The Donor Substrate Site within the Peptidyl Transferase Loop of 23 S rRNA and its Putative Interactions with the CCA-end of N-blocked Aminoacyl-tRNAPhe

J. Mol. Biol. (1996) 264, 472–483

The Donor Substrate Site within the Peptidyl Transferase Loop of 23 S rRNA and its Putative Interactions with the CCA-end of N-blocked Aminoacyl-tRNAPhe Bo T. Porse, Hoa Phan Thi-Ngoc and Roger A. Garrett* RNA Regulation Centre Institute of Molecular Biology, University of Copenhagen, So lvgade 83H DK 1307 Copenhagen K Denmark

An RNA region associated with the donor substrate site, located at the base of the peptidyl transferase loop of 23 S rRNA, was subjected to a comprehensive single-site mutational study. Growth phenotypes of Escherichia coli cells were characterized on induction of synthesis of the mutated rRNAs and the mutated ribosomes were tested, selectively, for their capacity to generate peptide bonds under the conditions of the ‘‘fragment’’ assay. Most of the mutants exhibited dominant or recessive lethal growth phenotypes and, in general, defective growth correlated with low activities in peptide bond formation, although exceptions were observed with normal growth and low activities, and vice versa. All these phenotypes are consistent with defects occurring in the structure of the ribosomal donor site and/or the capacity of the donor substrate to enter or leave this site. A compensating base change approach was employed to test for Watson-Crick base-pairing interactions between the -CCA end of the P-site bound tRNAPhe and this region of the peptidyl-transferase loop. Single nucleotide substitutions were introduced into the -CCA end of tRNAPhe and the ability of the 3'-terminal pentanucleotide fragments to act as donor substrates was examined for ribosomes carrying the different mutated 23 S rRNAs. No evidence was found for the occurrence of Watson-Crick base-pairing interactions. However, the data are consistent with the formation of a Hoogsteen pair between the 3'-terminal adenosine base of the donor substrate and U2585 of the 23 S rRNA. 7 1996 Academic Press Limited

*Corresponding author

Keywords: peptidyl transferase; donor substrate site; rRNA mutants; clindamycin; tRNA-rRNA interaction

Introduction Formation of hybrid tRNA binding sites during peptide elongation (Bretscher, 1968; Kurland & Ehrenberg, 1985; Moazed & Noller, 1989a; Semenkov et al., 1989) has changed our conceptual view of how tRNAs move through the ribosome. It challenges many deeply rooted prejudices about protein biosynthesis and provides a rationale for many contradictions in the literature. It also raises new challenges to elucidate how movement occurs, especially of the 3'-end of the tRNA, during peptide bond formation. Initially, the -CCA end of the aminoacyl-tRNA is encapsulated in the ternary complex (Nissen et al., 1995). On GTP hydrolysis, it is released and probably moves through transitory states in the last of which (Porse et al., 1995) peptide 0022–2836/96/480472–12 $25.00/0

bond formation occurs with a peptidyl-tRNA occupying what is considered to be the classical P(P30 S/P50 S)-site. The new peptidyl-tRNA occupies the A/P(hybrid) site where, as in the P/P state, peptide bond formation can occur with puromycin, albeit at a slower rate (Semenkov et al., 1992). This implies that the P(hybrid) and P(50 S) sites are overlapping but non-identical and this view is reinforced by the results from cross-linking experiments involving the 2-azidoadenosine moiety at the 3' terminus of tRNAPhe (Wower et al., 1995). The P/P-site constitutes the strongest binding site on the ribosome for N-blocked peptidyl-tRNA, aminoacyl-tRNA and deacylated tRNA (Makarov et al., 1984). Ribonuclease T1 digestion experiments (Cerna´ et al., 1973) provided early evidence that 7 1996 Academic Press Limited

473

Ribosomal Donor Substrate Site

rRNA is crucial for donor substrate binding, although later cross-linking data (e.g. see Wower et al., 1995) also suggest a role for ribosomal proteins. Chemical modification studies have demonstrated that the terminal -CC sequence of P/P-site tRNA is protected in the ribosome (Peattie & Herr, 1981; Douthwaite et al., 1983), and that sequential removal of this tRNA sequence renders the universal GG2253 sequence, and the base of the peptidyl transferase loop, more reactive to chemical reagents (Moazed & Noller, 1989b). These observations led to the revival of an early hypothesis (Symons et al., 1978) that the universal -CCA sequence base-pairs with a conserved sequence in the 23 S rRNA. Several lines of evidence, including RNA footprinting, RNA cross-linking and antibiotic footprinting, have implicated the highly conserved RNA region at the base of the peptidyl transferase loop in binding of the donor substrate in either the P(hybrid) or the P(50 S)-site (reviewed by Porse et al., 1995). Moreover, it has been argued that this is the primary donor substrate site that contains a universally conserved C/UG2581 sequence, and an adjacent highly conserved G2582, that could provide hydrogen-bonding sites for the 3'-end of the donor substrate (Rodriguez-Fonseca et al., 1995; Porse & Garrett, 1995). Earlier, using a mutagenesis approach we (Porse & Garrett, 1995), and others (Saarma & Remme, 1992), demonstrated that a few single nucleotide changes in this region produced dominant lethal phenotypes, reinforcing its functional importance. In the present study, we have undertaken a systematic mutational study of the region, in order to obtain more insight into its functional role. In addition to characterizing the growth phenotypes of 25 single-site mutants, the peptidyl transferase activities of the mutated ribosomes were selectively examined using the ‘‘fragment’’ assay (Monro, 1967). Furthermore, a search was made for potential base-pairing interactions between the conserved -CCA end of Ac-Phe-tRNAPhe and conserved nucleotides in this region using a compensating base change approach (Lieberman & Dahlberg, 1994). The universally conserved GG2253 sequence in domain V of 23 S rRNA has been implicated in the donor substrate site primarily on the basis of RNA footprinting studies (Moazed & Noller, 1989b). However, there is no supporting evidence for this assignment either from antibiotic footprinting (Rodriguez-Fonseca et al., 1995) or from cross-linking of tRNAs affinity labelled at their 3'-ends (Wower et al., 1995). Its functional and structural relationship to the site in the peptidyl transferase loop remains, therefore, unclear. While our experiments were in progress, evidence was provided for an interaction between C74 of P-site bound tRNA and G2252 of the 23 S rRNA, using a compensating base-pairing approach (Samaha et al., 1995). Here, we confirm this observation and consider the relative functional significance of this site.

