- Email: [email protected]
The differentiation of rat adipose-derived stem cells into OEC-like cells on collagen scaffolds by co-culturing with OECs
Neuroscience Letters 421 (2007) 191–196
The differentiation of rat adipose-derived stem cells into OEC-like cells on collagen scaffolds by co-culturing with OECs Bin Wang a,b , Jin Han a , Yuan Gao a , Zhifeng Xiao a , Bing Chen a , Xia Wang a , Wenxue Zhao a , Jianwu Dai a,b,∗ a
Key Laboratory of Molecular Developmental Biology, Institute of Genetics and Developmental Biology Chinese Academy of Sciences, China b The Graduate School of Chinese Academy of Sciences, China Received 24 January 2007; received in revised form 13 March 2007; accepted 6 April 2007
Abstract Olfactory ensheathing cells (OECs) transplantation is a promising or potential therapy for spinal cord injury (SCI). However, their clinical use is limited because of the availability. Adipose-derived stem cells (ADSCs) have been identified as an alternative source of adult stem cells in recent years. ADSCs could be differentiated into various mesenchymal tissues cells such as chondrocytes, adipocytes, osteoblasts, and myocytes and also could be differentiated into neural lineages. In this study, we examined the feasibility of using ADSCs as a source of stem cells for the differentiation of OECs by co-culture approach. When co-cultured with OECs, the ADSCs on three-dimensional collagen scaffolds were differentiated into OEC-like cells, with similar morphology and antigenic phenotypes (p75NTR+/Nestin+/GFAP−) of OECs. Co-cultured ADSCs were positive for several important functional markers of mature OECs such as neurotrophic factor GDNF, BDNF and myelin protein PLP and the conditioned medium of OEC-like cells could significantly promote DRG neuron growth and axon sprouting without NGF supporting in contrast to that of the ADSCs. Our results showed that ADSCs had the potential to differentiate into OEC-like cells on the three-dimensional collagen scaffolds in vitro. © 2007 Published by Elsevier Ireland Ltd. Keywords: OECs; ADSCs; Differentiation; Co-culture; Three-dimensional culture
The olfactory ensheathing cells (OECs) are believed to be important for the repair of damaged CNS. In animal models, cultured OECs transplanted into ablated corticospinal tract [16], fasciculus gracilis [12], or nerve bridges in the spinal cord promoted the survival of injured neuron and functional recovery [20]. OECs are considered one of the most promising candidates for the treatment of transected and demyelinated spinal cord [13]. However, their clinical use is limited by the availability of the functional cells. Using stem cells for cell-based therapies is an increasing promising strategy. Embryonic stem cells are able to expand
∗ Corresponding author at: Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, 3 Nanyitiao, Zhongguancun, Beijing 100080, China. Tel.: +86 10 82614426; fax: +86 10 82614426. E-mail addresses: [email protected] (B. Wang), [email protected] (J. Han), [email protected] (Y. Gao), [email protected] (Z. Xiao), [email protected] (B. Chen), [email protected] (X. Wang), zhaowenxue [email protected] (W. Zhao), [email protected] (J. Dai).
0304-3940/$ – see front matter © 2007 Published by Elsevier Ireland Ltd. doi:10.1016/j.neulet.2007.04.081
and differentiate into multiple lineages including neural lineages in vitro and in vivo. However, there were still limitations on the practical use of embryonic stem cells because of ethical concerns [15]. In recent years, adipose-derived stem cells (ADSCs) have been showed as an alternative source of adult stem cells [11,27]. ADSCs could be differentiated into a variety of mesenchymal tissues cells such as chondrocytes, adipocytes, osteoblasts, and myocytes [11,27,9] and also could be differentiated into neural lineages [3,14]. In previous studies, stem cells were induced to differentiate into a peripheral glial lineage [17,22] and generated mature myelinating Schwann cells in vitro or in vivo [2]. Using ADSCs for customized cell-based therapies have advantages: adequate cells available from the patient, no ethical questions and avoiding immunological rejection of the transplanted cells. In our previous work, we found that three-dimensional (3D) scaffolds provide a suitable niche for OECs to maintain their morphology, as well as functional phenotypes [23]. We proposed that 3D culture could be important in ADSCs’ differentiation. Thus, we studied ADSCs on 3D collagen scaffolds co-cultured with OECs in an attempt to differentiate ADSCs into OECs.
192
B. Wang et al. / Neuroscience Letters 421 (2007) 191–196
Fig. 1. Primary cultured OECs and ADSCs. (A) Phase-contrast image of ADSCs; (B) phase-contrast image of OECs; (C) immunostaining of primary OECs with anti-P75NTR and Hoechst33342; (D) p75NTR was expressed in cytoplasm of OECs. Bar scale 100 m; (E) the structure of 3D collagen scaffolds used in this work observed by SEM; (F) the schematic drawing of ADSCs co-cultured with OECs.
