The dst2 gene essential for photomorphogenesis of Coprinopsis cinerea encodes a protein with a putative FAD-binding-4 domain

Fungal Genetics and Biology 47 (2010) 152–158

Contents lists available at ScienceDirect

Fungal Genetics and Biology journal homepage: www.elsevier.com/locate/yfgbi

The dst2 gene essential for photomorphogenesis of Coprinopsis cinerea encodes a protein with a putative FAD-binding-4 domain q Masaki Kuratani, Kanako Tanaka, Kazuhisa Terashima 1, Hajime Muraguchi 2, Takehito Nakazawa, Kiyoshi Nakahori, Takashi Kamada * Graduate School of Natural Science and Technology, Okayama University, Okayama 700-8530, Japan

a r t i c l e

i n f o

Article history: Received 28 July 2009 Accepted 13 October 2009 Available online 20 October 2009 Keywords: Blue light Coprinus cinereus Dark stipe Fruiting-body Mushroom Photoreceptor

a b s t r a c t The fruiting-body primordium of Coprinopsis cinerea exhibits remarkable photomorphogenesis. Under a 12-h light/12-h dark regime, the primordium proceeds to the fruiting-body maturation phase in which the primordium successively undergoes basidiospore formation, stipe elongation and pileus expansion, resulting in the mature fruiting-body. In continuous darkness, however, the primordium never proceeds to the maturation phase: the pileus and stipe tissues at the upper part of the primordium remain rudimentary while the basal part of the primordium elongates, producing the etiolated ‘‘dark stipe” phenotype. In our previous studies, blind mutants, which produce dark stipes under light conditions that promote fruiting-body maturation in the wild-type, have been isolated, and two genes, dst1 and dst2, responsible for the mutant phenotype have been identified. In this study we show that the dst2-1 mutant exhibits a blind phenotype during asexual spore production in addition to that in fruiting-body photomorphogenesis. We also reveal that dst2 is predicted to encode a protein with a putative flavin adenine dinucleotide (FAD)-binding-4 domain. The two blind phenotypes, together with the existence of an FADbinding domain in Dst2, suggest that Dst2 may play a role in perceiving blue light. Ó 2009 Elsevier Inc. All rights reserved.

1. Introduction Blue light is known to be an important signal for diverse organisms from all kingdoms of life, regulating their developmental and/ or physiological processes. The photoreceptors for blue light reported to date can be divided into three groups: (1) phototropintype photoreceptors, which have one or two LOV (light, oxygen, or voltage) domains for flavin–chromophore binding (for a review, see Briggs and Christie, 2002), (2) cryptochromes, which exhibit high sequence similarities to microbial DNA photolyases (for a review, see Cashmore et al., 1999), and (3) BLUFs, which have a novel, BLUF-type FAD-binding domain (for a review, see Gomelsky and Klug, 2002). In fungi, it was first established in the ascomycete Neurospora crassa that blue light is perceived by the phototropin-type photoreceptor, WC-1 (Ballario et al., 1996; Froehlich et al., 2002; He et al., q Sequence data from this article have been deposited with the DDBJ/EMBL/ GeneBank Data Libraries under accession no. AB449111. * Corresponding author. Address: Department of Biology, Faculty of Science, Okayama University, Okayama 700-8530, Japan. Fax: +81 86 251 7876. E-mail address: [email protected] (T. Kamada). 1 Present address: The Tottori Mycological Institute, 211 Kokoge, Tottori 689-1125, Japan. 2 Present address: Department of Biotechnology, Faculty of Bioresource Sciences, Akita Prefectural University, Akita 010-1195, Japan.

1087-1845/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.fgb.2009.10.006

2002) and that WC-1 interacts with WC-2 to form a heterodimeric complex in order to activate the transcription of light-regulated genes (Ballario et al., 1998; Cheng et al., 2002). WC-1 homologs have now been found in various fungal species including zygomycetes, ascomycetes and basidiomycetes (for a review, see Corrochano, 2007). In N. crassa, another blue-light photoreceptor with a LOV domain, VIVID, has been identified (Schwerdtfeger and Linden, 2003). The homobasidiomycete Coprinopsis cinerea exhibits remarkable photomorphogenesis during fruiting-body development (Tsusué, 1969; Kamada et al., 1978; Terashima et al., 2005; for reviews, see Kües, 2000; Kamada, 2002) and provides an excellent opportunity for studies of the mechanisms for sensing and responding to light. When the fruiting-body primordium is cultured under appropriate light conditions such as the 12-h light/12-h dark cycle, it proceeds to the fruiting-body maturation phase. In the maturation phase, meiosis and sporulation, stipe elongation, and pileus expansion occur successively, resulting in the mature fruiting-body. In continuous darkness, however, fruiting-body maturation is suppressed: the pileus and stipe tissues at the upper part of the primordium remain rudimentary while the basal part of the primordium elongates, producing a ‘‘dark stipe.” We have isolated several blind mutants of C. cinerea, which produce dark stipes even under light conditions that normally promote fruiting-body maturation (Muraguchi et al., 1999; Terashima et al., 2005). Genetic

153

M. Kuratani et al. / Fungal Genetics and Biology 47 (2010) 152–158 Table 1 Coprinopsis cinerea strains used in this study.

Table 2 PCR primers used in this study.