Results Expression of 23 S rRNAs mutated in the putative donor site On the basis of RNA footprinting studies, a small set of universally conserved nucleotides, including G2505, U2506, U2584 and U2585 at the base of the peptidyl transferase loop, as well as G2252 and G2253, have been assigned to the donor substrate site (Moazed & Noller, 1989b). Therefore, each of these positions and the adjacent C2580, G2581, G2582 and G2583 (Figure 1A and B) was mutated. Nucleotide substitutions were generated in vitro and cloned into pLK45, which contains a copy of the rrnB operon of Escherichia coli under control of the PL promoter of phage l (Powers & Noller, 1990). pLK45 carries the mutations C1192 : U in 16 S rRNA and A2058 : G in 23 S rRNA, which confer resistance to spectinomycin and erythromycin, respectively. pLK45 derivatives were transformed into E. coli XL-1 cells that had been pretransformed with pcI857. This plasmid encoded a temperaturesensitive cI repressor such that transcription from the pLK45 derivatives could be regulated. Growth characteristics on agar plates of XL-1 cells transformed with pcI857, and the pLK45 derivatives, are shown in Table 1. At the permissive temperature, 30°C, each mutant displayed growth similar to the pLK45 control. However, when transcription of plasmid-encoded 23 S rRNA was induced at 42°C, several mutants grew more slowly. Extreme effects were observed for the U2506A, U2506C, U2506G, U2585A, U2585C, U2585G, C2580C, G2583U and U2584G mutants, which all showed a dominant lethal phenotype, i.e. were unable to grow despite the presence of 60 to 70% chromosomal-encoded ribosomes (Table 2). Major decreases in growth rate were generally observed when the cells were stressed by adding erythromycin to the medium, such that they became more dependent on plasmid-encoded ribosomes carrying the A2058 : G mutation. Two erythromycin concentrations were examined, one (25 mg/ml) where partial growth inhibition of the control cells occurs and a second (35 mg/ml) where growth of control cells is strongly reduced (Douthwaite, 1992). For some positions, the growth phenotype was dependent on the identity of the base change. For example, U2584R mutations produced a strong decrease in growth, whereas the U2584C mutation produced only a small decrease, in the absence of, or at low concentrations of, erythromycin. Similarly, the transversions G2583Y were very deleterious for cell growth, whereas the G2583A transition was almost neutral. Yields and peptidyl transferase activities of the mutated ribosomes Synthesis of plasmid-encoded 23 S rRNAs was induced by growing XL-1 (pcI857/pLK45 deriva-

474

Ribosomal Donor Substrate Site

Figure 1. Secondary structure of the peptidyl transferase loop of E. coli 23 S rRNA and the adjacent 2250-loop showing (A) 23 S rRNA nucleotides protected on donor substrate binding to the P-site (Moazed & Noller, 1989b). Symbols illustrate the protection dependency of the aminoacyl group, diamonds; the 3'-terminal adenosine base, filled circles, the 3'-terminal -CA, filled triangles and the remainder of the tRNA, filled squares. m, Methyl groups; c, pseudouridine; and D, dihydrouridine (Bakin & Ofengand, 1993; Brimacombe et al., 1993; Kowalak et al., 1995). B, Nucleotide substitutions that were studied in this work. The G2508U mutant was from a previous study (Porse & Garrett, 1995). The A2058 : G mutation is present in pLK45 and confers resistance to erythromycin and clindamycin.

tive) cells at 42°C for two hours. Ribosomal particles were isolated on sucrose gradients and the content of plasmid-encoded 23 S rRNA in the 50 S and 70 S particles was analysed using a primer extension procedure (Sigmund et al., 1988). In general, both 50 S subunits and 70 S ribosomes from the mutant cells contained less plasmid-encoded 23 S rRNA than the pLK45 control (Table 2). This was extreme for the G2505C and C2580G mutants, where plasmid-encoded 23 S rRNA was almost absent from 70 S ribosomes. However, apart from these exceptions, the ratios of mutated 23 S rRNAs in 50 S subunits and 70 S ribosomes were fairly close to those of the controls (Table 2), suggesting that subunit interactions were not seriously impaired by the mutations. Peptidyl transferase activities of mutated ribosomes were determined as described (Leviev et al., 1995), where the fragment assay was performed, together with puromycin and 33% ethanol (Monro, 1971), in the presence and absence of clindamycin. Ribosomes containing plasmid-encoded 23 S rRNA carry the A2058 : G mutation which confers resistance to the drug. When the fraction of plasmid-encoded 23 S rRNA in the ribosomes is known, the relative peptidyl transferase activity of ribosomes containing plasmid-encoded rRNA can be estimated (Leviev et al., 1995). These relative activities are listed in Table 2 for the mutated ribosomes. Ribosomes from all but one of the mutants exhibited strongly reduced activities. Only the G2508U mutant yielded ribosomes as active as the control ribosomes carrying the A2058 : G mutation. Reductions were greatest for mutations at positions G2582, G2583 and G2252, where activity levels were E5% of the control. Moreover,

as was found for the growth characteristics, at some positions the activity was strongly dependent on the identity of the base change. The largest variations were observed for the mutations at U2585 and G2253. For the former, ribosomes from the U2585G mutant retained 36% activity, whereas those from the U2585A and U2585C mutants were E6% active. For the latter, activities were reduced to 19% and 42%, respectively, for the G2253A and G2253U mutants whereas no activity (<5%) was detected for the G2253C mutant. Mutants G2583A and U2584C were exceptional in that they grew strongly (Table 1) but their ribosomes exhibited low activities (Table 2). To confirm this result, their ribosomes were tested further, together with those of mutants G2252C, G2583C, U2584A, U2585C and U2585G, in the puromycin reaction, in the presence of the donor substrate Ac-Phe-tRNAPhe and poly(U). The results for the G2583A and U2584C ribosomes (Table 3) correlate closely with those obtained with the fragment reaction (Table 2) as did those for the other mutant ribosomes, with the exception of ribosomes from mutants U2584A, U2584C and to a lesser extent, the U2585C and U2585G, which displayed enhanced activity in the tRNA assay, suggesting that the whole tRNA helps to compensate for a defective interaction between the -CCA end of the tRNA and the ribosome. RNA structural analysis around the mutated sites An attempt was made to show whether selective damage of mutant ribosomes had occurred during preparation, possibly because of the creation of

475

Ribosomal Donor Substrate Site

Table 1. Growth characteristics of cells harbouring mutated 23 S rRNA 30°C A50 K25

42°C A50 K25

42°C A50 K25 E25

42°C A50 K25 E35

Control pLK45

++++

++++

++++

++++

Mutants P.t. loop G2505A G2505C G2505U U2506A U2506C U2506G G2508U C2580A C2580C C2580G G2581A G2581C G2581U G2582A G2582C G2582U G2583A G2583C G2583U U2584A U2584C U2584G U2585A U2585C U2585G

