The direct proliferative stimulus of dehydroepiandrosterone on MCF7 breast cancer cells is potentiated by overexpression of aromatase

Molecular and Cellular Endocrinology 184 (2001) 163– 171 www.elsevier.com/locate/mce

The direct proliferative stimulus of dehydroepiandrosterone on MCF7 breast cancer cells is potentiated by overexpression of aromatase Marcello Maggiolini a, Amalia Carpino b, Daniela Bonofiglio a, Vincenzo Pezzi a, Vittoria Rago b, Stefania Marsico c, Didier Picard d, Sebastiano Ando` b,* a Department of Pharmaco-Biology, Uni6ersity of Calabria, I-87036 Rende CS, Italy Department of Cellular Biology, Facolta’ di Farmacia, Uni6ersity of Calabria, I-87036 Rende CS, Italy c Health Center, Uni6ersity of Calabria, I-87036 Rende CS, Italy d De´partement de Biologie, Cellulaire, Uni6ersite´ de Gene`6e, Sciences III, CH-1211 Gene6e 4, Switzerland b

Received 3 April 2001; accepted 4 June 2001

Abstract In women after menopause aromatization of adrenal androgens represents the main source of estrogens, which may promote the development of hormone-dependent breast tumor. Several studies have attempted to determine the cell type within carcinomas that is responsible for ‘in situ’ estrogen biosynthesis and whether the amount produced may sustain relevant biological effects. Here we show P450arom mRNA and protein expression together with immunocytochemical localization of aromatase in the epithelial MCF7 breast cancer cell line. Moreover, we demonstrate that the enhanced aromatization of dehydroepiandrosterone in aromatase transfected MCF7 cells confers biological advantages such as proliferative stimulation similar to that induced by estradiol. Our results suggest that aromatase inhibitors may be particularly effective in the treatment of hormone-dependent breast cancer disease in postmenopausal women. © 2001 Elsevier Science Ireland Ltd. All rights reserved. Keywords: MCF7; P450arom; DHEA; Estrogen receptor; Transfection

1. Introduction The conversion of C19 steroids to estrogens is catalyzed by an enzyme complex termed aromatase, which consists of a ubiquitous non-specific flavoprotein, NADPH-cytochrome P450 reductase, and a specific microsomial form of cytochrome P450, P450arom, product of the CYP19 gene (Simpson et al., 1994). Aromatase is expressed in ovarian granulosa and luteal cells (McNatty et al., 1979), testicular Leydig cells (Brodie and Inkster, 1993), placenta (Gadsby et al., 1980), adipose tissue (Ackerman et al., 1981; Mendelson et al., 1982), brain (Price et al., 1992a,b; Steckelbroeck et al., 1999), skin (Simpson et al., 1997), osteoblasts (Bruch et al., 1992), vascular endothelial * Corresponding author. Tel.: + 39-098-449-3110; fax: + 39-098449-3271. E-mail address: [email protected] (S. Ando`).

and aortic smooth-muscle cells (Sasano et al., 1999), endometrial and breast cancer tissues (Sasano and Harada, 1998). The biological activity of estrogens synthesized within these extragonadal sites is mainly exerted locally by paracrine and/or autocrine mechanisms (Simpson et al., 2000). Estrogens may promote the growth of hormone-dependent breast tumors (Eisen and Weber, 1998; Hoskins and Weber, 1994; Korach, 1994) that maintain high estrogen concentrations even in postmenopausal patients (Thorsen et al., 1982; van Landeghem et al., 1985). In such circumstances P450arom takes over ‘in situ’ estradiol production converting plasma adrenal androgen precursors (Labrie, 1991; Labrie et al., 1995). Measurable P450arom activity in at least 60–70% of breast carcinomas indicates that intratumorally synthesized estrogens may function as a mitogenic factor sustaining cell proliferation (Hoskins and Weber, 1994; Korach, 1994), moreover aromatase overexpression im-

0303-7207/01/$ - see front matter © 2001 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 3 0 3 - 7 2 0 7 ( 0 1 ) 0 0 5 6 3 - 9