Strain

Genotype/description

Source

Primer name

Sequence

326 H1-1280 KF2#1 KF3#2 292 5005A HT12 H1-1280F1#5

Amut Bmut pab1-1 Amut Bmut pab1-1 dst2-1 A91B92 A91B91 A3B1trp1-1,1.6 A2B2 ade1-1 A5B5 trp2-1 A91B92 dst2-1/a progeny of H1-1280  KF2#1 A3B1 dst2-1 trp1-1,1-6/a progeny of 1-1280F1#5  292 A5B5 dst2-1/a progeny of H1-1280F1#5  HT12 Amut Bmut pab1-1 dst2-1/ a progeny of H1-1280F2#23  326

P.J. Pukkila M.E. Zolan This laboratory This laboratory P.J. Pukkila This laboratory M.E. Zolan This study

C49AL_1 C49AL_4 C49AR_3 C49AR_4 dst2_a1 dst-2_a2 50 -RACE 50 -nested C49_SR C49_SL

GTGGAGAGGATGAGCCAAGA ATTATTTCAGCTTCCCCTTC CCCAAATGGTTGTTACGAGAA GACTCCTCCAAACCCGCTAC CGGCTCATCCTACTGGCTCTTCGATT TTCTTGAGCAGGTTGCATGGCCTTAG CCGTCAACAAGAGGTTGGCGTACAAT GGAGCGCCTTTGACACAATCCCTAAA ATAAAGGAAACCCGGATTGG GACGAGGTCACAGGAAGGTG

H1-1280F2#8 H1-1280F2#23 H1-1280F3#6

This study This study This study

analysis of the mutants identified two genes, dst1 and dst2, mutations of which are responsible for the blind phenotype (Terashima et al., 2005). Molecular genetic analysis then revealed that the dst1 gene encodes a WC-1 homolog (Terashima et al., 2005). The dst2 gene, however, remains to be characterized at the molecular level. In the present study we first show that the dst2-1 mutant exhibits a blind phenotype in asexual spore formation in addition to that in fruiting-body photomorphogenesis. We then cloned the dst2 gene as a DNA fragment that rescues the dst2-1 mutation, revealing that the dst2 gene is predicted to encode a protein with an FADbinding-4 domain. These results suggest the possibility that the predicted Dst2 protein may work as a photoreceptor for blue light.

2. Materials and methods 2.1. Strains, culture conditions, and genetic techniques Strains of C. cinerea listed in Table 1 were used. Malt extract/ yeast extract/glucose (MY) medium (Rao and Niederpruem, 1969) solidified by 2% agar in 9-cm petri dishes was used for routine mycelial cultures and for fruiting-body primordia for RNA

extraction. Slants of MY agar medium were used for examination of fruiting phenotypes. MY medium without agar in 9-cm petri dishes was used for mycelial cultures for extraction of DNA. MY agar plates overlaid with cellophane in 9-cm petri dishes were used for mycelial cultures for RNA extraction. MY medium was supplemented with 100 mg/l tryptophan for tryptophan-requiring strains. The minimal medium was that of Shahriari and Casselton (1974) modified by Binninger et al. (1987). Cultures were maintained at 28 °C under a 12-h light/12-h dark regime unless otherwise stated. Crosses and isolation of basidiospore germlings were performed as described previously (Inada et al., 2001). 2.2. Chromosome V-specific cosmid library screening, dst2 gene cloning, and sequencing An existing cosmid library of chromosome V from the wild-type strain Okayama-7 (Murata et al., 1998) was screened. The vector (LLC5200) contains the trp1 gene of C. cinerea as a selectable marker (Pukkila and Casselton, 1991). Groups of 12 cosmid clones were cultured on a plate of Luria broth/ampicillin solid medium, mixed, and subjected to standard purification. Pooled DNAs were used to transform strain H1-1280F2#8 (A3B1 dst2-1 trp1-1, 1-6) as described by Binninger et al. (1987). Transformants were cultured on minimal medium to purify the transformed mycelium, and then mated with H1-1280F2#23 (A5B5 dst2-1). The resulting dikaryons were cultured on MY slant medium in order to test for fruiting

Fig. 1. Photographs showing young fruiting bodies from the wild-type strain, 326 (Amut Bmut pab1-1) (A), dark stipes from the dst2-1 mutant strain H1-1280F3#6 (Amut Bmut pab1-1 dst2-1) (B), fruiting-body primordia from a dikaryon produced by crossing strains 326 (Amut Bmut pab1-1) and KF3#2 (A91B91 +) (C), fruiting-body primordia from a dikaryon between strain H1-1280 F3#6 (Amut Bmut pab1-1 dst2-1) and KF3#2 (A91B91 + +) (D), and fruiting-body primordia from a dikaryon between a transformant of H11280F2#8 (A3B1 dst2-1 trp1-1,1-6), in which cosmid clone 5F8 was introduced, and H1-1280F2#23 (A5B5 dst2-2) (E). All the cultures were incubated under a 12-h light/12-h dark regime at 28 °C. Scale bar: 1 cm.

