The early stages of the immune response of the European abalone Haliotis tuberculata to a Vibrio harveyi infection

ARTICLE IN PRESS Developmental and Comparative Immunology ■■ (2015) ■■–■■

Contents lists available at ScienceDirect

Developmental and Comparative Immunology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / d c i

The early stages of the immune response of the European abalone Haliotis tuberculata to a Vibrio harveyi infection Marion Cardinaud a,*, Nolwenn M. Dheilly b, Sylvain Huchette c, Dario Moraga a, Christine Paillard a,** a UMR 6539-LEMAR (Laboratoire des Sciences de l’Environnement Marin), IUEM (Institut Universitaire Européen de la Mer), Université de Bretagne Occidentale (UBO), CNRS, IRD, Ifremer, Technopôle Brest Iroise, 29280 Plouzané, France b School of Marine and Atmospheric Sciences, Stonybrook University, Stony Brook, NY 11794-5000 USA c France Haliotis, Kerazan, Lilia, 29880 Plouguerneau, France

A R T I C L E

I N F O

Article history: Received 14 November 2014 Revised 25 February 2015 Accepted 26 February 2015 Available online Keywords: Abalone immune response Gene expression Pathogen quantification Flow cytometry Vibrio harveyi

A B S T R A C T

Vibrio harveyi is a marine bacterial pathogen responsible for episodic abalone mortalities in France, Japan and Australia. In the European abalone, V. harveyi invades the circulatory system in a few hours after exposure and is lethal after 2 days of infection. In this study, we investigated the responses of European abalone immune cells over the first 24 h of infection. Results revealed an initial induction of immune gene expression including Rel/NF-kB, Mpeg and Clathrin. It is rapidly followed by a significant immunosuppression characterized by reduced cellular hemocyte parameters, immune response gene expressions and enzymatic activities. Interestingly, Ferritin was overexpressed after 24 h of infection suggesting that abalone attempt to counter V. harveyi infection using soluble effectors. Immune function alteration was positively correlated with V. harveyi concentration. This study provides the evidence that V. harveyi has a hemolytic activity and an immuno-suppressive effect in the European abalone. © 2015 Elsevier Ltd. All rights reserved.

1. Introduction Vibriosis is the most common disease caused by pathogenic bacteria in halophilic environment and affects a large panel of organisms such as humans, fishes and marine invertebrates. In humans, vibriosis is usually associated with an exposure or absorption of contaminated water or with a zoonosis process, and the regular symptoms are gastroenteritis, tissue lesions and septicemia (Austin, 2010). In marine organisms, several pathogenic Vibrio species are responsible for serious losses in natural populations or in aquaculture stocks. Vibrio pathogens have various virulence strategies in marine invertebrates and may invade their hosts through different ways and at different stages of the life cycle. It has been notably described that Vibrio parahaemolyticus and Vibrio harveyi target, respectively, the digestive tractus of the neritid gastropod Clithon

* Corresponding author. UMR 6539-LEMAR (Laboratoire des Sciences de l’Environnement Marin), IUEM (Institut Universitaire Européen de la Mer), Université de Bretagne Occidentale (UBO), CNRS, IRD, Ifremer, Technopôle Brest Iroise, 29280 Plouzané, France. Tel.: + 33 6 71 13 80 77; fax: +33 2 98 49 86 45. E-mail address: [email protected] (M. Cardinaud). ** Corresponding author. UMR 6539-LEMAR (Laboratoire des Sciences de l’Environnement Marin), IUEM (Institut Universitaire Européen de la Mer), Université de Bretagne Occidentale (UBO), CNRS, IRD, Ifremer, Technopôle Brest Iroise, 29280 Plouzané, France. Tel.: + 33 2 98 45 86 50; fax: +33 2 98 49 86 45. E-mail address: [email protected] (C. Paillard).

