROP region. This deletion results in a 1.3 kb amplicon when using the A3 primer set (Alfa et al., 2000). In addition an internal positive control for the PCR reaction was included to ensure there was amplifiable DNA in each sample tested. The universal primer (UNIV) used as the positive control for microbial DNA was described by Greisen et al. (1994). The UNIV

259

primer sequences used in our study were: Primer 2192: 5⬘AGGAGGTGATCCAACCGCA3⬘ and Primer 2193: 5⬘AACTGGAGGAAGGTGGGGAY3⬘ The expected amplicon size was 350 bp. For DNA extraction, C. difficile was cultured by inoculating 1–3 colonies of the organism into 5 mls of prereduced Brain Heart Infusion Broth and incubated overnight under anaerobic conditions. This overnight culture was used for DNA extraction by using 1.5 mls and extracting using the High Pure PCR Template Extraction Preparation Kit (Roche Diagnostics). The organism was pelleted by centrifugation, and the pellet was suspended in 200 ␮l of phosphate-buffered saline (PBS) pH 7.2. To this bacterial suspension was added; 10 ␮l of lysozyme at 200 mg/ml (Sigma) and 20 ␮l of mutanolysin at 5,000 U/ml (Sigma) and the bacterial suspension was then incubated at 37°C for 60 min to allow lysing. The remainder of the DNA extraction procedure was as per the manufacturer’s instructions. The PCR mix for all reactions was 50 ␮l total reaction volume and this reaction mix consisted of 0.5 ␮M concentration of the primers, 3 mM MgCl2 (Life Technologies) and 2.5 U of Taq polymerase (Life Technologies, Gaithersburg, MD). For the UNIV PCR and the A-B PCR reaction mixes, the dNTPs were obtained as a combined reagent called PCR Nucleotide Plus (Roche) with dATP, dCTP, and dGTP at 0.2 mM and dUTP at 0.6 mM. For amplicon contamination control, 0.5 Units of uracil deglycosylase (UDG) was added. Additional dTTP(Life Technologies,) at 0.1 mM was added to ensure efficiency of the amplification. For the A3 PCR reaction mix the nucleotide mix was a combined reagent called the PCR Nucleotide Mix (Roche) that contained dATP, dCTP, dGTP and dTTP each at 0.2 mM. To all of the reaction mixes, 2.5 ␮l of the C. difficile DNA extract was added. The PCR was performed using a PTC-2000 thermal cycler (MJ Research, Watertown, Mass.). For the A3 fragment the thermocylcer conditions described by Rupnick et al. (1997) were used: 93°C for 15 s, 47°C for 30 s, 68°C for 3 min. This set of cycle conditions was repeated for 34 cycles. For the Universal fragment and the Toxin A/B fragment, the thermocycler conditions were; pre-treatment at 37°C for 10 min before PCR cycles to allow UDG to degrade any contaminating amplicons that contained uracil, followed by 94°C for 10 min to inactivate any residual UDG, followed by the actual PCR cycle consisting of; 94o for 1 min, 52°C for 1 min, 72°C for 2 min. This set of PCR cycle conditions was repeated 34 times. The PCR products were compared to a 100-bp DNA ladder (Life Technologies) as well as a 500-bp DNA ladder (GenSura Laboratories Inc., Del Mar, Calif) after separation by 1.5%(w/v) agarose gel electrophoresis.

3. Results A total of 400 stool samples were tested over a 7 month period. An assessment of test turn-around time indicated

260

M.J. Alfa et al. / Diagnostic Microbiology and Infectious Disease 43 (2002) 257–263

Table 1 Comparison of overall results from diagnostic tests for C. difficile performed on stool samples Test Method:

Test Result

Number

Cytotoxin:

Positive Negative Positive Negative ToxA(⫹), GD(⫹) ToxA(⫺), GD(⫹) ToxA(⫹), GD(⫺) Total Triage Positive Negative

58 342 41 359 30 61 1 92 308 99/400

EIA*: Triage**:

Positive by ANY method:

* Compared to the Cytotoxin assay as the gold standard, the EIA demonstrated 66% sensitivity, 99% specificity, 94% negative predictive value and 93% positive predictive value ** Compared to the Cytotoxin assay as the gold standard, the Triage demonstrated 93% sensitivity, 89% specificity, 99% negative predictive value and 59% positive predictive value.