164

M. Maggiolini et al. / Molecular and Cellular Endocrinology 184 (2001) 163–171

parts a growth advantage to breast cancer cells which acquire an aggressive biological behavior (Sasano and Harada, 1998). P450arom mRNA has been earlier detected in breast cancer specimens (Esteban et al., 1992; Koos et al., 1993; Price et al., 1992a,b; Sourdaine et al., 1996), however, with heterogeneous tumor tissues it is difficult to localize the cellular origin in the samples. P450arom immunoreactivity has been predominantly found in adipocytes and stromal cells of breast carcinoma (Santen et al., 1994; Santner et al., 1997), while a weak cytoplasmic immunohistochemical localization has been detected in epithelial cells (Sasano and Harada, 1998). Estrogens produced in surrounding tissues contribute to the development of the disease through a paracrine mechanism, whereas aromatization within breast cancer epithelial cells provides an autocrine growth stimulatory loop involving growth factors, which in turn sustain the intratumoral enzyme activity (Dickson and Lippman, 1987; Dowsett et al., 1993). In a earlier study (Maggiolini et al., 1999), we ascertained that adrenal androgens directly activate the estrogen receptor a (ERa) and induce proliferation of epithelial MCF7 breast cancer cells. Besides, it has been recently reported that stimulation of MCF7 cell growth by dehydroepiandrosterone (DHEA) sulfate follows an aromatase-independent pathway (Billich et al., 2000). In this work, for the first time, we demonstrate P450arom immunocytochemical localization together with mRNA and protein expression data for MCF7 cells. We confirm that the aromatization of DHEA is enhanced in CYP19-transfected MCF7 cells (Schmitt et al., 2001). As a consequence, proliferation promoted by this major adrenal androgen mirrors that induced by estradiol. Thus, we provide insights into the biological effects of normal and overexpressed aromatase activity, both of which represent an important target of the endocrine treatment of breast cancer.

expression vector pRL-CMV (Promega) was used as a transfection standard. The Gal4 chimera Gal-ERa was expressed from plasmid GAL93.ER(G). It was constructed by transferring the coding sequences for the hormone binding domain (HBD) of ERa (amino acids 282–595) from HEG0 (Tora et al., 1989), into the mammalian expression vector pSCTEVGal93 (Seipel et al., 1992). The eukaryotic expression vector pCMV2 which contains a full-length cDNA encoding human P450arom (CYP19) (Corbin et al., 1988) was used to overexpress aromatase.

2.3. Cell culture Wild-type human breast cancer MCF7 and CHO cells were gifts from E. Surmacz (Philadelphia, USA). Both cell lines were maintained in DMEM without phenol red supplemented with 10% FCS.

2.4. Transfections and luciferase assays Cells were transferred into 24-well plates with 500 ml of regular growth medium/well the day before transfection. The medium was replaced with DMEM on the day of transfection, which was performed using Fugene6 Reagent as recommended by the manufacturer (Roche Diagnostics) with a mixture containing 0.5 mg of reporter plasmid, 5 ng of pRL-CMV, 0.1 mg of effector plasmid and 0.1 mg of CYP19, both of which of where applicable. After 5–6 h the medium was replaced with serum-free DMEM, ligands were added at this point, and cells incubated for 20–24 h. Luciferase activity was then measured with the Dual Luciferase Kit (Promega) according to the recommendations of manufacturer. Firefly luciferase activity was normalized to the internal transfection control provided by the Renilla luciferase signal.

2.5. RT-PCR 2. Materials and methods

2.1. Reagents 17b-estradiol (E2), dehydroepiandrosterone (DHEA) and hydroxytamoxifen (OHT) were purchased from Sigma. Methyltrienolone (R1881) was obtained from Dupont. Letrozole and hydroxyflutamide (OHF) were gifts from Novartis (Switzerland) and from M. McPhaul (Dallas, USA), respectively.

2.2. Plasmids Firefly luciferase reporter plasmids used were XETL (Bunone et al., 1996) for the ER and GK1 (Webb et al., 1998) for the Gal4 fusion protein. The Renilla luciferase

The evaluation of P450arom mRNA expression was performed by the RT-PCR. Total RNA was extracted from MCF7 cells using TRIZOL reagent (Life Technologies, Basel, Switzerland) as suggested by the manufacturer. For cDNA synthesis 1 mg of total RNA was mixed with 20 pmol oligo(dT) in 30 ml 50mM Tris–HCl pH 8.3, 75 mM KCl, 3 mM MgCl2, 5 mM DTT, 0.67 u/ml Rnasin, denatured at 72 °C for 5 min, and incubated with 200 U M-MLV reverse transcriptase (RT) at 37 °C for 90 min after addition of 20 ml of the same buffer containing dNTPs to obtain a final concentration of 0.5 mM each. The RT was inactivated by boiling for 3 min. The cDNAs obtained were further amplified by PCR using 0.5 mM of primers, 5%CTGGAAGAATGTATGGACTT3% (CYP19 for-

M. Maggiolini et al. / Molecular and Cellular Endocrinology 184 (2001) 163–171

ward) located in exon VII and 5%GATCATTTCCAGCATGTTTT3% (CYP19 reverse) located in exon X, to yield product of 660 bp by 35 PCR cycles (1 min at 92 °C, 1 min at 60 °C, 2 min at 72 °C) in the presence of Taq DNA polymerase (1 U/tube) and 2.5 mM MgCl2. Water instead of DNA was used to evaluate contamination of reaction mixture. CYP19 encoding human P450arom (Corbin et al., 1988) provided the positive control. For each sample 4 ml of PCR amplification product was analyzed on 1.2% agarose gel and stained with ethidium bromide. Standard DNA (100bp DNA) ladder (Promega, WI) was run to provide the appropriate size marker.