++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++ ++++

++ ++ + − − − ++++ + − + ++ + ++ + + + ++++ ++ − + +++ − − − −

+ + + − − − ++++ + − + + − − − − − +++ − − + ++ − − − −

+ + − − − − ++++ − − − + − − − − − ++ − − − ++ − − − −

2250 loop G2252C G2252U G2253A G2253C G2253U

++++ ++++ ++++ ++++ ++++

+ + ++++ +++ ++++

− − ++++ + ++++

− − ++++ + ++++

E. coli XL-1 cells were transformed with pcl857 and mutated pLK45 derivatives, and growth-rates were determined on agar plates containing the indicated antibiotics: A50 , 50 mg/ml ampicillin; K25 , 25 mg/ml kanamycin; E25 , E35 , 25 or 35 mg/ml erythromycin. Growth was quantified, relative to the pLK45 control, by comparing colony sizes after incubation for 16 to 60 hours: + + + +, 80 to 100%; + + +, 50 to 80%; + +, 20 to 50%; +, 0 to 20%; −, no growth detected after 60 hours. Results are presented for mutations at the base of the peptidyl transferase (P.t.) loop and the G2250 loop (Figure 1). The data are averaged from three or four independent experiments.

very accessible nuclease sites, which might explain the high-growth, low-activity phenotypes of, for example, mutants G2583A and U2584C. The structural integrity of the rRNA at the base of the peptidyl transferase loop was investigated by primer extension for 17 of the 25 mutants (the exceptions were G2505C, U2506A, C2580G, G2581C, G2582U, G2583U, U2584G and U2585A). No new control cut was observed for any of the individual mutant rRNAs tested, including those of mutants G2583A and U2584C (Figure 2), which could reflect selective degradation during preparation. Only three mutants, C2580C, G2582C and G2583C, all with low-growth, low-activity phenotypes (Tables 1 and 2), displayed enhancements of the control bands that were observed for the wild-type sample (Figure 2). The latter probably reflect additional increased pausing of the reverse

transcriptase around the GGG2583 sequence, consistent with local structural alterations produced by the mutations. No other change in the intensities of control bands was observed in the lower part of the peptidyl transferase loop. Donor activities of tRNAPhe derivatives mutated in the CCA sequence Mutant tRNAPhe molecules were transcribed by phage T7 RNA polymerase and subjected to aminoacylation and N-acetylation. Although the Vmax values for aminoacylation of some of the tRNAPhe mutants were low (up to 250-fold lower than for the unmutated tRNA), each tRNA could be charged by adding large amounts of the phenylalanyl-tRNA synthetase. 3'-Pentanucleotide fragments were isolated by RNase T1 digestion of

476

Ribosomal Donor Substrate Site

Table 2. Incorporation of mutated 23 S rRNA into ribosomal particles and peptidyl transferase activities of the mutated ribosomes % Plasmid-encoded 23 S rRNA in 50 S 70 S subunits ribosomes

Mutant 50 S/70 S ratio

% Activity of mutant 70 S ribosomes

Control pLK45

45

30

1.6

100

Mutants P.t. loop G2505A G2505C G2505U U2506A U2506C U2506G G2508U C2580A C2580C C2580G G2581A G2581C G2581U G2582A G2582C G2582U G2583A G2583C G2583U U2584A U2584C U2584G U2585A U2585C U2585G

40 15 40 30 25 35 50 40 45 35 40 30 35 35 40 40 40 30 30 35 40 40 30 25 30

25 <5 20 20 20 25 30 25 30 10 25 25 30 20 25 25 25 25 25 15 25 25 25 20 25

1.8 >3 2.0 1.5 1.2 1.4 1.6 1.6 1.6 >3 1.4 1.2 1.3 1.5 1.6 1.6 1.6 1.3 1.3 1.8 1.5 1.5 1.2 1.3 1.2

14(23) 17(23) <5 5(22) 20(23) <5 77(26) <5 12(24) 6(22) 22(23) 13(22) 18(23) <5 <5 <5 5(22) <5 5(22) 22(25) 21(25) 32(26) 6(23) <5 36(24)

2250 loop G2252C G2252U G2253A G2253C G2253U

30 30 35 40 40

20 20 25 20 25

1.6 1.5 1.5 2.0 1.6

<5 <5 19(24) <5 42(26)

The amount of plasmid-encoded 23 S rRNA in 50 S and 70 S ribosomal particles was quantified by a primer extension method (Sigmund et al., 1988). Peptidyl transferase activities produced by ribosomes carrying plasmid-encoded 23 S rRNA were determined for 70 S particles, except for the G2505C and C2580G mutants, where 50 S subunits were employed because of the low yields of 70 S ribosomes carrying plasmid-encoded 23 S rRNA. The data are averaged from at least two independent experiments. Primer extension data displayed a 25% variation and are adjusted to the nearest 5% value. Error limits for the peptidyl transferase measurements are indicated.

N-acetylated and aminoacylated tRNA species and their donor activities were then tested in the fragment reaction. Pentanucleotide fragments from seven of the nine tRNAPhe mutants were tested (fragments with terminal sequences GCA and CGA could not be generated) on wild-type E. coli XL-1 ribosomes. As shown in Figure 3, all 7 mutant tRNAPhe fragments were very poor donors compared with the wild-type fragment. The highest activities were displayed by CCG and UCA, followed by CCC, which showed a low, albeit significant, donor substrate activity. The low activities underline the functional importance of each nucleotide in the CCA sequence for donor substrate activity.

Attempts to regenerate peptidyl transferase activity in the mutated ribosomes by incorporating compensating mutations in the tRNA fragments We tested the hypothesis that the -CCA end of the donor substrate interacts with the base of the peptidyl transferase loop via Watson-Crick basepairing by applying the concept of compensatory base changes. This requires, for example, that mutating a uridine base in 23 S rRNA, which putatively base-pairs with A76 of the donor substrate, would strongly reduce or abolish peptidyl transferase activity in the presence of the unmutated tRNA fragment but restore it if the

477

Ribosomal Donor Substrate Site

Table 3. Peptidyl transferase activity of mutant ribosomes determined using Ac-Phe-tRNAPhe as donor substrate in the presence of poly(U) % activity Control pLK45

100

Mutants P.t. loop G2583A G2583C U2584A U2584C U2585C U2585G

<5 <5 49(25) 41(24) 10(23) 51(25)

2250 loop G2252C

<5

Peptidyl transferase activities were measured in the absence of ethanol using 10 pmol of 70 S ribosomes, 10 pmol N-acetyl[3H]Phe-tRNAPhe and 10 mg of poly(U) in 100 ml of 50 mM Tris-HCl (pH 7.5), 150 mM KCl, 10 mM MgCl2 and 1 mM puromycin. Activities of the ribosomes containing plasmid-encoded 23 S rRNA were determined by performing parallel reactions in the presence and absence of 150 mM clindamycin.

mutated fragment carrying the complementary sequence is added. We performed the assays, in the presence of clindamycin, using all possible combinations of the eight donor fragments, carrying the terminal sequences CCA, CCC, CCG, CCU, CAA, CUA, UCA and ACA, and ribosome preparations for the 25 mutants in the peptidyl transferase loop (Figure 1B). Peptidyl transferase activities did not rise significantly above background levels for any of these combinations. This renders the occurrence of a Watson-Crick base-pairing interaction between the 3'-terminal -CCA sequence of the donor

Figure 2. Primer extension analyses of rRNA extracted from ten mutant ribosome preparations. Arrows denote structural pausing of the reverse transcriptase at U2584 (lower) and G2582 (upper bands). Samples were loaded in the order: (1) wild-type control, (2) C2580A, (3) C2580C, (4) G2581A, (5) G2581U, (6) G2582A, (7) G2582C, (8) G2583A, (9) G2583C, (10) U2584A and (11) U2584C.