retropictus and the cultured juveniles of the shrimp Penaeus monodon or larvae of the lobster Jasus verreauxi (Diggles et al., 2000; Kumazawa and Mine, 2001; Leaño et al., 1998). Vibrio pathogens may also generate epidermal ulcerations and hemocytic inflammation, causing the necrosis of diverse tissues, as observed in cultured oyster Crassostrea gigas infected by Vibrio splendidus (Sugumar et al., 1998), in cultured cuttlefishes from the genus Sepia infected by Vibrio alginolyticus (Sangster and Smolowitz, 2003), in the wild octopus Octopus vulgaris infected by Vibrio lentus (Farto et al., 2003), and in cultured post-larvae of the penaeid shrimp P. monodon infected by V. harveyi (Soonthornchai et al., 2010). Moreover, they may induce a repression effect on immune function via an alteration of cellular capacities or molecular effector synthesis, as described in the Manila clam Ruditapes philippinarum infected by Vibrio tapetis, and in the shrimp Litopenaeus vannamei following a V. alginolyticus injection (Allam and Ford, 2006; Allam et al., 2006; Brulle et al., 2012; Li et al., 2008). Interestingly, a significant immunosuppression, including the downexpression of antimicrobial synthesis, has also been observed in the coral Pocillopora damicornis infected by Vibrio coralliilyticus (Vidal-Dupiol et al., 2014) . The European abalone hemolymph is constituted for a high majority by a single differentiated cell population, assimilated to hyalinocyte-type cells, which present remarkable adhesion and aggregation capacities – 56% of the cells adhere within 15 min to the substratum, and assume immune function (Travers et al., 2008b). The remaining circulating cells are undifferentiated blast cells.

http://dx.doi.org/10.1016/j.dci.2015.02.019 0145-305X/© 2015 Elsevier Ltd. All rights reserved.

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the European abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

ARTICLE IN PRESS M. Cardinaud et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

2

Hyalinocytes assume abalone immunity through the phagocytosis of foreign particles and the synthetization of a panel of soluble effectors (Hooper et al., 2007; Travers et al., 2008b). Abalone immune responses are initiated by protein-mediated recognition of nonself molecules (Nikapitiya et al., 2008; Wang et al., 2008c) that leads to the induction of two major signal transduction pathways, the NFκB and MAP kinases, and stimulate the synthesis of immune effectors (Baud and Karin, 2001; De Zoysa et al., 2010a, 2010b; Jiang and Wu, 2007). Foreign particles are then internalized and phagocytized by hemocytes (Bayne, 1990; Travers et al., 2008b). The elimination of the invader is accomplished by enzymatic digestion mediated by acid phosphatase activity and by the production of reactive oxygen species such as hydrogen peroxide – ROS (Tiscar and Mosca, 2004; Wang et al., 2004). The toxic effect of ROS production is limited by “ROS-scavengers” such as superoxide dismutase – SOD (Ekanayake et al., 2006; Kim et al., 2007; Li et al., 2010). In addition, soluble effectors present in the serum act as immune helpers such as the ion holders and the phenoloxidase pathway that may limit pathogen proliferation in abalone (Cheng et al., 2004; Travers et al., 2008c). Over the past fifteen years, European abalone populations from the north coast of France and aquaculture farms have suffered massive summer mortalities leading to the loss of up to 80% of abalone stock (Nicolas et al., 2002). These mortalities have been attributed to the bacterial pathogen V. harveyi in physiologically depressed animals when the seawater temperature reaches 17 °C (Cardinaud et al., 2014b; Travers et al., 2009a). V. harveyi infection of the European abalone is characterized by the rapidity of the infectious process. V. harveyi adhesion on gills and penetration into abalone tissues takes place within the first 3 hours of contact. Invasion and multiplication of V. harveyi in the abalone circulatory system is effective 24 h after exposure and mortalities appear 2 days after the initial exposure (Cardinaud et al., 2014a; Travers et al., 2009a). It has been demonstrated in vitro that 3 hours of contact between V. harveyi and abalone hemocytes lead to an inhibition of phagocytosis that could be triggered by an inhibition of the p38 MAPK pathway (Travers et al., 2009b). However, the alteration of Haliotis tuberculata hemocytes function by V. harveyi remains to be demonstrated in vivo. In the present study, we analyzed the response of European abalone hemocytes, at the cellular and molecular levels during the first 24 hours of V. harveyi infection. Measurements of cellular immune parameters, immunerelated gene expressions and analyses of enzymatic activities involved in general metabolism and immune function have provided crucial information on the successive events leading to the successful and rapid infection of abalone by V. harveyi.