2.6. Immunoblotting MCF7 cells were grown in 10 cm dishes to 70– 80% confluence and lysed in 500 ml of 50 mM Hepes (pH 7.5), 150 mM NaCl, 1.5 mM MgCl2, 1 mM EGTA, 10% glycerol, 1% Triton X-100, a mixture of protease inhibitors (Aprotinin, PMSF), and Na-orthovanadate. Equal amounts of total protein were resolved on a 10% SDS-polyacrylamide gel. Proteins were transferred to a nitrocellulose membrane, probed with rabbit polyclonal antiserum directed against the human placental P450arom (1:50). The antigen-antibody complexes were detected by incubation of the membranes at room temperature with peroxidase-coupled goat anti-rabbit IgG and revealed using the ECL System (Amersham Pharmacia Biotech). Human placental proteins were used as a positive control. CYP19 transfected in MCF7 cells overexpressed P450arom respect to nontransfected cells as determined by Western analysis (data not shown).

2.7. Proliferation assays For quantitative proliferation assays MCF7 cells were maintained at least 4 days in DMEM supplemented with 5% charcoal stripped FCS and then seeded (2× 104) in 24-well plates using the same medium. Cells were washed extensively once they had attached, the medium was replaced with serum-free DMEM and a transient transfection was performed by Fugene6 Reagent with the same amount of CYP19 expression vector used in transfection assay (0.1 mg), where applicable. After 5–6 h the medium was replaced with serum-free DMEM and ligands were added at this point. Every day the serum-free DMEM was changed and ligands added. On day 4, cells were trypsinized and counted in a haemocytometer.

165

charcoal stripped FCS. When cells were 70–80% confluent, they were washed extensively, the medium was replaced with serum-free DMEM and a transient transfection was performed by Fugene6 Reagent with 1 mg of CYP19, where applicable. After 5– 6 h the medium was replaced with serum-free DMEM, ligands were added at this point and cells incubated for 24 h. After which, the E2 content of medium recovered from each plate was determined against estradiol standards (prepared in serum-free DMEM) by an estradiol radioimmunoassay kit (ICN Pharmaceuticals Inc., Costa Mesa, CA). E2 production was normalized to the cellular protein content per well and expressed as nmol per mg of protein in 24 h (nM/mg prot/24 h). The antiserum cross reactivity with DHEA and R1881 was less than 0.01%.

2.9. Immunocytochemical staining Paraformaldeyde fixed MCF7 cells (2% PFA for 30 min.) were used for immunocytochemical staining. Endogenous peroxidase activity was inhibited by hydrogen peroxide (3% in absolute methanol for 30 min) and non specific sites were blocked by normal goat serum (15% for 30 min). P450arom immunostaining was then performed using as primary antibody a rabbit polyclonal antiserum generated against human placental P450 aromatase (1:200, overnight at 4 °C) (Dr Y. Osawa, Hauptman-Woodward Medical Research Institute,Buffalo, NY), while a biotinylated goat-anti-rabbit IgG (1:1200,for 1 h at RT) (Vector Laboratories, Burlingame,CA) was utilized as secondary antibody. Avidin-biotin-horseradish peroxidase complex (ABC complex /HRP) (Vector Laboratories, Burlingame, CA) was applied (30 min) and the chromogen 3-3%-diaminobenzidine tetrachloride dihydrate (DAB-Vector Laboratories) was used as detection system (3 min). TBS-T (0.05 M Tris–HCl plus 0.15 M NaCl, pH 7.6 containing 0.05% Triton X-100) served as washing buffer. The primary antibody was replaced by normal rabbit serum at the same concentration in control experiments on MCF7 cultured cells. A further negative assessment was performed using the primary antibody preabsorbed (48 h at 4 °C) with an excess of purified human placental P450 aromatase (5 nmol/ml) (Hauptman-Woodward Medical Research Institute, Buffalo, NY). May-Gru¨ mwald-Giemsa staining provided the morphological analysis of MCF7 cultured cells.

2.8. E2 measurement

2.10. Statistical analysis

MCF7 cells were grown in 6 cm dishes and maintained at least 4 days in DMEM supplemented with 5%

Statistical analysis was performed using ANOVA followed by Newman–Keuls testing to determine dif-

166

M. Maggiolini et al. / Molecular and Cellular Endocrinology 184 (2001) 163–171

P450arom placental proteins which were used as positive control (Fig. 1B).