Figure 3. Peptidyl transferase activities were measured by the fragment reaction using 3'-pentanucleotide fragments mutated in the 3'-terminal -CCA sequence. Values were normalized relative to the activity of the unmutated substrate after subtraction of background values. Relative peptidyl transferase activities varied within 22% of the number indicated above the bars.

substrate and any of the mutated positions within 23 S rRNA, very unlikely. Using a similar approach, where 50 S subunits were assembled in vitro from hybrid 23 S rRNA composed of a T7 transcript, carrying mutations at G2252 or G2253, and the 3'-end of natural E. coli 23 S rRNA, evidence was provided for WatsonCrick base-pairing between C74 of the 3'-terminal pentanucleotide fragment from fMet-tRNAMet and G2252 (Samaha et al., 1995). We repeated this experiment in our system, partly in order to test the sensitivity of our assay. Ribosomes from the pLK45 control, and the mutants G2252C and G2252U, were assayed with the donor fragments carrying sequences CCA, ACA and UCA, and the G2253A, G2253C and G2252U mutants were tested with all eight of the donor substrate mutants. The results are consistent with the earlier data. No significant peptidyl transferase activity was restored for the G2253 mutants, whereas they were for those G2252 mutants that could generate a base-pair (G-C (wild-type), G:U or A-U) with position 74 of the tRNA, as illustrated in Figure 4. This result provides an important positive control for the sensitivity of our compensating base-pair approach, as well as confirming the earlier result, using ribosomes assembled in vivo.

Discussion The concept of base-pairing between the 3'-terminal -CCA sequence of tRNA and a complementary sequence in 23 S rRNA (Symons et al., 1978) initially gained credibility because of the universality of the former sequence. However, the -CCA sequence may be conserved because of multiple constraints

478

Figure 4. Peptidyl transferase activities of the wild-type, and the G2252 mutants, using pentanucleotide fragments of tRNAPhe with the terminal sequences CCA, UCA, ACA. Assays were performed in the presence of clindamycin and normalized to levels observed for wild-type ribosomes and the unmutated -CCA substrate. Relative peptidyl transferase activities varied within 23% of the number indicated above the bars. The identity of the bases at positions 74 (tRNA) and 2252 (23 S rRNA) are shown below each bar. Potential WatsonCrick and G:U base-pairing interactions are shown in bold.

that are not exclusively ribosomal. It is recognized specifically by other components of the translation machinery including RNase P (Kirsebom & Svard, 1994), aminoacyl-tRNA synthetases (Liu & Horowitz, 1994; Tamura et al., 1994) and EF-Tu (Nissen et al., 1995), and it has a specific attachment site in the ribosomal E-site (Lill et al., 1988). Moreover, estimation of the free energy contributions of -CCA76 to binding in the donor substrate site appears to be incompatible with the simultaneous formation of multiple hydrogen bonds (Parfenov & Saminskii, 1993). There are indications that the ribosomal interactions may be complex. For example, pA-fMet exhibits donor activity that can be stimulated to the level of pCA-fMet by pC, whereas no stimulation of the donor activity of pCA-fMet occurred with added pC (Cerna´, 1975; Krayevsky et al., 1976). This suggests that the ribosomal interaction of C74 with G2252 (Samaha et al., 1995) may be structurally uncoupled from that of CA76 with the ribosome. Moreover, given that the 3'-end of the tRNA moves relative to the ribosome during peptide bond formation (Odom et al., 1990), and that there are overlapping but non-identical P(hybrid) and P(50 S) sites (Wower et al., 1995), interactions may occur sequentially with different parts of the -CCA sequence (Kirillov et al., 1997). In this study, we have concentrated on the partially accessible region at the base of the

Ribosomal Donor Substrate Site

peptidyl transferase loop (Egebjerg et al., 1990), which includes the universally conserved G2505, U2506, U2584 and U2585 (Figure 1). It has been implicated, on the basis of RNA footprinting experiments (Moazed & Noller, 1989b), in the interaction with the 3'-terminal -CA sequence of the donor substrate. Unlike the G2250 loop, this site is implicated in antibiotic binding; bruceantin, carbomycin, chloramphenicol, griseoviridin, tylosin and virginiamycin M1 all caused reduced chemical reactivity of one or more of these nucleotides (Moazed & Noller, 1987; Rodriguez-Fonseca et al., 1995). Moreover, it reacts with affinity labels attached to the 3'-A76 of donor substrates (Wower et al., 1995). Adjacent, lies the conserved C/ UGG2582 sequence (Figure 1) that provides potential base-pairing sites for the 3'-terminal CCA sequence of peptidyl-tRNA (Porse & Garrett, 1995), although G2582 is not rigorously conserved amongst all mitochondrial rRNAs (Maidak et al., 1996). Each of the above-mentioned nucleotides was mutated, together with the adjacent G2508 and G2583 (Figure 1) and expressed together with the A2058 : G mutation as double mutants, in the pLK45 system. The latter mutation allowed a functional distinction to be made between 23 S rRNA encoded by the plasmid and chromosome. G2058 occurs naturally in many archaea and eukaryotes (Maidak et al., 1996) and it caused only a minor reduction in both growth rate (5 to 10%) and peptidyl transferase activity of E. coli ribosomes (5%: Vester & Garrett, 1987; Porse & Garrett, 1995). Moreover, position 2058 and the region under study appear to be, to a large degree, functionally uncoupled (Rodriguez-Fonseca et al., 1995). However, we cannot completely eliminate the possibility that minor synergistic effects occur between them. All of the mutations, except for G2508U, G2583A and U2584C, produced serious growth defects. Each mutation at U2506 and U2585 produced dominant lethal phenotypes, as did the mutations C2580C, G2583U and U2584G (Table 1). Moreover, ribosomes isolated from each of the mutants, except for the single mutant at G2508, displayed low, or no activity (<5%), in the fragment assay. Strictly speaking, this can reflect defects in donor substrate binding, loss of catalytic activity or inhibition of puromycin binding. However, since there is no evidence implicating this region in catalysis (Garrett & Rodriguez-Fonseca, 1995), and puromycin does not footprint in this rRNA region (Rodriguez-Fonseca, C., Phan, H., Amils, R. & R.A.G., unpublished results), we are probably primarily monitoring donor substrate binding. However, a distinction cannot be made between altered binding at the P(50 S) site and altered access to, or exiting from, this site. Moreover, there may be differences in the mode of access to the P-site for factor-dependent reactions (EF-G or IF-2) and factor-independent binding, as studied here.