M. Kuratani et al. / Fungal Genetics and Biology 47 (2010) 152–158

Marker KF3#2 H1-1280

154

Photomorphogenesis bp 2000 ClaI RFLP 500

F1 progeny

W D D D D D D D D D D D W W W W W WW W WW

Fig. 2. Cosegregation between RFLP of the 2.8-kb region in the dst2 gene (see Fig. 3A) and the dark-stipe phenotype in F1 progeny from the cross H1-1280  KF3#2. The progeny were first scored for the fruiting phenotype and then a selection of the dark stipe mutant and wild-type progeny were scored for RFLP after ClaI digestion of the 2.8kb region. The progeny were crossed to H1-1280F2#23 in order to examine the fruiting phenotype.

A

1 kb

5’ -RACE 5’ -nested RACE

dst2_a1 dst2_a2 f-1

Northern probe RFLP

C49_SR

B

C49_SL

FAD-binding-4 N-terminal part

C-terminal part

Fig. 3. (A) Structure of the dst2 gene. The thick lines, open boxes and solid boxes indicate the regions transcribed, a deduced ORF, and the introns, respectively. The primers for 50 - and 30 -RACE experiments, the Northern probe, and RFLP are indicated by horizontal half-arrows. (B) Predicted structure of the Dst2 protein. The vertical arrow indicates the site of the dst2-1 mutation truncating the C-terminal region.

phenotypes. The mutation was partially rescued in eight of 46 trp+ transformants by a single pool of DNA, 5F. Subsequent sib-selection revealed that a single cosmid clone, 5F8, has the rescuing activity: the mutation was partially rescued in 18 of 52 trp+ transformants. Genomic regions containing the gene CC1G_06825, predicted by the Broad Institute (http://www.broadinstitute.org/annotation/genome/coprinus_cinereus/MultiHome.html), were amplified by PrimeSTAR GXL (Takara Bio Inc., Shiga, Japan) and used to cotransform H1-1280F2#8 (A3B1 dst2-1 trp1-1,1-6) with plasmid pCc1003 carrying the C. cinerea trp1 gene (Skrzynia et al., 1989): the amplified product and pCc1003 was mixed in the ratio 2:1 (w/w). Each trp+ transformant was tested for the fruiting phenotype after mating with H1-1280F2#23 (A5B5 dst2-1). The predicted gene, CC1G_06825, in the parental wild-type strain, 326, as well as in the mutant strain, H1-1280, were sequenced from both ends. 2.3. 50 and 30 RACE experiments dst2 cDNA was amplified using an existing cDNA library as a template, which was synthesized with the Marathon cDNA amplification kit (Clontech, Palo Alto, CA) by Muraguchi and Kamada (1998). The gene-specific primers for the 50 and 30 RACE experi-

ments are listed in Table 2 and their sites in the dst2 gene are shown in Fig. 3A. PCR was performed with an Advantage cDNA PCR Kit (Clontech), and the amplified products were cloned into a pCR 2.1 vector with the TA cloning kit (Invitrogen, Carlsbad, CA) and sequenced. 2.4. Northern analysis Total RNAs were prepared from vegetative mycelia, fruitingbody primordia and dark stipes. For vegetative mycelia, small pieces of mycelium were inoculated at four places on an MY agar plate overlaid with cellophane and incubated for 3 d. For fruiting-body primordia and dark stipes, four small pieces of mycelium were inoculated at four places on an MY agar plate and pre-incubated for 9 d under a 12-h light/12-h dark regime to produce hyphal knots. Cultures were then incubated for 2 d under continuous light to produce fruiting-body primordia of about 5 mm–1 cm in height or in continuous darkness to produce dark stipes. Harvested samples were immediately frozen in liquid nitrogen and ground into fine powder with a mortar and pestle. RNA was extracted from the powder using RNAiso (Takara Bio Inc.). About 15 lg of total RNA was fractionated by electrophoresis in 1.3% agarose formaldehyde gel, transferred to a Hybond-N+ membrane (Amersham, Arlington Heights, IL) according to Sambrook