3.2. Immunocytochemical localization of P450arom

Fig. 1. Expression of human P450arom in MCF7 cells. (A) Ethidium bromide stained agarose gel of RT-PCR analysis of P450arom mRNA. Lane 1, RNA sample without the addition of reverse transcriptase (control negative); lane 2, amplified product of 660 bp between exons 7 and 10; lane 3, amplification of human CYP19 yielded a band corresponding to that observed in MCF7 cells. (B) Immunoblot with a rabbit polyclonal antiserum against human placental P450arom. Lane 1, MCF7 cells extract; lane 2, human placental extract used as positive control.

ferences in means. P values B 0.05 were considered significant.

Having established that both aromatase mRNA and protein are expressed in MCF7 cells, we aimed to detect the localization of immunoreactive P450arom, which has never been demonstrated. The May-Gru¨ mwaldGiemsa staining shows the overall morphology MCF7 cells (Fig. 2A). Fig. 2B demonstrates a representative immunoreaction revealing aromatase protein exclusively in the cytoplasm of MCF7 cells. The staining intensity is variable from moderate to intense in about 70% of cells. In contrast, no immunoreactivity was seen when replacing the anti-P450arom antibody by irrelevant rabbit IgG (Fig. 2C) or when the antigen was preabsorbed with the primary antibody (data not shown).

3. Results

3.3. 17i-estradiol secretion 3.1. P450arom mRNA and protein expression We began by determining the expression of P450arom mRNA in MCF7 cells by RT-PCR. As shown in Fig. 1A, the expected transcript of 660 bp was clearly detected using primers designed to amplify the highly conserved sequence of P450arom, which includes the helical and aromatic regions (see Section 2). The positive signal obtained by amplification of a full length cDNA encoding the human P450arom (CYP19) validated our detection. Next, we performed Western Blot analysis using an antibody against human placental P450arom. Proteins extracted from MCF7 cells revealed a band comigrating with 55-Kd human

Having clearly confirmed the presence of endogenous P450arom in MCF7 cells, we determined its ability to catalyze the biosynthesis of E2 from the adrenal androgen DHEA (Fig. 3). The addition of a physiological concentration of DHEA (10 nM) resulted in E2 levels about 9-fold over those of untreated cells and this increase was further potentiated up to 14-fold in aromatase-transfected cells (see Section 2). It is noteworthy that the aromatase inhibitor letrozole completely reversed this phenomenon and that the androgen R1881, neither aromatisable nor metabolisable, did not induce variations of E2 levels under all experimental conditions.

Fig. 2. Morphology and P450arom immunoreactivity of MCF7 cells. (A) May-Gru¨ mwald-Giemsa staining. (B) P450arom immunoreactivity in the cytoplasm of MCF7 cells. (C) Immunonegative reaction obtained replacing the anti-P450arom antiserum with an irrelevant rabbit IgG. Each experiment is representative of at least 10 tests.

M. Maggiolini et al. / Molecular and Cellular Endocrinology 184 (2001) 163–171

167

nist OHT repressed the effectiveness of all hormones tested demonstrating that DHEA, DHT, and R1881 act directly as ligands to activate ERa.

3.5. The acti6ation of exogenous ERh by DHEA increases in CYP19 -transfected CHO cells

Fig. 3. Effects of 10 nM DHEA or R1881 and 1 mM of the aromatase inhibitor letrozole (L) on E2 secretion from MCF7 cells transfected or not with CYP19. DHEA induced E2 production 9-fold over untreated cells and 14-fold in CYP19-transfected cells. Letrozole treatment reversed DHEA stimulation and R1881 (androgen neither aromatisable nor metabolisable) was ineffective in all conditions designed. Values represent the mean and S.D. from two experiments with triplicate samples ’*P B0.01.

3.4. The acti6ation of endogenous ERh by DHEA is enhanced in CYP19 -transfected MCF7 cells The afore-mentioned results suggested that DHEA may be a substrate for E2 biosynthesis in MCF7 cells. This prompted us to investigate whether expression of the CYP19 gene modifies the potency of DHEA to activate ERa (Maggiolini et al., 1999). We transiently transfected an ER reporter gene (XETL) carrying firefly luciferase sequences under the control of an estrogen response element upstream of the thymidine kinase promoter. To normalize luciferase activity with an internal control we cotransfected a plasmid expressing Renilla luciferase, which is enzymatically distinguishable from firefly luciferase, from the strong cytomegalovirus enhancer/promoter. CYP19 was transfected when indicated to overexpress P450arom activity (see Section 2). Luciferase activity of cells receiving no hormone treatment was set as 1-fold induction, upon which the other treatments were calculated. Fig. 4A shows the results obtained with the MCF7 cells, that exclusively express ERa and no ERb as judged by RT-PCR (data not shown). As expected CYP19 did not affect the E2 response, but enhanced significantly the transactivating potency of DHEA. Interestingly, this increase was abolished by the aromatase inhibitor letrozole. The activity of R1881 was not affected by CYP19 overexpression or in the presence of letrozole. In addition, the androgen receptor antagonist OHF had no effect on responses induced by both DHEA and R1881. As expected, the ERa antago-

Nuclear receptors such as ERa contain two main transcriptional activation functions (AF), the N-terminal AF1 and the C-terminal AF2, the second of which is associated with the hormone binding domain (HBD) (Kumar et al., 1987). With a chimeric protein consisting of the heterologous DNA binding domain (DBD) of the yeast transcription factor Gal4 and the ERa HBD we confirmed in the results obtained with MCF7 cells by transient transfection into CHO cells (Fig. 4B). These data also argue that the tested hormones are able to activate AF2.