Ribosomal Donor Substrate Site

Evidence for the structural complexity of the donor substrate site We still know relatively little about the structure of this region, mainly because the highly conserved rRNA sequence is not amenable to secondary structural analysis by the compensatory base change approach. We also lack data on the involvement of ribosomal proteins, although L27 cross-links to tRNA probes carrying affinity labeled A76 that also react with this rRNA region (Wower et al., 1995). However, our data yield some insight into its structural complexity. Mutation of G2505, U2506, U2584 and U2585, as well as G2583, produced growth phenotypes and/or ribosomal activities that are dependent on the identity of the base change (Table 1). Thus, for G2583 and U2584, transversions were more deleterious for growth than transitions, which may reflect their involvement in G:U pairs, compatible with their low chemical reactivities in ribosomal particles (Egebjerg et al., 1990). The phenotype displayed by the G2583A and U2584C mutants, strong growth at high erythromycin concentration and no or low peptidyl transferase activity for both the pentanucleotide substrate (Table 2) and the full-length tRNA (Table 3), is enigmatic. Earlier, ribosomes from another double mutant of 23 S rRNA were examined that carried the G2583A mutation. The donor substrate was positioned in an EF-G-dependent manner (Saarma & Remme, 1992) and low levels of peptidyl transfer were observed. These results suggest that donor site binding is defective only in the absence of EF-G, and is compatible with either EF-G compensating for weakened donor substrate binding or the substrate entry pathway being different in the presence of EF-G. The reverse effect that was observed for the G2581A mutant, 22% activity when the donor site was filled with the pentanucleotide fragment (Table 2) but none when filled in an EF-G-dependent manner (Nierhaus et al., 1995), is consistent with this view. For the G2505, U2506 and U2585 mutants, their growth phenotypes did not vary with the identity of the nucleotide but their ribosomal activity levels did (Table 2). The low activity (<5%) for the G2505U mutant ribosomes probably reflects a larger structural perturbation than for the G2505A and G2505C mutants, which produced higher ribosomal activities (14% and 17%, respectively). Only the mutations U2506C and U2585G, at positions 2506 and 2585, produced significant ribosomal activities (20% and 36%, respectively). The results for the U2506C mutant may indicate that a U:G pair is replaced by a C:G pair in the mutant, which partially retains peptidyl transferase activity. The possible interaction of both U2585, that is very accessible in ribosomal particles (Garrett & Rodriguez-Fonseca, 1995), and mutated G2585, with the 3'-terminal adenosine base of the donor substrate is considered below.

479 What can be deduced about the interaction of the -CCA end of the donor substrate and the 50 S subunit? The importance of the CCA sequence for donor substrate activity has been systematically and extensively studied. For example, the minimal substrates pR-fMet produced donor activities in the order A > I > G, whereas pY-fMet substrates were inactive (Cerna´ et al., 1974), underlining that residual substrate specificity resides in a terminal 3'-purine base of the tRNA. Furthermore, mutational studies on Ac-Val-tRNAVal showed that the 3'-terminal CCG, CUA and UCA mutations produced 20%, 4% and 10%, respectively, of the donor activity of unmutated tRNA substrate, whereas the other possible mutants were inactive (Tamura, 1994). This supports the requirement for a purine at the 3' terminus and pyrimidines at the other positions. The present work is in line with both results. Pentanucleotide fragments derived from mutants of Ac-Phe-tRNAPhe, carrying the mutated 3'-terminal sequences UCA and CCG, were significantly active as donors (with about 8% of the wild-type activity) in the fragment reaction (Figure 3). However, the weak donor activity displayed by the CCC fragment, indicates that a purine is not a strict requirement at the 3' terminus. In the compensating base change approach for testing tRNA-23 S rRNA interactions, the fragment reaction was performed on the eight donor fragments with single substitutions in the terminal CCA76 sequence and all combinations of the 25 ribosomal mutations at the base of the peptidyl transferase loop. No significant peptidyl transferase activity was generated by putative compensating Watson-Crick base-pairs. Importantly, the control experiment for the G2252/G2253 region (Figure 4), which supported the G2252:C74 interaction, established that our assay was sufficiently sensitive. This strongly suggests that Watson-Crick base-pairs do not form between the CCA76 sequence and the base of the peptidyl transferase loop, although the possibility cannot be eliminated that the identity of the 23 S rRNA nucleotides is essential for either structural or catalytic reasons. Another possibility is that the mutations affect the binding of a ribosomal protein(s) necessary for donor substrate binding. Earlier experiments with minimal donor substrates, that were conformationally restricted around the N-glycosidic bond, suggested that the 3'-terminal adenine base is in the syn conformation (reviewed by Krayevsky & Kukhanova, 1979). This would be compatible with the formation of an A-U Hoogsteen pair between A76 and U2585 on 23 S rRNA (Figure 5A), and it correlates with ribosomes from the U2585G mutant displaying a significant level of peptidyl transferase activity, since an iso-structural A76:G2585 pair may form in this mutant (Figure 5B). Lack of growth of the U2585G mutant does not necessarily detract from the model, since together with U2585A and U2585C

480

Ribosomal Donor Substrate Site

derive directly from the site being examined. The present study is no exception. Peptide bond formation is mechanistically coupled to movement of the 3'-ends of the aminoacyl and peptidyl-tRNAs into, and out of, the catalytic centre, movements that we cannot directly monitor with our methods. Movements may also occur within the donor site during peptide bond formation. The experimental approach used was therefore a necessary compromise. We established a direct proportionality between a decreased cell growth phenotype and low activity in forming peptide bonds and, on the basis of extensive literature evidence, we argue that these defects arise primarily from perturbation of the donor site; we consider further that the three exceptions (high growth/low activity or vice versa) are also compatible with donor site-related defects. Apart from the potential A76-U2585 Hoogsteen pairing interaction, we are no wiser concerning donor substrate-donor site interactions in this region, and further resolution of these weak interactions may require NMR or X ray diffraction approaches. Nevertheless, all of the data establish that the RNA region under study is of functional importance.