M. Kuratani et al. / Fungal Genetics and Biology 47 (2010) 152–158

et al. (1989), and then fixed by UV crosslinking (Stratagene, La Jolla, CA). A part (1688 bp) of the dst2 ORF was amplified using cosmid clone 5F8 as a template and a pair of primers, f-1 and c-2 (see Table 2; Fig. 3A), labeled using the Gene Images system (Amersham) and used as the probe. 2.5. DNA isolations Cosmid and plasmid DNAs were isolated with the Plasmid Miniprep kit (Bio-Rad, Hercules, CA). Genomic DNA from C. cinerea was prepared as described by Zolan and Pukkila (1986). 2.6. Measurement of oidia number A small piece of mycelium was inoculated at one place on an MY agar plate and incubated for 10 d under a 12-h light/12-h dark regime or in continuous darkness. Oidia produced were harvested in water and the number of oidia in the suspension was quantified as described by Inada et al. (2001). 3. Results 3.1. Phenotypic analysis We carried out phenotypic analysis of strain H1-1280 (Amut Bmut pab1-1 dst2-1), one of the three dst2 mutants identified previously (Terashima et al., 2005). Strain H1-1280 was isolated from strain 326 (Amut Bmut pab1-1) after restriction enzyme-mediated integration (REMI) mutagenesis (Cummings et al., 1999): strain 326 carries mutations in both A and B mating type loci and produces a fertile dikaryon-like mycelium without the need of mating. Strain H1-1280 produced dark stipes, which never developed into mature fruiting bodies even after prolonged cultivation for a month under the conditions that promote fruiting-body maturation in the wild-type. This mutant strain, however, lost the ability to produce dark stipes during storage. Therefore, we crossed H11280F2#23 (A5B5 dst2-1) with the parental wild-type strain, 326 (Amut Bmut pab1-1), to isolate an F3 dst2-1 mutant strain with the Amut Bmut background, which we named H1-1280F3#6 (Amut Bmut pab1-1 dst2-1). Strain H1-1280F3#6 exhibited the same darkstipe phenotype as that of the original dst2-1 mutant, H1-1280 (Fig. 1B). Thus, we used strain H1-1280F3#6 for the examination of the effect of the dst2-1 mutation on asexual spore (oidium) production and for the dominance test of the mutation described below. It is known that light promotes oidium production in C. cinerea strains such as strain 326 in which both the A and B pathways are switched on (Kües et al., 2002). Therefore, we examined if the dst21 mutation affects the promotion of oidium production by light. We found that in strain 326 oidium production was 62 times greater under light than in darkness, whereas in the mutant strain, H1-1280F3#6, it was not affected by light conditions (Table 3). These results indicate that strain H1-1280F3#6 is blind in asexual oidium production as well as in sexual fruiting-body photomorphogenesis, suggesting that the two developmental processes Table 3 Effect of the dst2-1 mutation on production of oidia. Strain

326 (Amut Bmut pab1-1) H1-1280F3#6 (Amut Bmut pab1-1 dst2-1) a

Values are means of three measurements.

No. oidia (106/plate)a 12-h light/12-h dark

Continuous darkness

117.8 1.2

1.9 1.3

155

share a presumptive light-signal perception/transduction pathway in which the dst2 gene is involved. 3.2. Genetic analysis A dikaryon heterozygous for dst2, which was produced by a cross between strain H1-1280F3#6 (Amut Bmut pab1-1 dst2-1) and KF3#2 (A91B91), formed slender fruiting-body primordia with smaller top parts and slenderer basal part than those from a cross between the wild-type strain, 326 (Amut Bmut pab1-1 +), and KF3#2 (Fig. 1C and D). The primordia from the dikaryon heterozygous for dst2 proceeded into the fruiting-body maturation phase after prolonged cultivation for 15–30 days. These results indicate that the dst2-1 mutation is semi-dominant. As described above, strain H1-1280 was obtained by REMI mutagenesis, in which transformed plasmids are integrated in the fungal chromosomes to disrupt genes (for a review, see Riggle and Kumamoto, 1998). If the dst2 gene in strain H1-1280 were tagged by the plasmid used for REMI, it would be possible to clone the dst2 gene by using a selectable marker in the plasmid. However, analysis of progeny from a cross between H1-1280 and a wild-type homokaryon indicated that the dst2 mutation was not tagged (data not shown). Therefore, we chose to first map the dst2 gene to a chromosome and then screen a cosmid library from the chromosome for a clone that complements the mutation. Analysis of the progeny from a cross between H1-1280F1#5 and 5005A (A2B2 ade1-1) showed that dst2 is linked to ade1, an auxotrophic marker on chromosome V (Takemaru, 1982), at a map distance of 16.7% (5/30). It was also found that dst2 is linked to trp2, another auxotrophic marker on chromosome V (Pukkila, 1992), at a map distance of 5.9% (4/68) by F1 analysis of a cross between H1-1280F1#5 and HT12 (A5B5 trp2-1). These results indicated that dst2 was located on chromosome V. In the genetic linkage analyses described above, the wild-type progeny and the dst2-1 mutant progeny occurred at a 1:1 ratio (49 wild-type:49 mutants). This finding indicates that the dark-stipe phenotype in strain H1-1280 was caused by mutation in a single gene. 3.3. Cloning of dst2 gene On the basis of the above results indicating that dst2 is located on chromosome V, we screened a cosmid library of chromosome V for a clone that rescues the dst2 mutation and found that clone 5F8 has the activity of rescuing the dst2-1 mutation. The rescue was, however, partial: in fruiting-body primordia from the transformants in which the dst2-1 mutation were regarded as rescued, the elongation of their lower parts was suppressed, as compared with those from dst2-1 mutant strains, and their upper parts developed close to a stage just before entering the fruiting-body maturation phase (Fig. 1E). However, none of the primordia from the transformants proceeded to the maturation phase even after a prolonged, month-long culture. We sequenced both ends of the 31.3-kb insert in cosmid clone 5F8, and found that the insert is from supercontig3:10,818– 42,159 in the Coprinus cinereus database at the Broad Institute. Annotations on the C. cinereus genome predict that this genomic region contains 11 genes. The 11 genes do not include a wc-1 or wc-2 homolog. However, one of the 11 genes (CC1G_06825) is predicted to encode a protein with an FAD-binding domain, suggesting the possibility that this gene might be the dst2 gene because FAD can work as a chromophore absorbing blue light. To examine this possibility, we amplified the genomic region (supercontig3:2,290,791–2,295,495) that covers the whole length of CC1G_06825 and used the amplified product to co-transform strain H1-1280F2#8 with pCc1003 carrying the C. cinerea trp1 gene. We tested trp+ transformants obtained for the fruiting phenotype after