3.6. Proliferati6e effects of DHEA are potentiated in CYP19 -transfected MCF7 cells To evaluate a more complex biological response, we analyzed the proliferative effects of androgens on MCF7 cells transiently transfected with CYP19. Cells were treated for 3 days with the different hormones, counted and the data expressed as percentage of the E2 stimulation (Fig. 5), which was similar in presence or absence of CYP19 (data not shown). Only DHEA induced a significant proliferation of CYP19-transfected MCF7 cells and, interestingly, this increase was blocked by letrozole treatment. As expected, the antiestrogen OHT inhibited the proliferative effects induced by all ligands confirming an ERa-dependent mechanism.

4. Discussion In the present study we have demonstrated P450arom immunocytochemical localization together with mRNA and protein expression in MCF7 epithelial breast cancer cells. Proliferative effects induced by the major adrenal androgen DHEA were potentiated in CYP19transfected MCF7 cells becoming similar to that sustained by E2 stimulation. The ovary is the main source of estrogens in women before menopause, thereafter ‘in situ’ aromatization of C19 androgen precursors produces significant amounts of E2 in peripheral tissues that express P450arom (Sasano and Harada, 1998). Thus, in post-reproductive years DHEA, a major secretory steroidal product of the adrenal gland (Ebeling and Koivisto, 1994), either unconjugated or as its sulphate (DHEAS), may represent a key factor for extragonadal estrogen biosynthesis which occurs in several sites including the normal

168

M. Maggiolini et al. / Molecular and Cellular Endocrinology 184 (2001) 163–171

breast and breast carcinoma (Sasano and Harada, 1998). However, first the conversion of DHEA to androstenedione before aromatization, and then the reduction of the 17-ketogroup to 17b-hydroxyl which is catalyzed by 17b-hydroxysteroid dehydrogenase, are major steps for E2 biosynthesis (Simpson et al., 2000). The distribution in extragonadal tissues of the various enzymes involved in E2 production has not yet been fully clarified, but it has been reported for breast epithelium tumors (Sasano et al., 1996) and for bone (Sasano et al., 1997). With regards to P450arom, several studies have demonstrated its expression and activity in breast carcinoma as well as in breast cancer cell

lines (Dowsett et al., 1993; Ryde et al., 1992; Sadekova et al., 1994; Sourdaine et al., 1996). We now complete this knowledge by demonstrating that (i) MCF7 cells are able to convert DHEA to E2, (ii) the production of E2 from DHEA is potentiated in CYP19-transfected cells, (iii) the P450arom-inhibitor letrozole blocks E2 biosynthesis confirming an aromatase-mediated mechanism, and (iv) DHEA activates ERa and stimulates proliferation of MCF7 to the same extent as E2 in CYP19-transfected cells. Taken together, the data obtained with our ‘in vitro’ model system support the potential biological relevance of P450arom expression for breast cancer disease.

Fig. 4. The activation of ERa by DHEA is potentiated in CYP19-transfected cells. (A) MCF7 cells were cotransfected with the ER reporter gene XETL, the internal control Renilla luciferase, the CYP19 plasmid (where applicable), and then treated for 20 – 24 h with 10 nM E2, DHEA or R1881 and 1 mM letrozole (L), hydroxyflutamide (OHF) or hydroxytamoxifen (OHT). Values of luciferase activity normalized to renilla expression represent the mean and S.D. of two experiments with triplicate samples. (B) CHO were cotransfected with the reporter gene GK1, GAL4 chimera Gal93-ERa, the transfection standard Renilla luciferase and CYP19 (where applicable) and then treated for 20 – 24 h with 10 nM E2, DHEA or R1881 and 1 mM letrozole (L), hydroxyflutamide (OHF) or hydroxytamoxifen (OHT). Values of luciferase activity normalized to Renilla expression represent the mean and S.D. of two experiments with triplicate samples °*+PB 0.01.

M. Maggiolini et al. / Molecular and Cellular Endocrinology 184 (2001) 163–171

169

Fig. 5. The proliferative effects induced by DHEA are enhanced in CYP19-transfected MCF7 cells. MCF7 were transfected with CYP19 and treated for 3 days with 10 nM E2, DHEA or R1881 and 1 mM letrozole (L) or hydroxytamoxifen (OHT). Results were expressed relative to the E2-induced proliferation which was set at 100% and values represent the mean and S.D. of two experiments with triplicate samples *°PB 0.01.