Three-dimensional collagen scaffolds were obtained from Zhenghai Biotechnology Inc. (Shandong, China). Scanning electron microscope (SEM) was used to visualize their surface feature. The structure of 3D collagen scaffolds was shown in Fig. 1E. The average pore size is 20–100 m in diameter. This would provide suitable spaces for cells to grow into the scaffold. OECs were isolated from adult male Sprague–Dawley rats (180–220 g). The method was described in our previous report [23]. Primary culture of ADSCs was performed as described in a previous study [18]. 1 × 106 ADSCs were seeded on pieces of 1 cm × 1 cm × 0.02 cm 3D collagen scaffolds with DMEM/F12 medium containing 10% FBS overnight and replaced with DMEM/F12 medium containing 3% FBS for 2 days of culture. As shown in Fig. 1F, the pieces of 3D collagen scaffold with ADSCs were transferred to transwell insert (diameter 12 mm, non-treated) and five transwell inserts were co-cultured with OECs in 60 mm culture dish with 15 ml DMEM/F12 medium containing 3% FBS and, with 1/2 volume of the co-culture medium replacement every 4 days. The control group was without OECs. ADSCs were trypsinized from 3D collagen scaffold with 0.25% trypsin after co-culture with OECs for 30 days and approximately 8 × 105 cells were seeded in a 60-mm cul-
ture dish with 5 ml DMEM/F12 medium (3% FBS) for 2 days. The medium was replaced with 5 ml N2 medium (neurobasal medium plus N2) without FBS. After 4 days, the medium was collected as conditioned medium for functional assay. The ADSCs without co-culture OECs in the same condition were negative control and OECs were positive control. Details of dorsal root ganglion (DRG) neurons culture preparation have been described in a previous study [19]. Approximately 5000 DRG cells were plated per well (24 well plate). After seeding and overnight incubation, the cultures were flooded and subsequently treated with NLA medium containing 5 -fluoro-2 -deoxyuridine (FUDR) at 20 g/ml and uridine at 10 g/ml 2 days to kill the non-neuronal cells (fibroblasts, SCs, and phagocytes). After this antimitotic treatment, the resulting DRGN cultures were maintained on conditioned medium for 3 days. Then DRG neurons were stained by mouse anti-rat III-tubulin antibody (Sigma). RT-PCR was used to evaluate the gene expression of p75 NTR, GFAP, Nestin, nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), and glia cell line-derived neurotrophic factor (GDNF), PLP, MBP, and MAG in ADSCs co-cultured with OECs. The primers of detected genes were
B. Wang et al. / Neuroscience Letters 421 (2007) 191–196
193
Table 1 Primers used in this study Gene
Forward (5 to 3 )
Reverse (5 to 3 )
PCR product (bp)
-Actin P75 GFAP Nestin BDNF GDNF NGF PLP MBP MAG
GTCCCTGTATGCCTCTGGTC AGGGCACATACTCAGACGAA CTTCCCGCAACGCAGAG GCTGGAGCGGGAGTTAG TGGTTATTTCATACTTCGGTTGC GATGAAGTTATGGGATGTCG GTTTAGCACCCAGCCTCC GTGTTTGCCTGCTCTGCT TCGCAGAGGACCCAAGATG CTGTGGTCGCCTTTGCC
GGTCTTTACGGATGTCAACG CAAGATGGAGCAATAGACAG GAGCCGTGGGCACTAAA GAAGGGAAGGATGTGGG ATGGGATTACACTTGGTCTCG TTCCTCCTTGGTTTCGTAG GCTCTTCTCACAGCCTTCC TTCATTCCTCTGCGACTT TAAGAAGCCGAGGGCAGGA TGTCCTTGGTGGGTCGT
458 327 631 681 550 418 459 616 210 273
shown in Table 1. Total RNA was extracted using TRIzol reagent (Invitrogen life technologies) according to the manufacturer’s protocol. Primers for -actin gene were cycled 28 times and others were cycled 32 times. Table 1 listed primers of genes for PCR. PCR products were analyzed on 1.2% agarose gel with an Image Acquisition and Analysis Software (Labworks, Japan). To test the purity of OECs in primary culture and the percentage of survival DRG neurons promoted by conditioned medium of co-cultured ADSCs, rabbit anti-rat p75NTR antibody (Upstate) and mouse anti-rat  III-tubulin antibody (Sigma) were used for immunocytochemistry staining, respectively. The secondary antibodies were FITC-conjugated goat anti-rabbit IgG and FITC-conjugated rabbit anti-mouse IgG (Sigma) at dilutions of 1:800. The cells were fixed with ice-cold 4% paraformaldehyde for 30 min and then blocked with goat blocking serum for an hour. The primary antibodies were incubated with cells overnight at 4 ◦ C. Cells were incubated with the secondary FITC-conjugated antibodies and Hoechst33342 (1 g/ml) for 1 h at room temperature. The images of Hoechsst dye staining (to identify the total number of cells in the field) and the respective antigens were captured with a Zeiss Axiovert 200 (Carl Zeiss). The respective images were overlaid and the percentage of antigen positive cells was calculated. Six random
fields/well from three replicated wells were counted. Results were presented as mean values with standard deviations. Twotailed t-test was used. P-values of <0.05 are referred to as significance in the text. All experiments were performed in triplicate and repeated at least twice. Fig. 1A showed the typical phase-contrast microscopic appearance of primary ADSCs. As Fig. 1B showed, OECs typically were spindle-shaped and were either bipolar, tripolar, or occasionally multipolar, often with one or more branched processes. To exam the purity of primary cultured OECs, we stained OECs with p75 and Hoechst 33342 (Fig. 1C). Cells with green and blue fluorescence were OECs. The OECs purity was 93.75 ± 5.44% (n = 4). At co-culture day 0, day 20, and day 30, the ADSCs on 3D collagen scaffold were visualized by fluorescein diacetate (FDA, Sigma) staining. As Fig. 2 showed, ADSCs co-cultured with OECs had striking morphology changes compared to the control. ADSCs seeded on 3D collagen scaffolds had round and big cell body and short process (Fig. 2A and B). When ADSCs were co-cultured with OECs for 20 days and 30 days, some cells showed spindle-like morphology with bi- or tripolar, assembling the appearance of OECs (Fig. 2C and E). The control ADSCs on 3D collagen scaffolds remained the round cell body and short processes.
Fig. 2. FDA staining of ADSCs on collagen scaffold at 0, 20, and 30 day. (A, C, and E) The morphology of ADSCs co-cultured with OECs at 0, 20, and 30 day, repectively. (B, D, and F) The morphology of ADSCs at 0, 20, and 30 day, respectively. Bar scale 100 m.
194
B. Wang et al. / Neuroscience Letters 421 (2007) 191–196
Fig. 3. Detection of P75NTR, Nestin, GDNF, BDNF, and PLP by RT-PCR. Lane 1, OECs; Lane 2, ADSCs co-cultured with OECs; and Lane 3, ADSCs.