Adult abalone at 19°C

Exp. infection 1 n=60

Experimental infection 2 n=40

Mortality rate after 12 days

Hemolymph sampling of 5 individuals after 0, 3, 9 and 24h

On each abalone

Cellular analysis

V. harveyi quantification

Hemocyte density Hemocyte viability Phagocytosis index ROS production

Gene expression Gls Actin Ferritin Mpeg Clathrin Rel/NF-κB Mnk

Enzymatic activities GLS CCO PO AP SOD

Fig. 1. Simplified experimental design to determine the early effects of V harveyi exposure to the immune function of the European abalone. One hundred adult abalones were transferred from hatchery, maintained in the laboratory and acclimated at 19 °C and were subjected to two different experimental infections. ROS: reactive oxygen species, Gls: Glutamine synthase gene, Mpeg: Macrophage expressed protein, Rel/NF-κB: Rel/nuclear factor-kappa B, Mnk: MAP kinase-interacting kinase, GLS: Glutamine synthase enzyme, CCO: Cytochrome c oxidase, PO: Phenoloxidase, AP: Acid phosphatase, SOD: Superoxide dismutase.

temperature controlled shaker, at 28 °C for 16 hours. Bacteria were washed and re-suspended 3 times in filtered and sterile seawater (FSSW) before use. The bacterial concentration was then measured by spectrophotometry at 490 nm according to the formula CFU = 6.109 OD – 108, as previously described (Travers et al., 2008a). The rest of the procedure was summed up in the Fig. 1. 2.2. Experimental infection 1

2. Material and methods 2.1. Abalone and bacterial strain Adult H. tuberculata (n = 100, 3 years old) were transported in containers filled with macroalgae Palmaria palmata from the France Haliotis hatchery in Plouguerneau (temperature 14 °C, salinity 35), France (abalonebretagne.com/) to our laboratory at the European Institute for Marine Studies in Brest, in April 2012. Abalones were placed in six 5 L-tanks in which the seawater was replaced daily with seawater pumped from the Bay of Brest filtered at 1 μm (dissolved oxygen concentration > 7.5 mg. L-1, salinity 35). The seawater temperature was progressively increased by 1 °C per day until 19 °C and animals were maintained at this temperature for a week before experimental infections. The strain ORM4 of V. harveyi, isolated from diseased abalone H. tuberculata in Normandy, France, during an episode of massive mortalities in 1999 (Nicolas et al., 2002), was used in this study. Bacteria were grown in lysogeny Broth (LB Broth, Sigma-Aldrich Co., St. Louis, USA) supplemented with extra salt (20 g L-1, f.c.) in a

Thirty abalones were exposed for 24 hours to V. harveyi, strain ORM4, at a final concentration of 105 CFU mL−1 as previously described (Travers et al., 2009a). A control group of 30 individuals were kept unexposed to bacteria. Dead abalone were counted and removed daily until mortality rate stabilization (Fig. 1). The presence of V. harveyi in moribund abalone hemolymph was confirmed by PCR using the method developed by Conejero and Hedreyda (2003). 2.3. Experimental infection 2 2.3.1. Sampling Forty abalones were separated in two sets of 3 tanks: the first set contained animals exposed to the strain ORM4 at a final concentration of 105 CFU mL−1, and the second set contained unexposed animals. Five animals were randomly sampled from the 3 tanks of each set just before the infection (T0) and then after 3 h, 9 h and 24 h of experimentation. Approximately one mL of hemolymph was collected from the anterior sinus of each abalone with a 2.5 mL pre-cooled sterile