that, on average, the Triage® test took 20 min, the EIA required 65 min and the Cytotoxin assay took 24 h for initial results (48 h for final results). The “hands-on” technologist time was approximately equivalent at between 10 –15 min. There were 99 stool samples that were positive by ANY of the three test methods. A breakdown of the results for each test are given in Table 1 and a summary of concordant/ discordant test results is provided in Table 2. For all stools showing any discrepancy on direct stool testing, culture was performed and all Clostrium species detected were further evaluated. A summary of the breakdown of isolates detected and their genetic and phenotypic characterization is given in Table 3. Although the GD antigen in the Triage® is highly specific for C. difficile, there was 1/17 clostridial species (other than C. difficile) that did give a positive reaction for this antigen. Of the discordant stools listed in Table 2, the original stool test had shown; 28 were cytotoxin positive, 11 were EIA (⫹) and 62 were Triage® positive on one of the antigens (i.e., either positive for GD antigen or Toxin A antigen). Of the 67 clostridial isolates detected, 15 were clostridial species other than C. difficile, 52 were C. difficile

Table 2 Summary of concordance/discordance for diagnostic tests for CAD Diagnostic Test:

Diagnostic Test Results: Concordant N ⫽ 331

Discordant N ⫽ 69

Cytotoxin EIA Triage: Number:

Pos Pos Pos* 30

Pos Neg Pos** 16

Neg Neg Neg 301

Neg Neg Pos** 38

Pos Pos Pos*** 8

Pos Neg Neg 4

Neg Pos Neg 3

* Triage was positive for both; Toxin A and GD ** Triage results: all were; Toxin A(⫺), GD(⫹) *** Triage results: one was Toxin A(⫹), GD(⫺), and seven were; Toxin A(⫺), GD(⫹).

and of these 10 were non-toxigenic strains by PCR, and culture supernatant testing for toxin (Table 3). These data suggest that there were 42 of the 69 discrepant test results that were true positives (i.e., contained C. difficile carrying Toxin A & B). Review of the 42 stools that contained detectable toxigenic C. difficile indicated that the original direct stool tests for cytotoxin was negative for 21/42. The detection of a large number of toxigenic C. difficile isolates among the discordant stool samples, raises the question of what is the clinical significance of the toxigenic C. difficile strains detected in the stools of the patients that had discordant diagnostic test results? This question is especially critical for the 21 samples (from 17 patients) that were negative when originally tested by the cytotoxin test, that were positive by Triage® testing for GD antigen only. A review of these 17 patient charts was undertaken to assess the clinical significance of the isolate at the time the stool sample was collected. The patient’s clinical symptoms/history 3 weeks before and after the stool sample was collected were evaluated by an Infectious Disease/Medical Microbiologist specialist. Charts were available for 14 of the 17 patients. The data from the chart reviews indicated that at the time of sample collection 2/14 patients were considered to have CAD. These two patients received antibiotic therapy (Metronidazole administered for treatment of presumptive CAD) and had subsequent stool samples taken within 1–2 days that were positive by the cytotoxin test. The remaining 12 patients were assessed as NOT having CAD, as they did not receive specific CAD therapy, nor did they have any evidence in the 3 weeks before or after collection of this stool sample to support the clinical diagnosis of CAD. In our geographic area we have described the presence of a Toxin A(⫺), Toxin B(⫹) strain of C. difficile that is missed by the EIAs that only target the detection of Toxin A. This has been shown to be due to the monoclonal antibody used in these EIAs. It is specific for the CROP region of Toxin A, therefore, such tests will be negative for stool samples that contain C. difficile that lack the gene segment that codes for this CROP region. Because the CPE produced by these strains has a characteristic “no spindle” appearance (Alfa et al., 2000), we routinely culture any stool sample that shows this type of CPE and then further analyze the isolate to determine if it has an intact Toxin A gene. In addition, all of the discordant stool samples from the study group were further evaluated by culture and analysis of any Clostrium species isolated. To determine if any of the isolates were Toxin A(⫺), Toxin B(⫹), PCR using primers to amplify the A3 fragment (3.1 kb) described by Rupnick et al. (1997) was performed. If there are large deletions in the gene coding for the CROP region, these will be detected as smaller A3⬘ amplicons (Alfa et al., 2000; Rupnik et al., 1998; Rupnik et al., 1997). From the 400 stools processed for the study there were a total of 8 isolates from 7 patients that contained C. difficile isolates where the genes for Toxin A and Toxin B were present but there were large deletions in the part of the Toxin A gene that codes for the CROP

M.J. Alfa et al. / Diagnostic Microbiology and Infectious Disease 43 (2002) 257–263

261

Table 3 Characterization of the Clostridium species isolated from 69 stool samples having discordant diagnostic test results

Clostridium difficile*** (N ⫽ 52) Clostridium species (N ⫽ 15) No Clostridium isolated (N ⫽ 2)****

PCR analysis on DNA from Isolate*:

Culture supernatant analysis on isolate:

Toxin A/B: amplicon detection

A3 Fragment: size of amplicon

Cytotoxin**:

Triage:

Pos

Neg

1.3 kb

3.1 kb

Pos

Neg

Tox A only

GD only

Tox A & GD

Neg

42 0 N/D

10 15 N/D

8 N/D N/D

34 N/D N/D

42 0 N/D

10 17 N/D

0 0 N/D

11 1 N/D

31 0 N/D

10 14 N/D

* All PCR reactions for Clostridial isolates were positive for the Universal primer, indicating adequacy of DNA extraction. ** Cytotoxin Pos indicates that CPE was detected that was neutralizable by C. difficile antitoxin (see Materials and Methods section.) *** Of the 52 C. difficile isolates that were toxigenic; 21 came from stools that were originally negative by direct cytotoxin testing and were Toxin A(⫺), GD(⫹) by TCT. The other 31 isolates came from stools that were originally positive by direct cytotoxin testing. **** Both stool samples were positive by EIA (absorbance; 0.183, 0.444) on direct testing, but negative by cytotoxin and Triage on direct stool testing.

region. All of these were from stools that produced discordant test results. The direct stool testing performed on these eight samples was positive for 6/8,4/8, and 8/8, respectively for cytotoxin (the C.P.E. had typical lack of spindle formation), EIA and Triage® testing. The EIA used in this evaluation detects both Toxin A and Toxin B (materials and methods). On the Triage® test, all 8 were positive for GD antigen only. Of interest the eight C. difficile isolates that were Toxin A(⫺) all had the same 1.8 kb deletion detected in the A3 portion of the gene that codes for the CROP region and the amplicon obtained had the same restriction pattern with SmaI and EcoRI (data not shown). All eight isolates were identical by PFGE analysis (data not shown). The PFGE profile detected for these eight isolates was identical to that reported by Alfa et al. (2000) which was from a strain causing a nosocomial outbreak in another hospital in the same city. It appears that this strain is endemic in our geographic area, as retrospective analysis of stocked isolates of C. difficile indicated that we have had isolates with this same PFGE profile since 1997.

4. Discussion The data from this study indicate that compared to the cytotoxin assay as the gold standard, the TCT provides an excellent screening test for CAD because it can be performed within 20 min of receipt of the stool, and 85% of all stools tested can be reliably reported as negative or positive on the day of receipt. The remaining 15% require further testing, and the institution must determine how and when they will report the discordant Triage® test results. Furthermore, our data indicated that the TCT would not miss Toxin A(⫺), Toxin B(⫹) strains of C. difficile. TCT was more sensitive than even the cytotoxin assay at detecting the presence of toxigenic C. difficile (Tables 2, 3). However, the CT assay remains the most specific test, as our data indicate that 12/14 (86%) patients where toxigenic C.

difficile was detected by the TCT and missed by the CT were not considered to have CAD. This finding is consistent with reports in the literature indicating that although culture is the most sensitive method, cytotoxin testing remains the most specific (Gerding et al., 1995; Johnson & Gerding 1998; Knoop et al., 1993), and that up to 21% of hospitalized patients may be asymptomatic carriers of toxigenic C. difficile (Knoop et al., 1993). Furthermore, this finding supports our recommendation that discordant TCT results, (most commonly GD(⫹), Toxin A(⫺)) should not be reported to the physician, rather the sample should be further tested before results are released. Based on our data, we recommend that the discordant TCT stool samples be further tested using the CT assay as it was more sensitive and specific than the EIA (detects Toxin A and Toxin B) that was evaluated in this study. Although the TCT was extremely sensitive at detecting both toxigenic and non-toxigenic C. difficile in stool samples from patients with diarrhea 15% of tests must be resolved using additional testing. Furthermore, of the 42 toxigenic strains of C. difficile detected on culture of discordant stool samples, only 1 had been detected as Toxin A(⫹), GD(⫹) and the remaining 41 were all Toxin A(⫺), GD(⫹) on direct stool testing. The Toxin A antigen is less sensitive than the GD antigen detection in the TCT. Despite this shortcoming, the negative predictive capacity of the TCT make it an excellent screening test for CAD where 80 –90% of all stool samples submitted are negative. The greatest dilemma with TCT testing is how to report test results where GD was positive and Toxin A was negative. We have chosen to not report the discordant results, but to immediately set up the CT assay. In our center we previously performed all CAD testing by CT, therefore, resolving discordant TCT tests using CT and only reporting the final CT result provides results within TATs similar to our previous routine practice. In some centers this is not possible, as they would have to refer the stool out to a reference lab for the CT testing and this results in very prolonged TATs.