As shown in Fig. 3, P75NTR gene and Nestin gene expressions were detected weakly in ADSCs co-cultured with OECs at day 20, and were strongly expressed at day 30. However, glial fibrillary acidic protein (GFAP, an intermediate filament associated with glial cells) highly expressed in OECs was not detected during the experimental period (data not showed). Cultured OECs expressed nerve growth factor, brain-derived neurotrophic factor, glia cell line-derived neurotrophic factor and their receptors. The expression of NGF, GDNF, and BDNF in ADSCs co-cultured with OECs were examined. After 30-day co-culture, GDNF and BDNF were detected (Fig. 3). However, NGF was not detected (data not shown). We also measured the expression of PLP, MBP and MAG genes, and successfully detected PLP gene expression in OEC-co-cultured ADSCs at 30 day. DRG neurons were cultured in vitro with 10 ng/ml NGF for 48 h, and then the medium was replaced with conditioned medium prepared from ADSCs, co-cultured ADSCs, and OECs, respectively, for 72 h. Conditioned medium from OECs could significantly promote DRG neuron growth and axon sprouting without NGF supporting. The percentage of -III tubulin positive cells (DRG neuron cell) was 53.0 ± 5.0%. Like OECs, co-cultured ADSCs’ conditioned medium could promote growth
and axon sprouting of DRG neurons and the percentage of -III tubulin positive cells was 31.2 ± 4.3%, significantly higher than 22.4 ± 4.9% of ADSCs’ (P < 0.05) (Fig. 4). Cell transplantation needed large number of cells, but the in vitro expansion potential of committed OECs was limited. In vitro expansion of ADSCs was considered a powerful approach to overcome some practical and ethical concerns of cell transplantation. In this study, we examined the feasibility of ADSCs as a source of stem cells for differentiation into OECs. We found that, by co-culturing with OECs, the ADSCs on 3D collagen scaffolds were efficiently differentiated into OEClike cells, with similar morphology and antigenic phenotypes (p75NTR+/Nestin+/GFAP−) of OECs. P75NTR was expressed in cultured OECs and was an important marker for OECs. Like p75NTR gene, both Nestin and GFAP genes were expressed in OECs. After 20 days of coculture with OECs, ADSCs were found to very weakly express P75NTR and Nestin mRNA, and the OEC-cell-like morphology. Only at 30 day, co-cultured ADSCs were positive for the functional markers of mature OECs such as neurotrophic factor GDNF, BDNF and myelin protein PLP. This indicates that the morphological changes occur earlier than the study marker expression in co-cultured ADSCs. Interestingly, after long-term co-culture, the conditioned medium prepared from OEC-like cells could significantly promote DRG neuron growth and axon sprouting without NGF supporting in contrast to that of the ADSCs. Neurotrophins play important roles in improving the survival and growth of damaged axons [4,6]. The mechanism of OECs in stimulating CNS regeneration is still unclear. A number of studies showed that the transplantation of OECs into injured CNS was able to promote the growth of axons, producing new myelin sheaths around demyelinated or amyelinated axons, and in some cases restore functional connections [5,10]. The growth factors produced by OECs were thought to play important roles in CNS regeneration. In vitro cultured rat OECs could express nerve growth factor (NGF), glia cell line-derived neurotrophic factor (GDNF), brain-derived neurotrophic factor (BDNF) and their receptors [25]. In animal models, transplan-
Fig. 4. Functional assay of conditioned medium: immunostaining of DRG neurons with anti- III tubulin and Hoechst33342. A, B and C showed DRG neurons immunostaining with conditioned medium from ADSCs, ADSCs co-cultured with OECs, and OECs, respectively. D showed the percentage of DRG neurons growing in the conditioned medium. (** P < 0.01, * P < 0.05). Bar scale 100 m.
B. Wang et al. / Neuroscience Letters 421 (2007) 191–196
tation of OECs transfected neurotrophic factor gene promote spine cord injury repair [7,21]. Because the pore size of the inserts is too small (diameter 0.4 M) to for OECs, and ADSCs were trypsinized from 3D collagen scaffold with trypsin after co-culture with OECs for 30 days, in this experiment conditioned medium of co-cultured cells of course will not contain components derived from the OEC. So the GDNF, BDNF and other factors secreted from OEC-like cells may contribute to the growth and axon sprouting of DRG neurons. Demyelination is another feature of spinal cord injuries, and many surviving axons may fail to conduct signals because remyelinaton has failed. Roteolipid protein (PLP) and myelin basic proteins (MBP) are two mayor myelin proteins, making up 30% and 40% of total myelin protein in CNS, respectively. PLP gene expression was detected in ADSCs co-cultured with OECs for 30 days and this indicated the OECs-like cells have partly myelin function. Adult stem cells are believed to have broad differentiation potential that could be induced by exposing stem cells to the extra cellular developmental signals of other lineages in mixedcell cultures [1,8]. In previous studies, co-cultured mouse neural stem cells (NSCs) committed to neurons and glial cells with human endothelial cells, NSC population converted to cells that did not express neuronal or glial markers, but instead showed the stable expression of multiple endothelial markers and the capacity to form capillary networks [26]. In this study, we co-cultured ADSCs on 3D collagen scaffolds with OECs and obtained OEClike cells. The soluble differentiation signals from OECs might have driven the differentiation of ADSCs into OEC-like cells. Stem cell plasticity was thought to form the foundation for one of the multiple prospective uses of adult stem cells in regenerative medicine [24]. Our results showed that ADSCs cells were able to differentiate into OEC-like cells in vitro. These findings are clinically relevant and could be helpful for the development of the cell-based therapeutic strategies for CNS repair. Acknowledgements This work was supported by grants from NSFC (30688002 and 30428017) and a grant from the Ministry of Science and Technology of China (2006CB943601). The authors also gratefully acknowledge the support of K.C. Wong Education Foundation, Hong Kong. References [1] A.R. Alexanian, M. Sieber-Blum, Differentiating adult hippocampal stem cells into neural crest derivatives, Neuroscience 118 (2003) 1–5. [2] J.B. Aquino, J. Hjerling-Leffler, M. Koltzenburg, T. Edlund, M.J. Villar, P. Ernfors, In vitro and in vivo differentiation of boundary cap neural crest stem cells into mature Schwann cells, Exp. Neurol. 198 (2006) 438– 449. [3] P.H. Ashjian, A.S. Elbarbary, B. Edmonds, D. DeUgarte, M. Zhu, P.A. Zuk, H.P. Lorenz, P. Benhaim, M.H. Hedrick, In vitro differentiation of human processed lipoaspirate cells into early neural progenitors, Plast. Reconstr. Surg. 111 (2003) 1922–1931. [4] N.I. Bamber, H. Li, X. Lu, M. Oudega, P. Aebischer, X.M. Xu, Neurotrophins BDNF andNT-3 promote axonal re-entry into the distal host spinal cord through Schwann cell-seeded mini-channels, Eur. J. Neurosci. 13 (2001) 257–268.