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the European abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

ARTICLE IN PRESS M. Cardinaud et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

syringe fitted on a 23-gauge needle containing one mL of ice-cold FSSW to avoid hemocyte aggregation as previously described in abalone (Cardinaud et al., 2014b; Dang et al., 2012; Travers et al., 2008c). Hemolymph was sampled within 30 sec following abalone removal from each tank to prevent sampling stress, and was kept on ice. The 2 mL of 1:2 diluted hemolymph was split into four tubes : (i) 500 μL was further diluted with 500 μL of ice-cold FSSW and kept on ice until flow cytometry analysis, (ii) 500 μL was stored at −80 °C for V. harveyi quantification; (iii) 500 μL was centrifuged at 2500 g for 15 min and the hemocyte pellet was frozen in liquid nitrogen and stored at −80 °C for gene expression analysis; (iv) 500 μL was stored at −80 °C for enzymatic assays. 2.3.2. Cellular analysis by flow cytometry Morphological analyses of hemocytes were performed using a FACSCalibur flow cytometer (Becton Dickinson) equipped with a 488-nm air-cooled laser. Prior to the measures of immune parameters, the absence of different hemocyte sub-populations was confirmed by analyzing cell size – forward scattering (FSC) and complexity – side scattering (SSC) (Fig. S1). Hemocyte concentration, viability, phagocytosis index and ROS production were measured as described previously (Travers et al., 2008c). 2.3.2.1. Hemocyte concentration and viability. Initially, hemolymph samples were filtered through an 80 μm nylon mesh to eliminate aggregates and debris before flow cytometry analyses. Then, 300 μL of diluted hemolymph was further diluted into 300 μL of anti-aggregant solution (AASH: 1.5% EDTA, 6.25 g L−1 NaCl, in FSSW, pH 7.4), and divided in three technical replicates. Each sample was then incubated for 30 min with both SYBR Green I fluorescent dye (Molecular Probes, 10−3 dilution of the commercial stock solution, in FSSW) and Propidium Iodide fluorescent dye (10 μg·mL−1, f.c., in FSSW). Hemocyte concentration was estimated by counting at least 10,000 particles in 30 sec through the green fluorescence cytometer detector –FL1, and results were reported in cells per millimeter of hemolymph. Dead cells incorporated Propidium Iodide and were visualized though the FL3 cytometer detector. Hemocyte viability was obtained by calculating the percentage of dead cells among 10,000 hemocytes. 2.3.2.2. Phagocytosis index. Three hundred μL of diluted hemolymph were further diluted into 300 μL of FSSW and divided into three technical replicates of 200 μL. Each replicate was deposited in a 24-well plate (Cellstar, Greiner Bio-one). Hemocytes were allowed to adhere for 15 min at 18 °C. Then, 100 μL of fluorescent beads (Fluoresbrite Yellow Green Microspheres, 2.00 μm, Polysciences, 1:200 in FSSW) was added to each sample with a ratio about 30 beads per hemocyte. After 3 hours at 18 °C, supernatants were removed and adherent cells were detached by adding 200 μL of a trypsin solution (2.5 mg. mL-1 in AASH). Plates were shaken for 10 min and the percentage of hemocytes that phagocyted three or more beads – phagocytosis index – was counted on the flow cytometer through the cytometer detector FL1. 2.3.2.3. ROS production. Three hundred μL of diluted hemolymph was further diluted into 300 μL of FSSW and divided into three technical replicates of 200 μL. Each replicate was analyzed exactly 10 min after addition of 2′, 7′-dichlorofluorescein diacetate (DCFH-DA, 0.1 mM f.c. in FSSW) which is oxidized by H2O2 and other oxygen derivatives (Bass et al., 1983; Keller et al., 2004; Myhre et al., 2003). Results are given as the mean intra-hemocytic fluorescence level of the dichlorofluorescein end product expressed in arbitrary units (U.A.).