262

M.J. Alfa et al. / Diagnostic Microbiology and Infectious Disease 43 (2002) 257–263

Because of this constraint in availability of CT testing, some centers report all the data immediately and leave it up to the clinical judgment of the physician regarding treatment and isolation precautions. Although the TCT test is more costly than commercially available EIAs or CT tests, it does offer more rapid TAT, and for geographically isolated healthcare facilities, this easy to perform, self-contained test is a great improvement over prolonged transportation of samples to very distant reference laboratories. For higher volume acute care facilities, the advantages of using the TCT would be rapid TATs that could have a “real-time” impact on prescribing practices for CAD and may facilitate more optimal infection control interventions. As discussed by Conly (2000), CAD is “the new scourge of the health care facility.” Although most commonly associated with patients receiving third-generation cephalosporins, ampicillin, amoxicillin and clindamycin, CAD has been associated with virtually all antibiotics (Conly, 2000). Of great concern is the association between increasing hospitalization and death with CAD (Frost et al., 1998), and the apparent inability to provide reliable interventions that will reduce the spread of CAD within institutions (Johnson & Gerding, 1998; Olson et al., 1994). Reasons for the inability to reliably contain the spread of CAD have been suggested to be related to healthcare restructuring (Conly, 2000) resulting in increased nursing workload and difficulties in determining how to handle asymptomatic carriers of toxingenic C. difficile (Olson et al., 1994). One aspect that has not been considered, is the turn-around time for diagnostic testing and the impact this has on initiation of antibiotic therapy for CAD and lag time for isolation precaution implementation. For Mycobacterium tuberculosis, the TAT for diagnostic testing is a significant factor in the control programs. Despite the differences in the pathogenesis and culture characteristics of M.tuberculosis compared to C. difficile, the issue of impact of diagnostic testing on implementation of infection control measures may be similar. Traditionally TAT for CAD has not been considered a major factor, since the majority of patients with CAD who did not have PMC or toxic megacolon were unlikely to be adversely affected if the diagnostic test took 24 – 48 h and emperic treatment was often implemented in those cases deemed clinically warranted. However, such delays may have more of an impact than previously realized on containment of spread of CAD within the institution. Symptomatic patients with CAD have overgrowth due to C. difficile and shed large loads of organism during their bouts of diarrhea (Lyerly et al., 1988) whereas the load of organisms is thought to be lower in asymptomatic carriers. Once the organism and its spores are shed into the environment, it is extremely difficult to eradicate them (Gerding et al., 1995). Although not the purpose of this study, the ability to act on 85% of the CAD stool diagnostic test results within 1 h of sample receipt would be expected to facilitate controlling the spread of this nosocomial pathogen. The most controversial issue is whether patients who asymptomati-

cally carry toxigenic C. difficile require isolation precautions. Since the level of toxin in the stools of such patients is often so low it cannot be detected by the CT assay, this suggests that the load of toxigenic C. difficile is being controlled by the normal gastrointestinal flora. Therefore, the risk of infection transmission due to excretion and spread of this low load of toxigenic C. difficile that is posed by these asymptomatic carriers is relatively minor. Currently, neither specific antibiotic therapy or isolation precautions are recommended for asymptomatic carriers of toxigenic C. difficile. In summary, the data presented demonstrate that CT remains the most specific test for CAD, whereas the TCT provides the most rapid TAT and is an excellent screening test for CAD that allows reporting of test results on 85% of all stool samples within 20 min of specimen receipt. The discordant TCT tests require additional testing and based on our data, the CT test is recommended. The TCT test appears to be as sensitive as culture for detection of C. difficile and it does not miss strains that are Toxin A(⫺), Toxin B(⫹). Further studies are warranted to determine if the TCT can impact on prescribing practices and optimization of Infection Control intervention in the spread of CAD. Although the TCT test can detect asymptomatic carriage of toxigenic C. difficile, the issue of whether special Infection control precautions are warranted for such patients remains unanswered.

Acknowledgments The technical assistance of Nancy Olson and Rachel Suarez for maintenance of the tissue culture, and Pat Degagne for all PCR work is acknowledged. Funds for this study were provided by Biosite Diagnostics, San Diego, CA. Portions of this study were presented at the American Society for Microbiology Annual meeting in Los Angeles, CA, May 21–25, 2000 and at the Canadian Association of Clinical Microbiology and Infectious Diseases in Edmonton, Alberta, Canada Oct 31–Nov 4, 1999.