195
[5] S.C. Barnett, C.L. Alexander, Y. Iwashita, J.M. Gilson, J. Crowther, L. Clark, L.T. Dunn, V. Papanastassiou, P.G. Kennedy, R.J. Franklin, Identification of a human olfactory ensheathing cell that can affect transplant-mediated remyelination of demyelinated CNS axons, Brain 123 (2000) 1581–1588. [6] A. Blesch, H.S. Uy, R.J. Grill, J.G. Cheng, P.H. Patterson, M.H. Tuszynski, Leukemia inhibitory factor augments neurotrophin expression and corticospinal axon growth after adult CNS injury, J. Neurosci. 19 (1999) 3556–3566. [7] L. Cao, L. Liu, Z.Y. Chen, L.M. Wang, J.L. Ye, H.Y. Qiu, C.L. Lu, C. He, Olfactory ensheathing cells genetically modified to secrete GDNF to promote spinal cord repair, Brain 127 (2004) 535–549. [8] G. Condorelli, U. Borello, L. De Angelis, M. Latronico, D. Sirabella, M. Coletta, R. Galli, G. Balconi, A. Follenzi, G. Frati, Cardiomyocytes induce endothelial cells to trans-differentiate into cardiac muscle: implications for myocardium regeneration, Proc. Natl. Acad. Sci. U. S. A. 98 (2001) 10733–10738. [9] G.R. Erickson, J.M. Gimble, D.M. Franklin, H.E. Rice, H. Awad, F. Guilak, Chondrogenic potential of adipose tissue-derived stromal cells in vitro and in vivo, Biochem. Biophys. Res. Commun. 290 (2002) 763– 769. [10] R.J. Franklin, J.M. Gilson, I.A. Franceschini, S.C. Barnett, Schwann celllike myelination following transplantation of an olfactory bulb-ensheathing cell line into areas of demyelination in the adult CNS, Glia 17 (1996) 217–224. [11] Y.C. Halvorsen, W.O. Wilkison, J.M. Gimble, Adipose-derived stromal cells—their utility and potential in bone formation, Int. J. Obes. Relat. Metab. Disord. 24 (Suppl. 4) (2000) S41–S44. [12] T. Imaizumi, K.L. Lankford, J.D. Kocsis, Transplantation of olfactory ensheathing cells or Schwann cells restores rapid and secure conduction across the transected spinal cord, Brain Res. 854 (2000) 70– 78. [13] T. Imaizumi, K.L. Lankford, S.G. Waxman, C.A. Greer, J.D. Kocsis, Transplanted olfactory ensheathing cells remyelinate and enhance axonal conduction in the demyelinated dorsal columns of the rat spinal cord, J. Neurosci. 18 (1998) 6176–6185. [14] S.K. Kang, D.H. Lee, Y.C. Bae, H.K. Kim, S.Y. Baik, J.S. Jung, Improvement of neurological deficits by intracerebral transplantation of human adipose tissue-derived stromal cells after cerebral ischemia in rats, Exp. Neurol. 183 (2003) 355–366. [15] N. Lenoir, Europe confronts the embryonic stem cell research challenge, Science 287 (2000) 1425–1427. [16] Y. Li, P.M. Field, G. Raisman, Repair of adult rat corticospinal tract by transplants of olfactory ensheathing cells, Science 277 (1997) 2000– 2002. [17] S.J. Morrison, S.E. Perez, Z. Qiao, J.M. Verdi, C. Hicks, G. Weinmaster, D.J. Anderson, Transient notch activation initiates an irreversible switch from neurogenesis to gliogenesis by neural crest stem cells, Cell 101 (2000) 499–510. [18] R. Ogawa, H. Mizuno, A. Watanabe, M. Migita, T. Shimada, H. Hyakusoku, Osteogenic and chondrogenic differentiation by adipose-derived stem cells harvested from GFP transgenic mice, Biochem. Biophys. Res. Commun. 313 (2004) 871–877. [19] G.W. Plant, P.F. Currier, E.P. Cuervo, M.L. Bates, Y. Pressman, M.B. Bunge, P.M. Wood, Purified adult ensheathing glia fail to myelinate axons under culture conditions that enable Schwann cells to form myelin, J. Neurosci. 22 (2002) 6083–6091. [20] A. Ramon-Cueto, G.W. Plant, J. Avila, M.B. Bunge, Long-distance axonal regeneration in the transected adult rat spinal cord is promoted by olfactory ensheathing glia transplants, J. Neurosci. 18 (1998) 3803– 3815. [21] M.J. Ruitenberg, D.B. Levison, S.V. Lee, J. Verhaagen, A.R. Harvey, G.W. Plant, NT-3 expression from engineered olfactory ensheathing glia promotes spinal sparing and regeneration, Brain 128 (2005) 839– 853. [22] N.M. Shah, M.A. Marchionni, I. Isaacs, P. Stroobant, D.J. Anderson, Glial growth factor restricts mammalian neural crest stem cells to a glial fate, Cell 77 (1994) 349–360.
196
B. Wang et al. / Neuroscience Letters 421 (2007) 191–196
[23] B. Wang, Y. Zhao, H. Lin, B. Chen, J. Zhang, X. Wang, W. Zhao, J. Dai, Phenotypical analysis of adult rat olfactory ensheathing cells on 3D collagen scaffolds, Neurosci. Lett. 401 (2006) 65–70. [24] I.L. Weissman, Translating stem and progenitor cell biology to the clinic: barriers and opportunities, Science 287 (2000) 1442–1446. [25] E. Woodhall, A.K. West, M.I. Chuah, Cultured olfactory ensheathing cells express nerve growth factor, brain-derived neurotrophic factor, glia cell line-derived neurotrophic factor and their receptors, Brain Res. Mol. Brain Res. 88 (2001) 203–213.
[26] A.E. Wurmser, K. Nakashima, R.G. Summers, N. Toni, K.A. D’Amour, D.C. Lie, F.H. Gage, Cell fusion-independent differentiation of neural stem cells to the endothelial lineage, Nature 430 (2004) 350– 356. [27] P.A. Zuk, M. Zhu, H. Mizuno, J. Huang, J.W. Futrell, A.J. Katz, P. Benhaim, H.P. Lorenz, M.H. Hedrick, Multilineage cells from human adipose tissue: implications for cell-based therapies, Tissue Eng. 7 (2001) 211– 228.