3

2.3.3. V. harveyi quantification V. harveyi quantification was performed using a 7500 Fast RealTime PCR System instrument and TaqMan® Universal Master Mix (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA, USA) as described in Cardinaud et al. (2014a). Briefly, 500 μL of hemolymph was diluted in 500 μL of salted extract buffer (100 mM Tris–HCl, 100 mM NaCl and 50 mM EDTA pH 8). Total DNA was extracted using a phenol/chloroform/isoamyl alcohol method (Sambrook and Russell, 2001) and resuspended in 50 μL of DNasefree water. Concentration and quality of DNA were determined using a Nanodrop ND-1000 spectrometer (Thermo Fisher scientific, USA). RT-qPCR measures were made using V. harveyi tox-R gene specific primers: Forward CCA-CTG-CTG-AGA-CAA-AAG-CA, Reverse GTGATT-CTG-CAG-GGT-TGG-TT, and a Tox-R probe dually labeled with 5′ reporter dye Texas Red and a downstream 3′ quencher dye BHQ2: CAG-CCG-TCG-AAC-AAG-CAC-CG (Schikorski et al., 2013). Each reaction was run in triplicate in a final volume of 20 μL containing 4 μL of DNA sample, 1X of master mix, 300 nM of each primer and 200 nM of probe. Reactions were initiated with activation of the Thermo-Start DNA polymerase during 10 min at 95 °C followed by 45 amplification cycles (denaturation at 95 °C for 15 s, annealing at 60 °C for 1 min). Tenfold serial dilution of V. harveyi in hemolymph of healthy unexposed abalone (108 CFU to 0) was used to generate a standard curve. Bacteria count was confirmed by spectrophotometry (for high bacteria concentrations, see above) and by plating and microscopic enumeration (for low bacteria concentrations). 2.3.4. Gene expression analysis 2.3.4.1. Selection of gene candidates. Seven genes were chosen for gene expression analysis due to their implication in general metabolism – Glutamine Synthase (Gls), in cell movement – Actin, in immune response – the subunit H of Ferritin, Clathrin, Macrophage expressed gene (Mpeg), and in signal transduction – Rel/ nuclear factor-kappa B (Rel/NF-κB) and MAP kinase-interacting kinase (Mnk) genes, and their putative involvement during abalone infection (Jiang and Wu, 2007; Travers et al., 2009b, 2010; Wang et al., 2008b). The gene encoding Elongation Factor 2 (Ef2) was selected as reference gene (Table 1) because of its stable expression in all samples and time points. Primers for sequencing those genes were available in the literature in H. tuberculata, except for Rel/NFκB and Mnk genes (Table 1). For Rel/NF-κB gene, a cDNA consensus sequence was created by the software Bioedit Sequence Alignment Editor 7.1.3.0 (Hall, 1999) from the conserved regions of other Haliotis species sequences (Fig. S2). Oligonucleotide primer sequences were designed using Primer express 3.0 software (Applied Biosystems, Foster City, CA) (Fig. S2). For Mnk gene, the primers designed in Haliotis midae were used in this study (van der Merwe et al., 2011). None of the primers matched with the genome of the strain ORM4 of V. harveyi (unpublished data, Paillard Christine), which prevented cross-reactions. The size of the PCR products was confirmed by electrophoresis on agarose gel. The RT-qPCR efficiency (E) was estimated by serial dilutions (from 1/25 to 1/400) of two reference cDNA samples (one control and one exposed abalone), using the method described by Yuan et al. (2006): E = 10[−1/slope]. 2.3.4.2. RNA isolation and cDNA synthesis. Total RNA was extracted using TRIzol® Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions and resuspended in RNase-free water. RNA was quantified by spectrophotometry with a Nanodrop ND-1000 (Thermo Fisher Scientific, USA) and RNA quality was assessed by gel electrophoresis and by analysis on an Agilent Bioanalyzer 2100 with RNA 6000 Nano Kit (Agilent Technologies). DNA contamination was prevented using a RTS-DNase kit (MO BIO Laboratories, Inc., Carlsbad, CA) on RNA samples, and checked by amplification of a non-reverse transcribed fraction (minus-RT).