References Al-Barrak, A., Embil, J., Dyck, B., Olekson, K., Nicoll, D., Alfa, M., & Kabani, A. (1999). An outbreak of toxin A negative, toxin B positive Clostridium difficile -associated diarrhea in a Canadian tertiary-care hospital. Canada Communicable Disease Report, 25, 65– 69. Alfa, M. J., Kabani, A., Lyerly, D., Moncrief, S., Neville, L. M., Al-Barrak, A., Harding, G. K. H., Dyck, B., Olekson, K., & Embil, J. M. (2000). Characterization of a Toxin A-negative, Toxin B-positive strain of Clostridium difficile responsible for a nosocomial outbreak of Clostridium difficile-associated diarrhea. Journal of Clinical Microbiology, 38, 2706 –2714. Bartlett, J. G. (1992). Antibiotic-associated diarrhea. State-of-the-art clinical article. Clinical Infectious Diseases, 15, 573–581. Bradbury, A. W., & Barrett, S. (1997). Surgical aspects of Clostridium difficile colitis. British Journal of Surgery, 84, 150 –159.

M.J. Alfa et al. / Diagnostic Microbiology and Infectious Disease 43 (2002) 257–263 Clinical Microbiology Procedures Handbook. HD Isenberg (editor in chief) (1994). American Society for Microbiology, Washington, D.C. publisher. Cohen, S. H., Tang, Y. J., & Silva, J. (2000). Analysis of the pathogenicity locus in Clostridium difficile strains. Journal of Infectious Diseases, 181, 659 – 663. Conly, J. M. (2000). Clostridium difficile-associated diarrhea—The new scourge of the health care facility. Canadian Journal of Infectious Diseases, 11, 25–27. Fekety, R., McFarland, L. V., Surawicz, C. M., Greenberg, R. N., Elmer, G. W., & Mulligan, M. E. (1997). Recurrent Clostridium difficile diarrhea: characteristics of and risk factors for patients enrolled in a prospective, randomized, double-blinded trial. Clinical Infectious Diseases, 24, 324 –333. Frost, F., Craun, G. F., & Calderon, R. L. (1998). Increasing hospitalization and death possibly due to Clostridium difficile diarrheal disease. Emerging Infectious Diseases, 4, 619 – 625. Gerding, D., Johnson, S., Peterson, L. R., Mulligan, M. E., & Silva, J. (1995). Clostridium difficile-associated diarrhea and colitis. Infection Control and Hospital Epidemiology, 16, 459 – 477. Greisen, K., Loeffeholz, M., Purohit, A., & Leong, D. (1994). PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid. Journal of Clinical Microbiology, 32, 335–351. Johnson, S., & Gerding, D. N. (1998). Clostridium difficile- associated diarrhea. State-of-the-art clinical article. Clinical Infectious Diseases, 26, 1027–1036.

263

Kato, H., Kato, N., Watanabe, K., Iwai, N., Nakamura, H., Yamamoto, T., Suzuki, K., Kim, S. M., Chong, Y., & Wasito, E. B. (1998). Identification of toxin A-negative, toxin B-positive Clostridium difficile by PCR. Journal of Clinical Microbiology, 36, 2178 –2182. Knoop, F. C., Owens, M., & Crocker, C. (1993). Clostridium difficile: clinical disease and diagnosis. Clinical Microbiology Reviews, 6, 251– 265. Lyerly, D. M., Krivan, H. C., & Wilkins, T. D. (1988). Clostridium difficile: its disease and toxins. Clinical Microbiology Reviews, 1, 1–18. McGowan, K. L., & Kader, H. A. (1999). Clostridium difficile infection in children. Clinical Microbiology Newsletter, 21, 49 –53. Olson, M. M., Shanholtzer, C. J., James, T. L., & Gerding, D. N. (1994). Ten years of prospective Clostridium difficile-associated disease surveillance and treatment at the Minneapolis VA Medical Center, 1982– 1991. Infection Control and Hospital Epidemiology, 15, 371–381. Rupnik, M., Avesani, V., Jac, M., von Eichel-Streiber, C., & Delmee, M. (1998). A novel toxinotyping scheme and correlation of toxinotypes with serogroups of Clostridium difficile isolates. Journal of Clinical Microbiology, 36, 2240 –2247. Rupnik, M., Braun, V., Soehn, F., Janc, M., Hofstetter, M., LaufenbergFeldmann, R., & von Eichel-Streiber, C. (1997). FEMS Microbiology Letters, 148, 197–202. Von Eichel-Streiber, C., Laufenberg-Feldmann, C., Sartingen, S., Schulze, J., & Sauerborn, M. (1992). Comparative sequence analysis of the Clostridium difficile toxins A and B. Molecular and General Genetics, 233, 260 –268.