The differentiation of rat adipose-derived stem cells into OEC-like cells on collagen scaffolds by co-culturing with OECs Bin Wang a,b , Jin Han a , Yuan Gao a , Zhifeng Xiao a , Bing Chen a , Xia Wang a , Wenxue Zhao a , Jianwu Dai a,b,∗ a
Key Laboratory of Molecular Developmental Biology, Institute of Genetics and Developmental Biology Chinese Academy of Sciences, China b The Graduate School of Chinese Academy of Sciences, China Received 24 January 2007; received in revised form 13 March 2007; accepted 6 April 2007
Abstract Olfactory ensheathing cells (OECs) transplantation is a promising or potential therapy for spinal cord injury (SCI). However, their clinical use is limited because of the availability. Adipose-derived stem cells (ADSCs) have been identified as an alternative source of adult stem cells in recent years. ADSCs could be differentiated into various mesenchymal tissues cells such as chondrocytes, adipocytes, osteoblasts, and myocytes and also could be differentiated into neural lineages. In this study, we examined the feasibility of using ADSCs as a source of stem cells for the differentiation of OECs by co-culture approach. When co-cultured with OECs, the ADSCs on three-dimensional collagen scaffolds were differentiated into OEC-like cells, with similar morphology and antigenic phenotypes (p75NTR+/Nestin+/GFAP−) of OECs. Co-cultured ADSCs were positive for several important functional markers of mature OECs such as neurotrophic factor GDNF, BDNF and myelin protein PLP and the conditioned medium of OEC-like cells could significantly promote DRG neuron growth and axon sprouting without NGF supporting in contrast to that of the ADSCs. Our results showed that ADSCs had the potential to differentiate into OEC-like cells on the three-dimensional collagen scaffolds in vitro. © 2007 Published by Elsevier Ireland Ltd. Keywords: OECs; ADSCs; Differentiation; Co-culture; Three-dimensional culture
The olfactory ensheathing cells (OECs) are believed to be important for the repair of damaged CNS. In animal models, cultured OECs transplanted into ablated corticospinal tract [16], fasciculus gracilis [12], or nerve bridges in the spinal cord promoted the survival of injured neuron and functional recovery [20]. OECs are considered one of the most promising candidates for the treatment of transected and demyelinated spinal cord [13]. However, their clinical use is limited by the availability of the functional cells. Using stem cells for cell-based therapies is an increasing promising strategy. Embryonic stem cells are able to expand
∗ Corresponding author at: Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, 3 Nanyitiao, Zhongguancun, Beijing 100080, China. Tel.: +86 10 82614426; fax: +86 10 82614426. E-mail addresses: [email protected] (B. Wang), [email protected] (J. Han), [email protected] (Y. Gao), [email protected] (Z. Xiao), [email protected] (B. Chen), [email protected] (X. Wang), zhaowenxue [email protected] (W. Zhao), [email protected] (J. Dai).
0304-3940/$ – see front matter © 2007 Published by Elsevier Ireland Ltd. doi:10.1016/j.neulet.2007.04.081
and differentiate into multiple lineages including neural lineages in vitro and in vivo. However, there were still limitations on the practical use of embryonic stem cells because of ethical concerns [15]. In recent years, adipose-derived stem cells (ADSCs) have been showed as an alternative source of adult stem cells [11,27]. ADSCs could be differentiated into a variety of mesenchymal tissues cells such as chondrocytes, adipocytes, osteoblasts, and myocytes [11,27,9] and also could be differentiated into neural lineages [3,14]. In previous studies, stem cells were induced to differentiate into a peripheral glial lineage [17,22] and generated mature myelinating Schwann cells in vitro or in vivo [2]. Using ADSCs for customized cell-based therapies have advantages: adequate cells available from the patient, no ethical questions and avoiding immunological rejection of the transplanted cells. In our previous work, we found that three-dimensional (3D) scaffolds provide a suitable niche for OECs to maintain their morphology, as well as functional phenotypes [23]. We proposed that 3D culture could be important in ADSCs’ differentiation. Thus, we studied ADSCs on 3D collagen scaffolds co-cultured with OECs in an attempt to differentiate ADSCs into OECs.
192
B. Wang et al. / Neuroscience Letters 421 (2007) 191–196
Fig. 1. Primary cultured OECs and ADSCs. (A) Phase-contrast image of ADSCs; (B) phase-contrast image of OECs; (C) immunostaining of primary OECs with anti-P75NTR and Hoechst33342; (D) p75NTR was expressed in cytoplasm of OECs. Bar scale 100 m; (E) the structure of 3D collagen scaffolds used in this work observed by SEM; (F) the schematic drawing of ADSCs co-cultured with OECs.