156

M. Kuratani et al. / Fungal Genetics and Biology 47 (2010) 152–158

crossing with H1-1280F1#23 and found that the dst2-1 mutation was partially rescued in 16 of 102 trp+ transformants tested; of the remaining 86, 52 were not rescued and 34 were not determined for the fruiting phenotype because they failed to continue development to form fruiting-body primordia after hyphal knot formation. As a negative control, we transformed H1-1280F2#8 with plasmid pCc1003 only and found that the mutation was not rescued in any of the 77 trp+ transformants tested: 54 exhibited the dark-stipe phenotype and the remaining 23 were not determined for the fruiting phenotype because of the failure of development. To determine if the predicted gene, CC1G_06825, represents the dst2 locus, we scored 20 progeny from a cross between H1-1280 and KF3#2 for RFLP of a 2.8-kb fragment in the predicted gene (see Fig. 3) and the fruiting phenotype. We found that the RFLP and fruiting phenotype completely co-segregated in the progeny (Fig. 2), strongly suggesting that the predicted gene represents the dst2 locus. With the small number of progeny analyzed, however, the possibility could not be ruled out that the predicted gene is not dst2 itself but closely linked to it. 3.4. Identification of dst2 ORF 0

0

5 -RACE and 3 -RACE experiments, together with sequencing of genomic and complementary DNAs of the parental wild-type strain, 326, identified an ORF, which is interrupted by nine introns and predicted to encode a protein of 723 amino acids (Fig. 3). The size of the introns ranged from 49 to 68 nt. The 50 splice sites agree with the consensus sequence GTRNGT found for filamentous fungi and the 30 splice sites with the consensus sequence YAG (Gurr et al., 1987), except that the first, second, fourth, seventh and eighth 50 splice sites are GTATGG, GTATGG, GTCTGT, GTAAGA, GTCAGT, respectively, and the fifth 30 splice site is AAG. The dst2 mRNA is predicted to have a 27-nt 50 - and a 229-nt 30 -untranslated region. 3.5. Predicted Dst2 protein has a split FAD-binding-4 and a berberin or berberin-like domain Pfam motif-finding software (Finn et al., 2008) indicated that Dst2 contains an FAD-binding-4 domain, which is split into two parts, aa 47–aa 104 and aa 382–aa 414 (Fig. 3B). The E-value of one part (aa 47–aa 104) was 1.4e-9 and that of the other part (aa 382–aa 414) 2.5e-8. When compared with the best characterized FAD-binding-4 domain of vanillyl-alcohol oxidase (VAO) from Penicillium simplicissimus, which is not split but located in one region (aa 71–aa 213) in the VAO peptide (Benen et al., 1998; Fraaije et al., 2000), one part (aa 47–aa 104) corresponds to aa 71–aa 117 in the domain of VAO, and the other part (aa 382–aa 414) to aa 183–aa 213. Pfam analysis also indicated that Dst2 contains a berberin or berberin-like (BBE) domain (E-value = 3.7e-6) in the C-terminal region (Fig. 3). This domain is found in the berberine bridge or berberine bridge-like enzymes, which catalyze the transformation of the N-methyl group of (S)-reticuline in the C-8 berberine bridge carbon of (S) scoulerine (Rink and Böhm, 1975). A blast search on the C. cinereus database at the Broad Institute revealed that the C. cinereus genome has 18 predicted proteins that exhibit similarities (E-value = < 1e-4) to Dst2 and contain both FAD-binding-4 and BBE domains. However, all 18 proteins are different from Dst2 in that their FAD-binding-4 domains are not split. A blast search at the National Center for Biotechnology Information (NCBI) (http://www/ncbi.nlm.nih.gov/) revealed that some basidiomycetous fungi including a heterobasidiomycete have proteins (putative) that exhibit high similarity to Dst2 and contain a split FAD-binding-4 and a BBE domain: they were a Laccaria bicolor predicted protein (accession No. XP-001889819) (score = 905,

1

2

3

dst2

26S rRNA

Fig. 4. Expression of the wild-type dst2 gene. For each lane, 15 lg of total RNAs from the following were electrophoresed in 1.3% agarose formaldehyde gel: vegetative mycelium cultured for 3 d (lane 1), fruiting primordia cultured for 2 d under continuous light after pre-incubation for 9 d under the cycle of 12-h light/12h dark for hyphal knots production (lane 2) and fruiting primordia (dark stipe) cultured for 2 d in continuous darkness after pre-incubation for 9 d under the 12-h light/12-h dark cycle for hyphal knot production (lane 3). After the ribosomal RNA was visualized under UV, the gel was blotted and hybridized. The probe was the PCR product that covers almost the whole length of the dst2 ORF (see Fig. 3A).