Whether the amounts of estrogens made ‘in situ’ are sufficient to produce physiologically relevant effects such as breast tumor growth has been controversial (Bradlow, 1982; Lipton et al., 1992; Miller, 1991; Pasqualini et al., 1996; Thorsen et al., 1982; van Landeghem et al., 1985; Yue et al., 1998). It may be important to note that if only a fraction of cells within a tumor contains high P450arom, their dilution with other cells might lower the apparent enzyme activity measured biochemically in tissue homogenates. Immunocytochemical studies have confirmed that clusters of cells with high staining intensity for aromatase are interspersed with a majority of negative cells in human breast carcinomas (Esteban et al., 1992). These investigations suggested that low aromatase activity, as assessed by biochemical assays with tumor homogenates, may not correlate with the biological relevance of the enzyme ‘in vivo’. Moreover, if we consider that the concentration of estrogens within the tumor is much higher than in plasma (Sasano and Harada, 1998), the precise characterization of the local sources of their production is of great physiological and clinical significance. Although both autocrine and paracrine mechanisms may contribute to the development of the disease, the important role of intratumoral aromatization has been earlier emphasized (Sasano and Harada, 1998; Yue et al., 1998). It is intriguing to suggest that growth factors, locally produced by breast cancer cells, may sustain P450arom activity, which in turn would lead to an autocrine growth stimulatory loop within the carcinoma (Dickson and Lippman, 1987; Dowsett et al., 1993). As a consequence, the production of E2 in the

microenvironment of the tumor tissue may be relevant as a proliferative stimulus for the malignant epithelial cells. To model this issue, we evaluated the activation of ERa by DHEA in CYP19-transfected MCF7 cells. Notably, the transcriptional and growth stimulatory efficacy of DHEA was similar to that of E2. Our results are consistent with MCF7 growth stimulation by physiological concentration of the adrenal androgen DHEA, which becomes as effective as E2 in aromatase-transfected cells. These data suggest that further studies should be addressed towards the role of overexpressed enzyme activity in breast tumor development, whereas the ability of epithelial breast cancer cells to aromatize DHEA and subsequently sustain proliferation remains an established important concern. In postmenopausal women estrogens are synthesized by ‘in situ’ conversion of androgen adrenal precursors, thus aromatase-inhibitors may represent a promising pharmacological approach in patients with hormonedependent breast cancer disease.

Acknowledgements We are grateful to E. Simpson and Y. Osawa who kindly provided CYP19 and P450arom antibody, respectively. We thank A. Vivacqua and P. Cicirelli for excellent technical assistance, D. Bellizzi for helpful suggestions. This study was supported by grants from Regione Calabria and U.E. (P.O.P.), MURST-CNR (Biothecnology Program L. 95/95), and (D.P.) by the Swiss National Science Foundation, Recherche Suisse contre la Cancer, and the Canton of Gene`ve.