Experimental Procedures Generation of single-site mutations in 23 S rDNA

Figure 5. Putative base-pairing patterns between the 3'-terminal adenosine base of peptidyl-tRNA, bound in the donor substrate site, and the U or G at position 2585 of 23 S rRNA. A, In wild-type ribosomes, U2585 could form an A:U Hoogsteen pair. B, In the U2585G mutant, partial restoration of the activity may result from formation of an A:G pair. In both diagrams the 3'-terminal adenosine of peptidyl-tRNA is in the syn conformer.

mutants, it may be defective in other functions coupled to peptidyl transfer including, entry of the newly deacylated tRNA into the E(50 S) site where the A76 of the tRNA is important for recognition (Lill et al., 1988). If this model is correct, then the weak donor activity observed for the CCG and CCC fragments (Figure 3) could reflect both a lower tendency of the 3'-terminal base to adopt the syn conformation and the partial loss of a hydrogenbonding donor or acceptor group.

Conclusions The ribosome is by nature, structurally and functionally a cooperative entity. Therefore, any attempt to examine a particular functional centre on the ribosome is fraught with difficulties, since any observed structural or functional change may not

Site-directed mutagenesis was performed according to Kunkel et al. (1987) using uracil-containing singlestranded M13mp1945SB DNA as template (Porse & Garrett, 1995). M13mp1945SB contains a 2.2 kb SphI/ BamHI fragment encompassing the 3' half of E. coli 23 S rDNA. The following oligonucleotides were used as primers where the mutated nucleotide is underlined: 5'TGATGAGCCGBCATCGAGGT (U2506 to A, C or G) 5'GTTCTAAACCCBGCTCGCGTACC (C2580 to A, C or G), 5'ACGTTCTAABCCCAGCTCGC (U2584 to A, C or G), 5'CGTTCTABACCCAGCTCG (U2585 to A, C or G), 5'GGAGACCGCDCCAGTCAAACTACCC (G2252 to A, C or U), 5'GGAGACCGDCCCAGTCAAACTACC (G2253 to A, C or U), 5'TGATGAGCCGADATCGAGGT (G2505 to A, C or U), 5'GTTCTAAACCDAGCTCGCGTACC (G2581 to A, C or U), 5'GTTCTAAACDCAGCTCGCGTACC (G2582 to A, C or U), 5'GTTCTAAADCCAGCTCGCGTACC (G2583 to A, C or U). G2508U was obtained in a previous study using a random mutagenesis approach (Porse & Garrett, 1995). The 2.2 kb SphI/BamHI fragments from the mutated M13mp1945SB derivatives were subsequently cloned into pLK45 (Powers & Noller, 1990). Competent XL-1 cells, pre-transformed with pcI857 (Remaut et al., 1983), were transformed with the ligation mixture and plated

481

Ribosomal Donor Substrate Site on LB agar plates containing ampicillin (50 mg/ml) and kanamycin (25 mg/ml). Expression of mutant 23 S rRNA and isolation of ribosomes Cultures of XL-1 cells, transformed with pcI857 and mutated pLK45 derivatives, were grown at 30°C in LB medium containing ampicillin (25 mg/ml) and kanamycin (15 mg/ml). The cultures were diluted into 500 ml of fresh medium and synthesis of plasmidencoded rRNA was induced by incubating at 42°C for two hours. Cells were pelleted, resuspended in 1 ml of buffer A (20 mM Tris-HCl (pH 7.5), 10.5 mM magnesium acetate, 100 mM NH4 Cl, 0.5 mM EDTA, 3 mM 2-mercaptoethanol) and transferred to a 50 ml polypropylene tube. Lysozyme (5 mg, Sigma) and 10 units of RNase-free DNase I (Boehringer-Mannheim, Germany) were added and the cells were opened by vortexing with an equal volume of glass beads. The lysate was recovered by centrifugation, layered on a 40 ml 10% to 40% (w/v) sucrose gradient containing buffer A and centrifuged for 19 hours at 42,000 g in an SW-28 rotor (Beckman, Palo Alto); 50 S and 70 S particles were recovered from the relevant fractions by adding 0.7 volume ethanol. Following centrifugation, ribosomal particles were resuspended in buffer A and stored at −80°C. rRNA was isolated from these particles by extraction with phenol and chloroform followed by precipitation with ethanol and their contents of plasmid-encoded 23 S rRNA were analysed by primer extension using a primer complementary to the sequence 2061 to 2078 of E. coli 23 S rRNA (Sigmund et al., 1988). Band intensities for the chromosome and plasmid-encoded rRNA were quantified in an lnstant Imager (Packard, Chicago). The structural integrity of the rRNA in the mutated region was analysed by primer extension on total rRNA isolated from 70 S ribosomes (Christiansen et al., 1990) using a primer complementary to 2654 to 2670 of E. coli 23 S rRNA. Generation of substrates for the fragment reaction The pheU gene from E. coli was amplified by PCR using chromosomal DNA from XL-1 cells as template and oligonucleotide primers: 5'GCCGCCAGGTTGGTGCATTG (identical with nucleotides 112 to 131 upstream from the transcription start site) and 5 'TGGTGCGCGGACTCGGAATC (complementary to nucleotides 57 to 76 of the tRNA gene; Schwartz et al., 1983). The 207 bp PCR product was cloned in the EcoRI site (filled out by treatment with the Klenow fragment) of pUC19 and an aliquot of the ligation mixture was subjected to a second round of PCR using the reverse primer (5 'GAAACAGCTATGACCATG) and a primer identical with the T7 promoter and the first 15 nucleotides of the tRNAPhe gene (5'TAATACGACTCACTATAGCGCGGATAGCTCAG). The 175 bp PCR product was cut with BamHI and the resulting 114 bp fragment was cloned into pUC19 (cut with BamHI and HincII) to yield pBP951. The underlined nucleotides represent the G3-C70 base-pair, which were reversed in order to improve the yield of T7 transcripts (Petersson & Uhlenbeck, 1992).

In vitro synthesis of tRNAPhe derivatives Templates for the T7 RNA polymerase were generated by PCR (30 cycles: 30 seconds at 92°C, 30 seconds at 48°C

and 30 seconds at 72°C) using pBP951 as the template, the reverse primer and one of the following oligonucleotides as primers: 5'XXXTGCGCGGACTCGGAATC, where XXX represents TGG, AGG, CGG, GGG, TAG, TCG, TTG, TGA, TGC or TGT. After gel purification, the resulting 140 bp PCR products were used as templates in the T7 RNA polymerase-directed in vitro RNA synthesis (Milligan & Uhlenbeck, 1989). The T7 transcripts were purified in 10% (w/v) polyacrylamide gels and, following extraction, they were labelled with 5'[32P]pCp, digested with RNase T2 and analysed by thin-layer chromatography in order to verify the identity of the 3'-terminal nucleotide. T7 transcribed tRNAPhe (4 mg), or a mutant thereof, was aminoacylated for 30 minutes in 30 mM Hepes-KOH (pH 7.45), 50 mM KCl, 15 mM MgCl2 , 4 mM DTT, 2 mM ATP, 5 mM [3H]phenylalanine (10 Ci/mmol) and a surplus of partially purified phenylalanyl-tRNA synthetase (Peterson & Uhlenbeck, 1992). After extraction with phenol and precipitation in ethanol, the aminoacylated tRNAs were resuspended in 250 mM sodium acetate (pH 6.0) and acetylated with acetic anhydride (Haenni & Chapeville, 1966). The N-blocked and aminoacylated tRNAs were purified on a Sephadex G25 column, precipitated with ethanol and resuspended in 250 mM sodium acetate containing 10 mM EDTA. They were then cleaved with RNase T1 .