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the European abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

ARTICLE IN PRESS M. Cardinaud et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

4

Table 1 Primer sequences used in Real time qPCR analysis in this study. Gene

Primer sequences

Biological function

Literature source

Efficiency

Elongation factor 2

F: ATGGAGTTTTGTGCGATGAGAA R: TCGGCGTGGAGAGTCACAT F: GCGACACCTGCCGAGAAGT R: AGTTATTGAAGAAGCCATCGAGAGA F: CGTGACGACTGGGCATTACTC R: GGACCACATCACCAACCTGAA F: CACTCGCTCGGTCAACTTCTT R: CTGGTAGTCCTCCTCCTCAATGA F: AGGTWGCTTCGCTRTGGT R: TCAYTCCTGCTGGYTGTTCT F: AATGGAGGATAACCGCAAAG R: GAGATTCAGATGTCCGCACC F: TCGTCCGCAACCCTTCT R: GGGTGGTTCAGTGAGTGAGAGA

Transduction – reference gene

Travers et al., 2010

1.07

General metabolism

Travers et al., 2010

0.94

Stress response – ferrous ion holder

Travers et al., 2010

0.96

Cell exchange – internalization

Travers et al., 2010

0.98

Immunity – perforin

Cardinaud et al., 2014b

1.01

Signal transduction – MAPK pathway

van der Merwe et al., 2011

1.03

Signal transduction – transcription factor

This study

0.87

Glutamine synthase Ferritin Clathrin Mpeg Mnk Rel/Nf-κB

Mpeg: macrophage expressed protein, Mnk: MAP kinase-interacting kinase, Rel/NF-κB: nuclear factor-kappa B.

Reverse transcription was performed with 1 μg of cDNA using random hexamer primers and a RevertAid™ kit (Fermentas International Inc., Burlington, Canada). A minimal difference between minus-RT and cDNA samples was fixed at ten amplification cycles to accept a sample in gene expression analyses. 2.3.4.3. Real time q-PCR measurements. RT-qPCR measurements were performed as previously described (Travers et al., 2010). Each run included a negative control in which sterile water replaced cDNA sample, and a reference sample constituted by a pool of all the samples – including both control and exposed samples. Results were first normalized to the reference gene using the method described by Pfaffl (2001) and determined by the equation: Relative expression = EtargetΔCttarget (control-sample)/ErefΔCtref (control-sample),where Etarget is the amplification efficiency of the target or gene of interest, Eref is the amplification efficiency of the reference gene and Ct is the cycle threshold. Then, relative gene expression was indexed to the number of viable hemocytes in the sample (see above hemocytes concentration and viability) and reported to 106 cells. 2.3.5. Enzymatic assays Prior to enzymatic activity assays by spectrophotometric methods, hemolymph samples were centrifuged at 2500 g for 15 min. The supernatant was conserved and stored on ice until use. The total protein content of all samples was measured using the method of Lowry and collaborators, with the DC™ Protein Assay kit (Life Science, BioRad, Marnes-la-Coquette, France) and serial dilution of bovine serum albumin as standards (Lowry et al., 1951). Enzymatic activities were calculated and normalized to the number of viable hemocytes and reported to 106 cells:

(ΔAλ Sample min − ΔAλ Blank min) ×Total volume × Conversion factor to minutes Units mg protein = Millimolar extinction coefficient of the substrate at λ × Volume of the sample × mg protein in the sample ×