170

M. Maggiolini et al. / Molecular and Cellular Endocrinology 184 (2001) 163–171

References Ackerman, G.E., Smith, M.E., Mendelson, C.R., MacDonald, P.C., Simpson, E.R., 1981. Aromatization of androstenedione by human adipose tissue stromal cells in monolayer culture. J. Clin. Endocrinol. Metab. 53, 412 –417. Billich, A., Nussbaumer, P., Lehr, P., 2000. Stimulation of MCF-7 breast cancer cell proliferation by estrone sulfate and dehydroepiandrosterone sulfate: inhibition by novel non-steroid sulfatase inhibitors. J. Steroid Biochem. Mol. Biol. 73, 225 –235. Bradlow, H.L., 1982. A reassessment of the role of breast tumor aromatase. Cancer Res. 42 (Suppl), 3382s –3386s. Brodie, A., Inkster, S., 1993. Aromatase in the human testis. J. Steroid Biochem. Mol. Biol. 44, 549 – 555. Bruch, H.R., Wolf, L., Budde, R., Romalo, G., Schweikert, H.U., 1992. Androstenedione metabolism in cultured human osteoblastlike cells. J. Clin. Endocrinol. Metab. 75, 101 – 105. Bunone, G., Briand, P.A., Miksicek, R.J., Picard, D., 1996. Activation of the unliganded estrogen receptor by EGF involves the MAP kinase pathway and direct phosphorylation. EMBO J. 15, 2174 – 2183. Corbin, C.J., Graham-Lorence, S., McPhaul, M., Mason, J.I., Mendelson, C.R., Simpson, E.R., 1988. Isolation of a full-lenght cDNA insert encoding human aromatase system cytochrome P450 and its expression in non steroidogenic cells. Proc. Natl. Acad. Sci. USA 85, 8948 – 8952. Dickson, R.B., Lippman, M.E., 1987. Estrogen regulation of growth and polypeptide growth factor secretion in human breast carcinoma. Endocr. Rev. 8, 29 –43. Dowsett, M., Macnulay, V., Gledhill, J., Ryde, C., Nicholls, J., Ashworth, A., Mc Kinna, J.A., Smith, I.E., 1993. Control of aromatase in breast cancer cells and its importance for tumor growth. J. Steroid Biochem. Mol. Biol. 44, 605 – 609. Ebeling, P., Koivisto, V.A., 1994. Physiological importance od dehydroepiandrosterone. Lancet 343, 1479 – 1481. Eisen, A., Weber, B.L., 1998. Recent advances in breast cancer biology. Curr. Opin. Oncol. 10, 486 –491. Esteban, J.M., Warsi, Z., Haniu, M., Hall, P., Shively, J.E., Chen, S., 1992. Detection of intratumoral aromatase in breast carcinomas. Am. J. Pathol. 140, 337 –343. Gadsby, J.E., Heap, R.B., Burton, R.D., 1980. Oestrogen production by blastocyst and early embryonic tissue of various species. J. Reprod. Fertil. 60, 409 –417. Hoskins, K., Weber, B.L., 1994. The biology of breast cancer. Curr. Opin. Oncol. 6, 554 –559. Koos, R.D., Banks, P.K., Inkster, S.E., Yue, W, Brodie, A.M.H., 1993. Detection of aromatase and keratinocyte growth factor expression in breast tumors using reverse transcription polymerase chain reaction. J. Steroid Biochem. Mol. Biol. 45, 217 –225. Korach, K.S., 1994. Insight from the study of animals lacking functional estrogen receptor. Science (Washington DC) 266, 1524 – 1527. Kumar, V., Green, S., Stack, G., Berry, M., Jin, J.R., Chambon, P., 1987. Functional domains of the human estrogen receptor. Cell 51, 941 – 951. Labrie, F., 1991. Intracrinology. Mol. Cell Endocrinol. 78, C113 – C118. Labrie, F., Belanger, A., Simard, J., Luu-The, V., Labrie, C., 1995. DHEA and perpheral androgen and estrogen formation: intracrinology. Ann. NY Acad. Sci. 774, 16 –28. Lipton, A., Santen, R.J., Santner, S.J., Harvey, H.A., Sanders, S.I., Matthews, Y.L., 1992. Prognostic value of breast cancer aromatase. Cancer 70, 1951 –1955. Maggiolini, M., Donze´ , O., Jeannin, E., Ando`, S., Picard, D., 1999. Adrenal androgens stimulate the proliferation of breast cancer cells as direct activators of estrogen receptor a. Cancer Res. 59, 4864 – 4869.