Peptidyl transferase assays Peptidyl transferase activities were measured using the fragment assay. Unmutated or mutated pentanucleotide fragments of tRNAPhe were prepared as described above and used as substrates. Assays were performed on ice in 33 mM Tris-HCl (pH 7.5), 270 mM KCl, 13 mM magnesium acetate, 0.5 mM puromycin (Sigma, St Louis), 33% ethanol and 5000 cpm pentanucleotide fragment. The reactions were initiated by the addition of 0.1 A260 unit of ribosomes. Activities of the ribosomes containing plasmid-encoded 23 S rRNA were determined by performing parallel reactions, in the presence and absence of 150 mM clindamycin (Sigma, St Louis: Leviev et al., 1995).

Acknowledgements We thank Stanislav Kirillov for critically reading the manuscript. The Danish Natural Science Research Council provided a PhD fellowship to B.T.P. and supported the research, which was financed also by the RNA Regulation Centre.

References Bakin, A. & Ofengand, J. (1993). Four newly located pseudouridylate residues in E. coli 23 S rRNA are all at the peptidyltransferase center: analysis by the application of a new sequencing technique. Biochemistry, 32, 9754–9762. Bretscher, M. S. (1968). Translocation in protein synthesis: a hybrid structure model. Nature, 218, 675–677. Brimacombe, R., Mitchell, P., Osswald, M., Stade, K. & Bochkariov, D. (1993). Clustering of modified nucleotides at the functional center of bacterial rRNA. FASEB J. 7, 161–167.

482 Cerna´, J. (1975). Effect of cytidine-5'-monophosphate on peptidyl transferase activity. FEBS Letters, 58, 94–98. Cerna´, J., Rychlı´k, I. & Jonak, J. (1973). Peptidyl transferase activity of E. coli ribosomes digested by ribonuclease T1 . Eur. J. Biochem. 34, 551–556. Cerna´, J., Rychlı´k, I., Krayevsky, A. A. & Gottikh, B. P. (1974). A contribution to the studies on donor site of peptidyl transferase with acylaminoacyl-nucleoside5'-monophosphates. Acta Biol. Med. Germ. 33, 877–883. Christiansen, J., Egebjerg, J., Larsen, N. & Garrett, R. A. (1990). Analysis of rRNA structure: experimental and theoretical considerations. In Ribosomes and Protein Biosynthesis: A Practical Approach (Spedding, G., ed.), pp. 229–252, Oxford University Press, Oxford. Douthwaite, S. (1992) Functional interactions within 23 S rRNA involving the peptidyl transferase center. J. Bacteriol. 174, 1333–1338. Douthwaite, S., Garrett, R. A. & Wagner, R. (1983). Comparison of E. coli tRNAPhe in the free state, in the ternary complex and in the ribosomal A and P sites by chemical probing. Eur. J. Biochem. 131, 261–269. Egebjerg, J., Larsen, N. & Garrett, R. A. (1990). Structural map of 23 S rRNA. In The Ribosome: Structure, Function and Evolution (Hill, W., Dahlberg, A., Garrett, R. A., Moore, P., Schlessinger, D. & Warner, J., eds), pp. 168–179, American Society Microbiology, Washington, DC. Garrett, R. A. & Rodriguez-Fonseca, C. (1995). The peptidyl transferase center. In Ribosomal RNA— Structure, Evolution, Processing, and Function in Protein Biosynthesis (Zimmermann, R. A. & Dahlberg, A. E., eds), pp. 327–355, CRC Press, Boca Raton, FA, Haenni, A. L. & Chapeville, F. (1966). The behaviour of acetylphenylalanyl soluble RNA in polyphenylalanine synthesis. Biochim. Biophys. Acta, 114, 135–148. Kirillov, S., Porse, B. T., Vester, B., Woolley, P. & Garrett, R. A. (1997). Movement of the 3'-end of tRNA through the peptidyl transferase centre and its inhibition by antibiotics. FEBS Letters. In the press. Kirsebom, L. A. & Svard, S. G. (1994). Base-pairing between E. coli RNase P RNA and its substrate. EMBO J. 1354, 4870–4876. Kowalak, J. A., Bruenger, E. & McCloskey, J. A. (1995). Posttranscriptional modification of the central loop of domain V in E. coli 23 S rRNA. J. Biol. Chem. 270, 17758–17764. Krayevsky, A. A. & Kukhanova, M. K. (1979). The peptidyl transferase centre of ribosomes. Prog. Nucl. Acids Res. 23, 1–51. Krayevsky, A. A., Victorova, L. S., Kotusov, V. V., Kukhanova, M. K., Treboganov, A. D., Tarussova, N. B. & Gottikh, B. P. (1976). The study of the stimulating mechanism of the peptidyl donor activity of 2'(3')-O-(N-formylmethionyl)-adenosine5'-phosphate in peptidyl transferase of the E. coli ribosome. FEBS Letters, 62, 101–104. Kunkel, T. A., Roberts, J. D. & Zakour, R. A. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol. 154, 367–382. Kurland, C. G. & Ehrenberg M. (1985). Constraints on the accuracy of messenger RNA movement. Quart. Rev. Biophys. 18, 423–450. Leviev, I., Levieva, S. & Garrett, R. A. (1995). Role of the highly conserved region of DIV of 23 S-like rRNA in subunit-subunit interactions at the peptidyl transferase centre. Nucl. Acids Res. 23, 1512–1517.