E-value = 0.0, identities = 65%), a Postia placenta hypothetical protein (accession No. EED82635) (score = 655, E-value = 0.0, identities = 46%), Ustilago maydis hypothetical protein UM04464.1 (score = 344, E-value = 8e-97, identities = 42%). It was noted that the heterobasidiomycete Cryptococcus neoformans does not have a protein that contains a split FAD-binding-4 domain. Ascomycetous fungi such as N. crassa and Aspergillus nidulans and zygomycetous fungi such as Phycomyces blakesleeanus and Rhizopus oryzae do not have such a protein, either. These suggest that Dst2 is a protein conserved in only some basidiomycetous fungi. 3.6. dst2-1 mutant allele We performed PCR amplification of the genomic DNA of the dst2-1 mutant strain, H1-1280, using primers that were designed on the basis of the parental wild-type dst2 sequence and sequenced the PCR products directly. Comparison of the dst2-1 mutant allele and the wild-type dst2 gene indicated that the mutant allele has a one-nucleotide substitution (A to T), which yields a stop codon (TAG) at 2028–2030 bp downstream from the translational start site, truncating the C-terminal 47 amino acids. 3.7. Developmental regulation of dst2 transcription Total RNAs from vegetative mycelium, fruiting-body primordia produced under continuous light and dark stipes were subjected to Northern analysis for examination of dst2 transcription. As expected from cDNA analysis, we identified a transcript of 2.4 kb in vegetative mycelium, fruiting-body primordia and dark stipes (Fig. 4). The level of dst2 transcription was higher in fruiting-body primordia and in dark stipes than in vegetative mycelium. There was no difference between the transcription levels of the primordia and dark stipes. This developmental control of dst2 transcription is similar to that of dst1 transcription (Terashima et al., 2005). 4. Discussion The parental wild-type of C. cinerea used in this study, strain 326 (Amut Bmut pab1-1), exhibits two light-regulated developmental processes. One is photomorphogenesis during sexual, fruitingbody development. The other is asexual, oidium production: in this strain, in which both A- and B-regulated developmental pathways are switched on, oidium production is induced by light. In the present study, we found that the dst2-1 mutation of C. cinerea caused

M. Kuratani et al. / Fungal Genetics and Biology 47 (2010) 152–158

blind phenotypes in both of the developmental processes. We then revealed that the dst2 gene is predicted to encode a protein containing a putative FAD-binding-4 and a BBE domain. Because FAD (flavin adenine dinucleotide) can work as a chromophore absorbing blue light, this finding, together with the blind phenotype of the dst2-1 mutation, suggest the possibility that the Dst2 protein might be a photoreceptor for blue light. If Dst2 is a photoreceptor, it is a novel one because the putative FAD-binding domain (FADbinding-4) is different from any of the FAD-binding domains of known blue-light photoreceptors. At present, however, the possibility cannot be excluded that Dst2 functions as an enzyme working in the presumptive pathway for blue-light perception, because the family of proteins with the FAD-binding-4 domain (pfam 01565) consists of various enzymes that use FAD as a cofactor and most of the enzymes are similar to oxygen oxidoreductase. A future challenge will be isolation and biochemical analysis of the Dst2 protein. Our previous studies have shown that C. cinerea has a putative photoreceptor for blue light, Dst1, the product of the dst1 gene (Terashima et al., 2005). Dst1 is a homolog of WC-1, a photoreceptor for blue light in N. crassa (Ballario et al., 1996; Froehlich et al., 2002; He et al., 2002). Therefore, if Dst2 is a photoreceptor for blue light, it is the second one in this fungus. This notion is consistent with the fact that although a general role for the WC-1/WC-2 complex is suggested as a fungal receptor for blue light (Idnurm and Heitman, 2005; for a review, see Corrochano, 2007), there is evidence suggesting additional blue-light photoreceptors in fungi: it has been reported in N. crassa that light responses are observed in wc-1 and wc-2 mutants (Dragovic et al., 2002). There are also hints of other blue-light photoreceptors than wc homologues in another ascomycete, Trichoderma atroviride (Casas-Flores et al., 2004; Rosales-Saavedra et al., 2006). A mutation in either the dst1 or dst2 gene causes the blind phenotype (Terashima et al., 2005). This fact suggests that Dst1 and Dst2 work in the same pathway for blue-light perception. This notion is supported by the fact that dst1/dst2 double mutant strains (Amut Bmut pab1-1 dst1-1 dst2-1) display the same blind phenotype as the dst2-1 mutant (data not shown). It remains to be elucidated, however, whether Dst1 and Dst2 work individually at different steps or both form a complex to work at the same step in the presumptive pathway. The dst2-1 mutation exhibited semi-dominance. This was reflected in the results of transformation experiments for cloning dst2: the ectopic wild-type dst2 gene rescued the dst2-1 mutation only partially. It may be that the mutant Dst2, in which the C-terminal 47 amino acid sequence is predicted to be truncated, competes with the wild-type Dst2 for a presumptive target(s) or that Dst2 forms a multisubunit complex and the mutant Dst2 causes a semi-dominant negative effect in the complex. There is also the possibility that the dst2-1 mutant strain may carry a second mutation that suppresses normal fruiting-body development. It has been established in N. crassa that WC-1 interacts with WC-2 to form a heterodimeric complex in order to activate transcription of downstream light-regulated genes, and mutation in either wc-1 or wc-2 results in blind phenotypes (for a review, see Corrochano, 2007). Recently, the interaction between WC-1 and WC-2 homologues was also demonstrated in the homobasidiomycete Lentinula edodes (Sano et al., 2009) and the zygomycete P. blakesleeanus (Sanz et al., 2009), suggesting that collaboration between WC-1 and WC-2 in perception of blue light is widespread in fungi. Our previous genetic studies on five C cinerea blind mutants exhibiting the dark-stipe phenotype have identified the two genes, dst1 and dst2, mutations of which are responsible for the phenotype (Terashima et al., 2005). dst1 was shown to encode a WC-1 homolog in a previous study (Terashima et al., 2005), while dst2 has been revealed to encode a protein with a FAD-binding-4