Three-dimensional collagen scaffolds were obtained from Zhenghai Biotechnology Inc. (Shandong, China). Scanning electron microscope (SEM) was used to visualize their surface feature. The structure of 3D collagen scaffolds was shown in Fig. 1E. The average pore size is 20–100 m in diameter. This would provide suitable spaces for cells to grow into the scaffold. OECs were isolated from adult male Sprague–Dawley rats (180–220 g). The method was described in our previous report [23]. Primary culture of ADSCs was performed as described in a previous study [18]. 1 × 106 ADSCs were seeded on pieces of 1 cm × 1 cm × 0.02 cm 3D collagen scaffolds with DMEM/F12 medium containing 10% FBS overnight and replaced with DMEM/F12 medium containing 3% FBS for 2 days of culture. As shown in Fig. 1F, the pieces of 3D collagen scaffold with ADSCs were transferred to transwell insert (diameter 12 mm, non-treated) and five transwell inserts were co-cultured with OECs in 60 mm culture dish with 15 ml DMEM/F12 medium containing 3% FBS and, with 1/2 volume of the co-culture medium replacement every 4 days. The control group was without OECs. ADSCs were trypsinized from 3D collagen scaffold with 0.25% trypsin after co-culture with OECs for 30 days and approximately 8 × 105 cells were seeded in a 60-mm cul-
ture dish with 5 ml DMEM/F12 medium (3% FBS) for 2 days. The medium was replaced with 5 ml N2 medium (neurobasal medium plus N2) without FBS. After 4 days, the medium was collected as conditioned medium for functional assay. The ADSCs without co-culture OECs in the same condition were negative control and OECs were positive control. Details of dorsal root ganglion (DRG) neurons culture preparation have been described in a previous study [19]. Approximately 5000 DRG cells were plated per well (24 well plate). After seeding and overnight incubation, the cultures were flooded and subsequently treated with NLA medium containing 5 -fluoro-2 -deoxyuridine (FUDR) at 20 g/ml and uridine at 10 g/ml 2 days to kill the non-neuronal cells (fibroblasts, SCs, and phagocytes). After this antimitotic treatment, the resulting DRGN cultures were maintained on conditioned medium for 3 days. Then DRG neurons were stained by mouse anti-rat III-tubulin antibody (Sigma). RT-PCR was used to evaluate the gene expression of p75 NTR, GFAP, Nestin, nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), and glia cell line-derived neurotrophic factor (GDNF), PLP, MBP, and MAG in ADSCs co-cultured with OECs. The primers of detected genes were
B. Wang et al. / Neuroscience Letters 421 (2007) 191–196
193
Table 1 Primers used in this study Gene
Forward (5 to 3 )
Reverse (5 to 3 )
PCR product (bp)
-Actin P75 GFAP Nestin BDNF GDNF NGF PLP MBP MAG
GTCCCTGTATGCCTCTGGTC AGGGCACATACTCAGACGAA CTTCCCGCAACGCAGAG GCTGGAGCGGGAGTTAG TGGTTATTTCATACTTCGGTTGC GATGAAGTTATGGGATGTCG GTTTAGCACCCAGCCTCC GTGTTTGCCTGCTCTGCT TCGCAGAGGACCCAAGATG CTGTGGTCGCCTTTGCC
GGTCTTTACGGATGTCAACG CAAGATGGAGCAATAGACAG GAGCCGTGGGCACTAAA GAAGGGAAGGATGTGGG ATGGGATTACACTTGGTCTCG TTCCTCCTTGGTTTCGTAG GCTCTTCTCACAGCCTTCC TTCATTCCTCTGCGACTT TAAGAAGCCGAGGGCAGGA TGTCCTTGGTGGGTCGT
458 327 631 681 550 418 459 616 210 273
shown in Table 1. Total RNA was extracted using TRIzol reagent (Invitrogen life technologies) according to the manufacturer’s protocol. Primers for -actin gene were cycled 28 times and others were cycled 32 times. Table 1 listed primers of genes for PCR. PCR products were analyzed on 1.2% agarose gel with an Image Acquisition and Analysis Software (Labworks, Japan). To test the purity of OECs in primary culture and the percentage of survival DRG neurons promoted by conditioned medium of co-cultured ADSCs, rabbit anti-rat p75NTR antibody (Upstate) and mouse anti-rat  III-tubulin antibody (Sigma) were used for immunocytochemistry staining, respectively. The secondary antibodies were FITC-conjugated goat anti-rabbit IgG and FITC-conjugated rabbit anti-mouse IgG (Sigma) at dilutions of 1:800. The cells were fixed with ice-cold 4% paraformaldehyde for 30 min and then blocked with goat blocking serum for an hour. The primary antibodies were incubated with cells overnight at 4 ◦ C. Cells were incubated with the secondary FITC-conjugated antibodies and Hoechst33342 (1 g/ml) for 1 h at room temperature. The images of Hoechsst dye staining (to identify the total number of cells in the field) and the respective antigens were captured with a Zeiss Axiovert 200 (Carl Zeiss). The respective images were overlaid and the percentage of antigen positive cells was calculated. Six random
fields/well from three replicated wells were counted. Results were presented as mean values with standard deviations. Twotailed t-test was used. P-values of <0.05 are referred to as significance in the text. All experiments were performed in triplicate and repeated at least twice. Fig. 1A showed the typical phase-contrast microscopic appearance of primary ADSCs. As Fig. 1B showed, OECs typically were spindle-shaped and were either bipolar, tripolar, or occasionally multipolar, often with one or more branched processes. To exam the purity of primary cultured OECs, we stained OECs with p75 and Hoechst 33342 (Fig. 1C). Cells with green and blue fluorescence were OECs. The OECs purity was 93.75 ± 5.44% (n = 4). At co-culture day 0, day 20, and day 30, the ADSCs on 3D collagen scaffold were visualized by fluorescein diacetate (FDA, Sigma) staining. As Fig. 2 showed, ADSCs co-cultured with OECs had striking morphology changes compared to the control. ADSCs seeded on 3D collagen scaffolds had round and big cell body and short process (Fig. 2A and B). When ADSCs were co-cultured with OECs for 20 days and 30 days, some cells showed spindle-like morphology with bi- or tripolar, assembling the appearance of OECs (Fig. 2C and E). The control ADSCs on 3D collagen scaffolds remained the round cell body and short processes.
Fig. 2. FDA staining of ADSCs on collagen scaffold at 0, 20, and 30 day. (A, C, and E) The morphology of ADSCs co-cultured with OECs at 0, 20, and 30 day, repectively. (B, D, and F) The morphology of ADSCs at 0, 20, and 30 day, respectively. Bar scale 100 m.
194
B. Wang et al. / Neuroscience Letters 421 (2007) 191–196
Fig. 3. Detection of P75NTR, Nestin, GDNF, BDNF, and PLP by RT-PCR. Lane 1, OECs; Lane 2, ADSCs co-cultured with OECs; and Lane 3, ADSCs.