106 cells number of viable cells

2.3.5.1. Glutamine synthase (GLS) activity. Glutamine synthase activity was measured at 19 °C, using the indirect method described by Kingdon et al. (1968). Briefly, the consumption of β-NADH was monitored at 340 nm during the formation of lactate by the enzymatic complex pyruvate kinase/L-lactic dehydrogenase. The final concentrations of the reagents were as follows: 34.1 mM imidazole, 102 mM sodium glutamate, 8.5 mM adenosine 5′-triphosphate, 1.1 mM phosphoenolpyruvate, 60 mM magnesium chloride, 18.9 mM

potassium chloride, 45 mM ammonium chloride, 0.25 mM b-nicotinamide adenine dinucleotide, 28 units of pyruvate kinase and 40 units of L-lactic dehydrogenase. The absorbance at 340 nm was read continuously for 30 min. The activity was given in GLS unit which corresponds to the conversion of 1.0 μmol of L-glutamate to L-glutamine.

2.3.5.2. Cytochrome c oxidase (CCO) activity. Cytochrome c oxidase was measured at 19 °C, using the method described by Smith (1955) and adapted in marine mollusks by Sussarellu et al. (2013). The oxidation of the reduced cytochrome c was monitored at 550 nm, using a 600 μM reduced cytochrome c substrate in 50 mM phosphate buffer (50 mM NaH2PO4, 50 mM Na2HPO4, pH = 7.8). The absorbance at 550 nm was read continuously for 15 min. The activity was given in CCO unit which corresponds to the oxidation of 1.0 μmol of reduced cytochrome c.

2.3.5.3. Phenoloxidase (PO) activity. Phenoloxidase activity was measured at 19 °C, using the indirect method described by Ford and Paillard, in which the oxidation of phenol components is monitored at 490 nm (Ford and Paillard, 2007). Briefly, 100 μL of 2 mM L-3,4-dihydroxyphenylalanine in 0.2 M Tris–HCl–1% SDS (v/v), pH 8, was added to 100 μL of total hemolymph and the absorbance at 490 nm was read continuously for 30 min. The activity was given in PO unit which corresponds to the oxidation of 1 μmol of L-DOPA.

2.3.5.4. Acid phosphatase (AP) activity. Acid phosphatase activity was measured at 19 °C, using the method described by Bergmeyer et al. (1974). Briefly, the consumption of p-nitrophenyl phosphate was monitored at 410 nm using a 6.9 mM p-nitrophenyl phosphate substrate in 41 mM citric acid buffer after 15 min. The activity was given in AP unit which hydrolyzes 1.0 μmol of p-nitrophenyl phosphate.

2.3.5.5. Superoxide dismutase activity. Superoxide dismutase activity was measured at 19 °C, using the method described by McCord and Fridovich (1969). The inhibition of the rate of cytochrome c reduction by superoxide anion generated from the xanthine oxidase/ hypoxanthine reaction was observed at 550 nm. The final concentrations of the reagents were as follows: phosphate buffer (50 mM, pH 7.8), hypoxanthine (0.05 mM), xanthine oxidase (0.008 mU/mL), and cytochrome C (0.01 mM). The absorbance at 490 nm was read continuously for 15 min. The activity is given in SOD unit which corresponds to a 50% inhibition of the xanthine oxidase reaction.

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the European abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

ARTICLE IN PRESS M. Cardinaud et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