McNatty, K.P., Makris, A., DeGrazia, C., Osathanondh, R., Ryan, K.J., 1979. The production of progesterone, androgens, and estrogens by granulosa cells, thecal tissue, and stromal tissue from human ovaries in vitro. J. Clin. Endocrinol. Metab. 49, 687 –699. Mendelson, C.R., Cleland, W.H., Smith, M.E., Simpson, E.R., 1982. Regulation of aromatase activity of stromal cells derived from human adipose tissue. Endocrinology 111, 1077 – 1085. Miller, W.R., 1991. Aromatase activity in breast tissue. J. Steroid Biochem. Mol. Biol. 39, 783 – 790. Pasqualini, J.R., Chetrite, G., Blacker, C., Feinstein, M.C., Delalonde, L., Talbi, M., Maloche, C., 1996. Concentrations of estrone, estradiol, and estrone sulfate and evaluation of sulfatase and aromatase activities in pre- and postmenopausal breast cancer patients. J. Clin. Endocrinol. Metab. 81, 1460 – 1464. Price, T., Aitken, J., Head, J., Mahendroo, M., Means, G., Simpson, E.R., 1992a. Determination of aromatase cytochrome P450 messenger ribonucleic acid in human breast tissues by competitive polymerase chain reaction amplification. J. Clin. Endocrinol. Metab. 74, 1247 – 1252. Price, T., Aitken, J., Simpson, E.R., 1992b. Relative expression of aromatase cytochrome P450 in human fetal tissues as determined by competitive polymerase chain reaction (PCR) amplification. J. Clin. Endocrinol. Metab. 74, 879 – 883. Ryde, C.M., Nicholls, J.E., Dowsett, M., 1992. Steroid and growth factor modulation of aromatase activity in MCF7 and T47D breast carcinoma cell lines. Cancer Res. 52, 1411 – 1415. Sadekova, S.I., Tan, L., Chow, T.Y.-K., 1994. Identification of the aromatase in the breast carcinoma cell lines T47D and MCF7. Anticancer Res. 14, 507 – 512. Santen, R.J., Martel, J., Hoagland, M., Naftolin, F., Roa, L., Harada, N., Hafer, L., Zaino, R., Santner, S.J., 1994. Stromal spindle cells contain aromatase in human breast tumors. J. Clin. Endocrinol. Metab. 79, 627 – 632. Santner, S.J., Pauley, R.J., Tait, L., Kaseta, J., Santen, R.J., 1997. Aromatase activity and expression in breast cancer and benign breast tissue stromal cells. J. Clin. Endocrinol. Metab. 82, 200 – 208. Sasano, H., Harada, N., 1998. Intratumoral aromatase in human breast, endometrial, and ovarian malignancies. Endocr. Rev. 19, 593 – 607. Sasano, H., Frost, A.R., Saitoh, R., Harada, N., Poutanen, M., Vihko, R., Bulun, S.E., Silverberg, S.G., Nagura, H., 1996. Aromatase and 17b-hydroxysteroid dehydrogenase type I in human breast carcinoma. J. Clin. Endocrinol. Metab. 81, 4042 –4046. Sasano, H., Uzuki, M., Sawai, T., Nagura, H., Matsunaga, G., Kashimoto, O., Harada, N., 1997. Aromatase in human bone tissue. J. Bone Miner. Res. 12, 1416 – 1423. Sasano, H., Murakami, H., Shizawa, S., Satomi, S., Nagura, H., Harada, N., 1999. Aromatase and sex steroid receptors in human vena cava. Endocr. J. 46, 233 – 242. Schmitt, M., Klinga, K., Schnarr, B., Morfin, R., Mayer, D., 2001. Dehydroepiandrosterone stimulates proliferation and gene expression in MCF-7 cells after conversion to estradiol. Mol. Cell. Endocrinol. 173, 1 – 13. Seipel, K., Georgiev, O., Shaffner, W., 1992. Different activation domains stimulate transcription from remote (enhancer) and proximal (promoter) positions. EMBO J. 11, 4961 – 4968. Simpson, E.R., Mahendroo, M.S., Means, G.D., Kilgore, M.W., Hinshelwood, M.M., Graham-Lorence, S., Amarneh, B., Ito, Y., Fisher, C.R., Michael, D.M., Mendelson, C.R., Bulun, S.E., 1994. Aromatase cytochrome P450, the enzyme responsible for estrogen biosynthesis. Endocr. Rev. 15, 342 – 355. Simpson, E.R., Khao, Y., Agarwal, V.R., Michael, M.D., Bulun, S.E., Hinshelwood, M.M., Graham-Lorence, S., Sun, T., Fisher, C.R.,

M. Maggiolini et al. / Molecular and Cellular Endocrinology 184 (2001) 163–171 Qin, K., Mendelson, C.R., 1997. Aromatase expression in health and disease. Rec. Prog. Horm. Res. 52, 185 –213. Simpson, E.R., Rubin, G., Clyne, C., Robertson, K., O’Donnel, L., Jones, M., Davis, S., 2000. The role of local estrogen biosynthesis in males and females. TEM 11, 184 – 188. Sourdaine, P., Mullen, P., White, R., Telford, J., Parker, M.G., Miller, W.R., 1996. Aromatase activity and CYP19 gene expression in breast cancers. J. Steroid Biochem. Mol. Biol. 59, 191 – 198. Steckelbroeck, S., Heidrich, D.D., Stoffel-Wagner, B., Hans, V.H.J., Schramm, J., Bidlingmaier, F., Klingmu¨ ller, D., 1999. Characterization of aromatase cytochrome P450 activity in the human temporal lobe. J. Clin. Endocrinol. Metab. 84, 2795 –2801. Thorsen, T., Tangen, M., Stoa, K.F., 1982. Concentration of endogenous oestradiol as related to oestradiol receptor sites in breast tumor cytosol. Eur. J. Cancer Clin. Oncol. 18, 333 – 337.

171

Tora, L., Mullick, A., Metzger, D., Ponglikitmongkol, M., Park, I., Chambon, P., 1989. The cloned human estrogen receptor contains a mutation which alters its hormone binding properties. EMBO J. 8, 1981 – 1986. van Landeghem, A.A.J., Portman, J., Mabauurs, M., 1985. Endogenous concentration and subcellular distribution of estrogens in normal and malignant human breast tissue. Cancer Res. 45, 2900 – 2906. Webb, P., Nguyen, P., Shinsako, J., Anderson, C., Feng, W., Nguyen, M.P., Chen, D., Huang, S.M., Subramanian, S., McKinerney, E., Katzenellenbogen, B.S., Stallcup, M.R., Kushner, P.J., 1998. Estrogen receptor activation function 1 works by binding p160 coactivator proteins. Mol. Endocrinol. 12, 1605 – 1618. Yue, W., Wang, J.P., Hamilton, C.J., Demers, L.M., Santen, R.J., 1998. In situ aromatization enhances breast tumor estradiol levels and cellular proliferation. Cancer Res. 58, 927 – 932.