As shown in Fig. 3, P75NTR gene and Nestin gene expressions were detected weakly in ADSCs co-cultured with OECs at day 20, and were strongly expressed at day 30. However, glial fibrillary acidic protein (GFAP, an intermediate filament associated with glial cells) highly expressed in OECs was not detected during the experimental period (data not showed). Cultured OECs expressed nerve growth factor, brain-derived neurotrophic factor, glia cell line-derived neurotrophic factor and their receptors. The expression of NGF, GDNF, and BDNF in ADSCs co-cultured with OECs were examined. After 30-day co-culture, GDNF and BDNF were detected (Fig. 3). However, NGF was not detected (data not shown). We also measured the expression of PLP, MBP and MAG genes, and successfully detected PLP gene expression in OEC-co-cultured ADSCs at 30 day. DRG neurons were cultured in vitro with 10 ng/ml NGF for 48 h, and then the medium was replaced with conditioned medium prepared from ADSCs, co-cultured ADSCs, and OECs, respectively, for 72 h. Conditioned medium from OECs could significantly promote DRG neuron growth and axon sprouting without NGF supporting. The percentage of -III tubulin positive cells (DRG neuron cell) was 53.0 ± 5.0%. Like OECs, co-cultured ADSCs’ conditioned medium could promote growth
and axon sprouting of DRG neurons and the percentage of -III tubulin positive cells was 31.2 ± 4.3%, significantly higher than 22.4 ± 4.9% of ADSCs’ (P < 0.05) (Fig. 4). Cell transplantation needed large number of cells, but the in vitro expansion potential of committed OECs was limited. In vitro expansion of ADSCs was considered a powerful approach to overcome some practical and ethical concerns of cell transplantation. In this study, we examined the feasibility of ADSCs as a source of stem cells for differentiation into OECs. We found that, by co-culturing with OECs, the ADSCs on 3D collagen scaffolds were efficiently differentiated into OEClike cells, with similar morphology and antigenic phenotypes (p75NTR+/Nestin+/GFAP−) of OECs. P75NTR was expressed in cultured OECs and was an important marker for OECs. Like p75NTR gene, both Nestin and GFAP genes were expressed in OECs. After 20 days of coculture with OECs, ADSCs were found to very weakly express P75NTR and Nestin mRNA, and the OEC-cell-like morphology. Only at 30 day, co-cultured ADSCs were positive for the functional markers of mature OECs such as neurotrophic factor GDNF, BDNF and myelin protein PLP. This indicates that the morphological changes occur earlier than the study marker expression in co-cultured ADSCs. Interestingly, after long-term co-culture, the conditioned medium prepared from OEC-like cells could significantly promote DRG neuron growth and axon sprouting without NGF supporting in contrast to that of the ADSCs. Neurotrophins play important roles in improving the survival and growth of damaged axons [4,6]. The mechanism of OECs in stimulating CNS regeneration is still unclear. A number of studies showed that the transplantation of OECs into injured CNS was able to promote the growth of axons, producing new myelin sheaths around demyelinated or amyelinated axons, and in some cases restore functional connections [5,10]. The growth factors produced by OECs were thought to play important roles in CNS regeneration. In vitro cultured rat OECs could express nerve growth factor (NGF), glia cell line-derived neurotrophic factor (GDNF), brain-derived neurotrophic factor (BDNF) and their receptors [25]. In animal models, transplan-
Fig. 4. Functional assay of conditioned medium: immunostaining of DRG neurons with anti- III tubulin and Hoechst33342. A, B and C showed DRG neurons immunostaining with conditioned medium from ADSCs, ADSCs co-cultured with OECs, and OECs, respectively. D showed the percentage of DRG neurons growing in the conditioned medium. (** P < 0.01, * P < 0.05). Bar scale 100 m.
B. Wang et al. / Neuroscience Letters 421 (2007) 191–196
tation of OECs transfected neurotrophic factor gene promote spine cord injury repair [7,21]. Because the pore size of the inserts is too small (diameter 0.4 M) to for OECs, and ADSCs were trypsinized from 3D collagen scaffold with trypsin after co-culture with OECs for 30 days, in this experiment conditioned medium of co-cultured cells of course will not contain components derived from the OEC. So the GDNF, BDNF and other factors secreted from OEC-like cells may contribute to the growth and axon sprouting of DRG neurons. Demyelination is another feature of spinal cord injuries, and many surviving axons may fail to conduct signals because remyelinaton has failed. Roteolipid protein (PLP) and myelin basic proteins (MBP) are two mayor myelin proteins, making up 30% and 40% of total myelin protein in CNS, respectively. PLP gene expression was detected in ADSCs co-cultured with OECs for 30 days and this indicated the OECs-like cells have partly myelin function. Adult stem cells are believed to have broad differentiation potential that could be induced by exposing stem cells to the extra cellular developmental signals of other lineages in mixedcell cultures [1,8]. In previous studies, co-cultured mouse neural stem cells (NSCs) committed to neurons and glial cells with human endothelial cells, NSC population converted to cells that did not express neuronal or glial markers, but instead showed the stable expression of multiple endothelial markers and the capacity to form capillary networks [26]. In this study, we co-cultured ADSCs on 3D collagen scaffolds with OECs and obtained OEClike cells. The soluble differentiation signals from OECs might have driven the differentiation of ADSCs into OEC-like cells. Stem cell plasticity was thought to form the foundation for one of the multiple prospective uses of adult stem cells in regenerative medicine [24]. Our results showed that ADSCs cells were able to differentiate into OEC-like cells in vitro. These findings are clinically relevant and could be helpful for the development of the cell-based therapeutic strategies for CNS repair. Acknowledgements This work was supported by grants from NSFC (30688002 and 30428017) and a grant from the Ministry of Science and Technology of China (2006CB943601). The authors also gratefully acknowledge the support of K.C. Wong Education Foundation, Hong Kong. References [1] A.R. Alexanian, M. Sieber-Blum, Differentiating adult hippocampal stem cells into neural crest derivatives, Neuroscience 118 (2003) 1–5. [2] J.B. Aquino, J. Hjerling-Leffler, M. Koltzenburg, T. Edlund, M.J. Villar, P. Ernfors, In vitro and in vivo differentiation of boundary cap neural crest stem cells into mature Schwann cells, Exp. Neurol. 198 (2006) 438– 449. [3] P.H. Ashjian, A.S. Elbarbary, B. Edmonds, D. DeUgarte, M. Zhu, P.A. Zuk, H.P. Lorenz, P. Benhaim, M.H. Hedrick, In vitro differentiation of human processed lipoaspirate cells into early neural progenitors, Plast. Reconstr. Surg. 111 (2003) 1922–1931. [4] N.I. Bamber, H. Li, X. Lu, M. Oudega, P. Aebischer, X.M. Xu, Neurotrophins BDNF andNT-3 promote axonal re-entry into the distal host spinal cord through Schwann cell-seeded mini-channels, Eur. J. Neurosci. 13 (2001) 257–268.