157

domain in the present study. Thus, none of the five blind mutants result from mutations in the wc-2 homolog. However, a blast search on the C. cinereus database at the Broad Institute using the wc-2 homolog of another basidiomycetous mushroom, L. edodes (Sano et al., 2009) followed by cDNA analysis shows that the C. cinerea genome has a wc-2 homolog (data not shown). It may be that mutations in the C. cinerea wc-2 homolog do not cause the dark-stipe phenotype. A future challenge will be silencing and/ or disrupting the wc-2 homolog and examining the phenotype of wc-2 mutants. Acknowledgments We thank Miriam E. Zolan of Indiana University for her kind gift of strains H1-1280 and HT12. References Ballario, P., Vittorioso, P., Magrelli, A., Talora, C., Cabibbo, A., Macino, G., 1996. White collar-1, a central regulator of blue light responses in Neurospora, is a zinc finger protein. EMBO J. 15, 1650–1657. Ballario, P., Talora, C., Galli, D., Linden, H., Macino, G., 1998. Roles in dimerization and blue light photoresponse of the PAS and LOV domains of Neurospora crassa white collar proteins. Mol. Microbiol. 29, 719–729. Benen, J.A.E., Sánchez-Torres, P., Wagemaker, M.J.M., Fraaije, M.W., van Berkel, W.J.H., Visser, J., 1998. Molecular cloning, sequencing, and heterologous expression of the vaoA gene from Penicillium simplicissimum CBS 170.90 encoding vanillyl-alcohol oxidase. J. Biol. Chem. 273, 7865–7872. Binninger, D.M., Skrzynia, C., Pukkila, P.J., Casselton, L.A., 1987. DNA-mediated transformation of the basidiomycete Coprinus cinereus. EMBO J. 6, 835–840. Briggs, W.R., Christie, J.M., 2002. Phototropins 1 and 2: versatile plant blue-light receptors. Trends Plant Sci. 7, 204–210. Casas-Flores, S., Rios-Momberg, M., Bibbins, M., Ponce-Noyola, P., Herrela-Estrella, A., 2004. BLR-1 and BLR-2, key regulatory elements of photoconidiation and mycelial growth in Trichoderma atroviride. Microbiology 150, 3561–3569. Cashmore, A.R., Jarillo, J.A., Wu, Y.J., Liu, D., 1999. Cryptochromes: blue light receptors for plants and animals. Science 284, 760–765. Cheng, P., Yang, Y., Gardner, K.H., Liu, Y., 2002. PAS domain-mediated WC-1/WC-2 interaction is essential for maintaining the steady-state level of WC-1 and the function of both proteins in circadian clock and light responses of Neurospora. J. Biol. Chem. 22, 517–524. Corrochano, L.M., 2007. Fungal photoreceptors: sensory molecules for fungal development and behaviour. Photochem. Photobiol. Sci. 6, 725–736. Cummings, W.J., Celerin, M., Crodian, J., Brunic, L.K., Zolan, M.E., 1999. Insertional mutagenesis in Coprinus cinereus: use of a dominant selectable marker to generate tagged, sporulation-defective mutants. Curr. Genet. 36, 371–382. Dragovic, Z., Tan, Y., Görl, M., Roenneberg, T., Merrow, M., 2002. Light reception and circadian behavior in ‘blind’ and ‘clock-less’ mutants of Neurospora crassa. EMBO J. 21, 3643–3651. Finn, R.D., Tate, J., Mistry, J., Coggill, P.C., Sammut, J.S., Hotz, H.R., Ceric, G., Forslund, K., Eddy, S.R., Sonnhammer, E.L., Bateman, A., 2008. The Pfam protein families database. Nucleic Acids Res. Database Issue 36, D281–D288. Fraaije, M.W., van den Heuvel, R.H.H., van Berkel, W.J.H., Mattevi, A., 2000. Structural analysis of flavinylation in vanillyl-alcohol oxidase. J. Biol. Chem. 275, 38654–38658. Froehlich, A.C., Liu, Y., Loros, J.J., Dunlap, J.C., 2002. White Collar-1, a circadian blue light photoreceptor, binding to the frequency promoter. Science 297, 815–819. Gomelsky, M., Klug, G., 2002. BLUF: a novel FAD-binding domain involved in sensory transduction in microorganisms. Trends Biochem. Sci. 27, 497–500. Gurr, S.J., Unkles, S.E., Kinghorn, J.R., 1987. The structure and organization of nuclear genes of filamentous fungi. In: Kinghorn, J.R. (Ed.), Gene Structure in Eukaryotic Microbes. IRL Press, London, pp. 93–139. He, Q., Cheng, P., Yang, Y., Wang, L., Gardner, K.H., Liu, Y., 2002. White collar-1, a DNA binding transcription factor and a light sensor. Science 297, 840–843. Idnurm, A., Heitman, J., 2005. Light controls growth and development via a conserved pathway in the fungal kingdom. PloS Biol. 3, e95. Inada, K., Morimoto, Y., Arima, T., Murata, Y., Kamada, T., 2001. The clp1 gene of the mushroom Coprinus cinereus is essential for A-regulated sexual development. Genetics 157, 133–140. Kamada, T., 2002. Molecular genetics of sexual development in the mushroom Coprinus cinereus. BioEssays 24, 449–459. Kamada, T., Kurita, R., Takemaru, T., 1978. Effects of light on basidiocarp maturation in Coprinus macrorhizus. Plant Cell Physiol. 19, 263–275. Kües, U., 2000. Life history and developmental processes in the basidiomycete Coprinus cinereus. Microbiol. Mol. Biol. Rev. 64, 316–353. Kües, U., Walser, P.J., Klaus, M.J., Aebi, M., 2002. Influence of activated A and B mating-type pathways on developmental processes in the basidiomycete Coprinus cinereus. Mol. Genet. Genomics 268, 262–271. Muraguchi, H., Kamada, T., 1998. The ich1 gene of the mushroom Coprinus cinereus is essential for pileus formation in fruiting. Development 125, 3133–3141.