Ribosomal Donor Substrate Site

Lieberman, K. R. & Dahlberg, A. E. (1994). The importance of conserved nucleotides of 23 S rRNA and tRNA in ribosome catalyzed peptide bond formation. J. Biol. Chem. 269, 16163–16169. Lill, R., Lepier, A., Schwa¨gele, F., Sprinzl, M., Vogt, H. & Wintermeyer, W. (1988). Specific recognition of the 3'-terminal adenosine of tRNAPhe in th exit site of E. coli ribosomes. J. Mol. Biol. 203, 699–705. Liu, M. & Horowitz, J. (1994). Functional tRNAs with modifications in the 3'-CCA end: differential effects on aminoacylation and polypeptide synthesis. Proc. Natl Acad. Sci. USA, 91, 10389–10393. Maidak, B. L., Olsen, G. J., Larsen, N., Overbeek, R., McCaughey, M. J. & Woese, C. R. (1996). The ribosomal database project (RDP). Nucl. Acids Res. 24, 82–85. Makarov, E. M., Katunin, V. I., Odintsov, V. B., Semenkov, Y. P. & Kirillov, S. V. (1984). How do ribosome binding sites recognize the functional state of tRNA? Mol. Biol. 18, 1342–1347. Milligan, J. F. & Uhlenbeck, O. C. (1989). Synthesis of small RNAs using T7 RNA polymerase. Methods Enzymol. 180, 51–62. Moazed, D. & Noller, H. F. (1987). Chloramphenicol, erythromycin, carbomycin, and vernamycin B protect overlapping sites in the peptidyl transferase region of 23 S rRNA. Biochimie, 69, 879–884. Moazed D. & Noller, H. F. (1989a). Intermediate states in the movement of transfer RNA in the ribosome. Nature, 342, 142–148. Moazed D. & Noller, H. F. (1989b). Interaction of tRNA with 23 S rRNA in the ribosomal A, P, and E sites. Cell, 57, 585–597. Monro, R. E. (1967). Catalysis of peptide bond formation by 50 S ribosomal subunits from E. coli. J. Mol. Biol. 26, 147–151. Monro, R. E. (1971). Ribosomal peptidyl transferase: the fragment reaction. Methods Enzymol. 20, 472–481. Nierhaus, K. H., Beyer, D., Dabrowski, M., Scha¨fer, M. A., Spahn, C. M. T., Wadzack, J., Bittner, J.-U., Burkhardt, N., Diedrich, G., Ju¨nemann, R., Kamp, D., Voss, H. & Stuhrmann, H. B. (1995). The elongating ribosome: structural and functional aspects. Biochem. Cell Biol. 73, 1011–1021. Nissen, P., Kjeldgaard, M., Thirup, S., Polekhina, G., Reshetnikova, L., Clark, B. F. C. & Nyborg, J. (1995). Crystal structure of the ternary complex of Phe-tRNAPhe, EF-Tu and a GTP analog. Science, 270, 1464–1472. Odom, O. W., Picking, W. D. & Hardesty, B. (1990). Movement of tRNA but not the nascent peptide during peptide bond formation on ribosomes. Biochemistry, 29, 10734–10744. Parfenov, D. V. & Saminskii, E. M. (1993). Poly(U)-dependent interaction of yeast tRNAPhe and its fragments with E. coli ribosomes. II. Location of P-site-binding tRNA centers. Mol. Biol. 27, 507–510. Peattie, D. A. & Herr, W. (1981). Chemical probing of the tRNA-ribosome complex. Proc. Natl Acad. Sci. USA, 78, 2273–2277. Peterson, E. T. & Uhlenbeck, O. C. (1992). Determination of recognition nucleotides for E. coli phenylalanyl-tRNA synthetase. Biochemistry, 31, 10380– 10389. Porse, B. T. & Garrett, R. A. (1995). Mapping important nucleotides in the peptidyl transferase centre of 23 S rRNA using a random mutagenesis approach. J. Mol. Biol. 249, 1–10. Porse, B. T., Rodriguez-Fonseca, C., Leviev, I. & Garrett,

Ribosomal Donor Substrate Site

R. A. (1995). Antibiotic inhibition of the movement of tRNA substrates through a peptidyl transferase cavity. Biochem. Cell Biol. 73, 877–885. Powers, T. & Noller, H. F. (1990). Dominant lethal mutations in a conserved loop in 16 S rRNA. Proc. Natl Acad. Sci. USA, 87, 1042–1046. Remaut, E., Tsao, H. & Fiers, W. (1983). Improved plasmid vectors with a thermoinducible expression and temperature-regulated runaway replication. Gene, 22, 103–113. Rodriguez-Fonseca, C., Amils, R. & Garrett, R. A. (1995). Fine structure of the peptidyl transferase centre on 23 S-like rRNAs deduced from chemical probing of antibiotic-ribosome complexes. J. Mol. Biol. 247, 224–235. Saarma, U. & Remme, J. (1992). Novel mutants of 23 S RNA: characterization of functional properties. Nucl. Acids Res. 20, 3147–3152. Samaha, R. R., Green, R. & Noller, H. F. (1995). A base-pair between tRNA and 23 S rRNA in the peptidyl transferase centre of the ribosomes. Nature, 377, 309–314. Schwartz, I., Klotsky, R. A., Elseviers, D., Gallagher, J., Krauskopf, M., Siddiqui, M. A. Q., Wong, J. F. H. & Roe, B. A. (1983). Molecular cloning and sequencing of pheU, a gene for E. coli tRNAPhe. Nucl. Acids Res. 11, 4379–4389. Semenkov, Y. P., Shapkina, T. G. & Kirillov, S. V. (1989). Puromycin reaction at the ribosomal A site. Acad. Sci.

483 USSR. Leningrad Nuclear Physics Institute, preprint no. 1495. Semenkov, Y. P., Shapkina, T. G., Makhno, V. & Kirillov, S. V. (1992). Puromycin reaction for the A-site bound peptidyl-tRNA. FEBS Letters, 296, 207–210. Sigmund, C. D., Ettayebi, M., Borden, A. & Morgan, E. A. (1988). Antibiotic resistance mutations in rRNA genes of E. coli. Methods Enzymol. 164, 673–690. Symons, R. H., Harris, R. J., Greenwell, P., Eckermann, D. J. & Vanin, E. F. (1978). The use of puromycin analogs and related compounds to probe the active center of peptidyl transferase on E. coli ribosomes. In Bioinorg. Chem. 4(Suppl.), 409–436. Tamura, K. (1994). The role of the CCA sequence of tRNA in the peptidyl transfer reaction. FEBS Letters, 353, 173–176. Tamura, K., Nameki, N., Hasegawa, T., Shimizu, M. & Himenov, H. (1994). Role of the CCA terminal sequence of tRNAVal in aminoacylation with valyltRNA synthetase. J. Biol. Chem. 269, 22173–22177. Vester, B. & Garrett, R. A. (1987). A plasmid-coded and site-directed mutation in Escherichia coli 23 S RNA that confers resistance to erythromycin: implications for the mechanism of action of erythromycin. Biochimie, 69, 891–900. Wower, J., Wower, I. K., Kirillov, S. V., Rosen, K. V., Hixson, S. S. & Zimmermann, R. A. (1995). Peptidyl tranferase and beyond. Biochem. Cell Biol. 73, 1041–1047.

Edited by D. E. Draper (Received 28 June 1996; received in revised form 2 August 1996; accepted 17 September 1996)