195
[5] S.C. Barnett, C.L. Alexander, Y. Iwashita, J.M. Gilson, J. Crowther, L. Clark, L.T. Dunn, V. Papanastassiou, P.G. Kennedy, R.J. Franklin, Identification of a human olfactory ensheathing cell that can affect transplant-mediated remyelination of demyelinated CNS axons, Brain 123 (2000) 1581–1588. [6] A. Blesch, H.S. Uy, R.J. Grill, J.G. Cheng, P.H. Patterson, M.H. Tuszynski, Leukemia inhibitory factor augments neurotrophin expression and corticospinal axon growth after adult CNS injury, J. Neurosci. 19 (1999) 3556–3566. [7] L. Cao, L. Liu, Z.Y. Chen, L.M. Wang, J.L. Ye, H.Y. Qiu, C.L. Lu, C. He, Olfactory ensheathing cells genetically modified to secrete GDNF to promote spinal cord repair, Brain 127 (2004) 535–549. [8] G. Condorelli, U. Borello, L. De Angelis, M. Latronico, D. Sirabella, M. Coletta, R. Galli, G. Balconi, A. Follenzi, G. Frati, Cardiomyocytes induce endothelial cells to trans-differentiate into cardiac muscle: implications for myocardium regeneration, Proc. Natl. Acad. Sci. U. S. A. 98 (2001) 10733–10738. [9] G.R. Erickson, J.M. Gimble, D.M. Franklin, H.E. Rice, H. Awad, F. Guilak, Chondrogenic potential of adipose tissue-derived stromal cells in vitro and in vivo, Biochem. Biophys. Res. Commun. 290 (2002) 763– 769. [10] R.J. Franklin, J.M. Gilson, I.A. Franceschini, S.C. Barnett, Schwann celllike myelination following transplantation of an olfactory bulb-ensheathing cell line into areas of demyelination in the adult CNS, Glia 17 (1996) 217–224. [11] Y.C. Halvorsen, W.O. Wilkison, J.M. Gimble, Adipose-derived stromal cells—their utility and potential in bone formation, Int. J. Obes. Relat. Metab. Disord. 24 (Suppl. 4) (2000) S41–S44. [12] T. Imaizumi, K.L. Lankford, J.D. Kocsis, Transplantation of olfactory ensheathing cells or Schwann cells restores rapid and secure conduction across the transected spinal cord, Brain Res. 854 (2000) 70– 78. [13] T. Imaizumi, K.L. Lankford, S.G. Waxman, C.A. Greer, J.D. Kocsis, Transplanted olfactory ensheathing cells remyelinate and enhance axonal conduction in the demyelinated dorsal columns of the rat spinal cord, J. Neurosci. 18 (1998) 6176–6185. [14] S.K. Kang, D.H. Lee, Y.C. Bae, H.K. Kim, S.Y. Baik, J.S. Jung, Improvement of neurological deficits by intracerebral transplantation of human adipose tissue-derived stromal cells after cerebral ischemia in rats, Exp. Neurol. 183 (2003) 355–366. [15] N. Lenoir, Europe confronts the embryonic stem cell research challenge, Science 287 (2000) 1425–1427. [16] Y. Li, P.M. Field, G. Raisman, Repair of adult rat corticospinal tract by transplants of olfactory ensheathing cells, Science 277 (1997) 2000– 2002. [17] S.J. Morrison, S.E. Perez, Z. Qiao, J.M. Verdi, C. Hicks, G. Weinmaster, D.J. Anderson, Transient notch activation initiates an irreversible switch from neurogenesis to gliogenesis by neural crest stem cells, Cell 101 (2000) 499–510. [18] R. Ogawa, H. Mizuno, A. Watanabe, M. Migita, T. Shimada, H. Hyakusoku, Osteogenic and chondrogenic differentiation by adipose-derived stem cells harvested from GFP transgenic mice, Biochem. Biophys. Res. Commun. 313 (2004) 871–877. [19] G.W. Plant, P.F. Currier, E.P. Cuervo, M.L. Bates, Y. Pressman, M.B. Bunge, P.M. Wood, Purified adult ensheathing glia fail to myelinate axons under culture conditions that enable Schwann cells to form myelin, J. Neurosci. 22 (2002) 6083–6091. [20] A. Ramon-Cueto, G.W. Plant, J. Avila, M.B. Bunge, Long-distance axonal regeneration in the transected adult rat spinal cord is promoted by olfactory ensheathing glia transplants, J. Neurosci. 18 (1998) 3803– 3815. [21] M.J. Ruitenberg, D.B. Levison, S.V. Lee, J. Verhaagen, A.R. Harvey, G.W. Plant, NT-3 expression from engineered olfactory ensheathing glia promotes spinal sparing and regeneration, Brain 128 (2005) 839– 853. [22] N.M. Shah, M.A. Marchionni, I. Isaacs, P. Stroobant, D.J. Anderson, Glial growth factor restricts mammalian neural crest stem cells to a glial fate, Cell 77 (1994) 349–360.
196
B. Wang et al. / Neuroscience Letters 421 (2007) 191–196
[23] B. Wang, Y. Zhao, H. Lin, B. Chen, J. Zhang, X. Wang, W. Zhao, J. Dai, Phenotypical analysis of adult rat olfactory ensheathing cells on 3D collagen scaffolds, Neurosci. Lett. 401 (2006) 65–70. [24] I.L. Weissman, Translating stem and progenitor cell biology to the clinic: barriers and opportunities, Science 287 (2000) 1442–1446. [25] E. Woodhall, A.K. West, M.I. Chuah, Cultured olfactory ensheathing cells express nerve growth factor, brain-derived neurotrophic factor, glia cell line-derived neurotrophic factor and their receptors, Brain Res. Mol. Brain Res. 88 (2001) 203–213.
[26] A.E. Wurmser, K. Nakashima, R.G. Summers, N. Toni, K.A. D’Amour, D.C. Lie, F.H. Gage, Cell fusion-independent differentiation of neural stem cells to the endothelial lineage, Nature 430 (2004) 350– 356. [27] P.A. Zuk, M. Zhu, H. Mizuno, J. Huang, J.W. Futrell, A.J. Katz, P. Benhaim, H.P. Lorenz, M.H. Hedrick, Multilineage cells from human adipose tissue: implications for cell-based therapies, Tissue Eng. 7 (2001) 211– 228.