158

M. Kuratani et al. / Fungal Genetics and Biology 47 (2010) 152–158

Muraguchi, H., Takemaru, T., Kamada, T., 1999. Isolation and characterization of developmental variants in fruiting using a homokaryotic fruiting strain of Coprinus cinereus. Mycoscience 40, 227–233. Murata, Y., Fujii, M., Zolan, M.E., Kamada, T., 1998. Molecular analysis of pcc1, a gene that leads to A-regulated sexual morphogenesis in Coprinus cinereus. Genetics 149, 1753–1761. Pukkila, P.J., 1992. Methods of genetic manipulation in Coprinus cinereus. In: Chang, S.T., Buswell, J.A., Miles, P.G. (Eds.), Culture Collection and Breeding of Edible Mushrooms. Gordon & Breach, Philadelphia, pp. 239–264. Pukkila, P.J., Casselton, L.A., 1991. Molecular genetics of the agaric Coprinus cinereus. In: Bennett, J.W., Lasure, L.L. (Eds.), More Gene Manipulation in Fungi. Academic Press, San Diego, pp. 126–150. Rao, P.S., Niederpruem, D.J., 1969. Carbohydrate metabolism during morphogenesis of Coprinus lagopus (sensu Buller). J. Bacteriol. 100, 1222– 1228. Riggle, P.J., Kumamoto, C.A., 1998. Genetic analysis in fungi using restriction enzyme-mediated integration. Curr. Opin. Microbiol. 1, 395–399. Rink, E., Böhm, H., 1975. Conversion of reticuline into scoulerine by a cell free preparation from Macleaya microcarpa cell suspension cultures. FEBS Lett. 49, 396–399. Rosales-Saavedra, T., Esquivel-Naranjo, E.U., Casas-Flores, S., Martínez-Hernández, P., Ibarra-Laclette, E., Cortes-Penagos, C., Herrela-Estrella, A., 2006. Novel lightregulated genes in Trichoderma astroviride: a dissection by cDNA microarrays. Mirobiology 152, 3305–3317. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Sano, H., Kaneko, S., Sakamoto, Y., Sato, T., Shishido, K., 2009. The basidiomycetous mushroom Lentinula edodes white collar-2 homolog PHRB, a partner of putative blue-light photoreceptor PHRA, binds to a specific site in the promoter region of the L. Edodes tyrosinase gene. Fungal Genet. Biol. 46, 333–341. Sanz, C., Rodríguez-Romero, J., Idnurm, A., Christie, J.M., Heitman, J., Corrochano, L.M., Eslava, A.P., 2009. Phycomyces MADB interacts with MADA to form the primary photoreceptor complex for fungal phototropism. Proc. Natl. Acad. Sci. USA 106, 7095–7100. Schwerdtfeger, C., Linden, H., 2003. VIVID is a flavoprotein and serves as a fungal blue light photoreceptor for photoadaptation. EMBO J. 22, 4846–4855. Shahriari, H., Casselton, L.A., 1974. Suppression of methionine mutants in Coprinus. I. Complementation and allele specificity as criteria of suppressor gene action. Mol. Gen. Genet. 134, 85–92. Skrzynia, C., Binninger, D.M., Alspaugh II., J.A., Pukkila, P.J., 1989. Molecular characterization of TRP1, a gene coding for tryptophan synthetase in the basidiomycete Coprinus cinereus. Gene 81, 73–82. Takemaru, T., 1982. Genetic map of Coprinus macrorhizus. In: Ishikawa, T. (Ed.), Experimental Methods in Microbial Genetics. Kyoritsu Publishing, Tokyo, pp. 355–356. Terashima, K., Yuki, K., Muraguchi, H., Akiyama, M., Kamada, T., 2005. The dst1 gene involved in mushroom photomorphogenesis of Coprinus cinereus encodes a putative photoreceptor for blue light. Genetics 171, 101–108. Tsusué, Y.M., 1969. Experimental control of fruit-body formation in Coprinus macrorhizus. Dev. Growth Differ. 11, 164–178. Zolan, M.E., Pukkila, P.J., 1986. Inheritance of DNA methylation in Coprinus cinereus. Mol. Cell. Biol. 6, 195–200.