2.4. Statistics All statistical analyses were performed using JMP 10.0.0 software (SAS Institute Inc.). 2.4.1. Factorial analyses A discriminant analysis (DA) was performed on all the variables of the dataset in the function of sampling time to estimate a possible distinction of the hemocyte response along the exposure to V. harveyi. Then, an estimation of Spearman’s rank correlation was done between all the measured parameters to remove variables statistically dependent on each other and positively correlated (Spearman, 1904). A Principal component analysis (PCA) was performed with these non-correlated variables. Components with the highest proportion of variance were used to draw a scatter plot organizing control (T0 and unexposed) and exposed abalone samples along the principal components. 2.4.2. Variance analyses According to the results of normality and homoscedasticity analyses, the effects of V. harveyi exposure and of the time of exposure were estimated by 1/ analysis of variance (2-way ANOVA) for the immune parameters, and 2/ by a non-parametric Wilcoxon test for transcriptional and enzymatic measures. Then, pairwise comparisons between control and exposed abalone were performed for each time point with Student’s t test for immune factors, and by a Wilcoxon signed-rank test for transcriptional and enzymatic measures (Wilcoxon, 1945). 3. Results 3.1. Mortality rate and quantification of V. harveyi in hemolymph European abalone mortality following a 24 h exposure to V. harveyi was followed for 12 days (Fig. S3). The role of V. harveyi in the individual mortality was assessed by the detection of V. harveyi in abalone hemolymph. The first mortalities occurred 2 days after exposure and the cumulated mortality rate reached 93% after 9 days. No mortality was observed in control abalone (T0 and unexposed). Quantification of V. harveyi in European abalone hemolymph revealed a significant abundance of the pathogen after 9 h of exposure

103 Log(CFU/mL)

V. harveyi concentration

104

102

101

Detection threshold

0 T0

T3

T9

T24

Exposure time

5

Table 2 Effects of Vibrio harveyi exposure and time of exposure on data of cellular immune parameters estimated by ANOVA tests, and gene expression and enzymatic activity measures estimated by Wilcoxon tests. The values in bold are statistically significant at the level of 0.05. Gene and variable tested Immune parameters Hemocyte density V. harveyi exposure Time V. harveyi exposure × time Viability V. harveyi exposure Time V. harveyi exposure × time ROS production V. harveyi exposure Time V. harveyi exposure × time Phagocytosis index V. harveyi exposure Time V. harveyi exposure × time Gene expression data Glutamine synthase V. harveyi exposure Time V. harveyi exposure × time Actin V. harveyi exposure Time V. harveyi exposure × time Clathrin V. harveyi exposure Time V. harveyi exposure × time Ferritin V. harveyi exposure Time V. harveyi exposure × time Mpeg V. harveyi exposure Time V. harveyi exposure × time Rel/NF-κB V. harveyi exposure Time V. harveyi exposure × time Mnk V. harveyi exposure Time V. harveyi exposure × time Enzymatic activities Glutamine synthase V. harveyi exposure Time V. harveyi exposure × time Cytochrome c oxidase V. harveyi exposure Time V. harveyi exposure × time Acid phosphatase V. harveyi exposure Time V. harveyi exposure × time Phenoloxidase V. harveyi exposure Time V. harveyi exposure × time Superoxide dismustase V. harveyi exposure Time V. harveyi exposure × time

P value

0.0171 0.0073 0.0048 0.0820 0.0367 0.0164 0.0922 0.0007 0.0007 0.2220 <0.001 <0.001

0.6839 0.5573 0.7418 0.1715 0.0043 0.0061 0.0005 0.1660 0.0058 0.2466 0.0308 0.0035 0.9501 0.0161 0.0237 0.3237 0.3633 0.0306 0.2356 0.0270 0.0574

0.3461 0.0002 0.0004 0.3428 0.0506 0.0479 0.3356 0.0762 0.1043 0.5016 0.5598 0.8952 0.5705 0.9493 0.0653

Mpeg: macrophage expressed protein, Mnk: MAP kinase-interacting kinase, Rel/ NF-κB: nuclear factor-kappa B.

Fig. 2. Fluctuations of V. harveyi concentration in European abalone hemolymph after 0 h, 3 h, 9 h and 24 h of exposure – T0, T3, T9 and T24. The measures were made by quantitative PCR using the absolute method developed in Cardinaud et al. (Cardinaud et al., 2014a). The dotted line corresponds to the detection threshold of this method.

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the European abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

ARTICLE IN PRESS M. Cardinaud et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

6

A

2

DA component 2

0

T0 and Unexposed

T9

-2

-4

T3 T24

-6

-8 8

10

12

14

16

18

DA component 1

C

6

2 y = 0.357 0.00205 x

Clathrin 4

PCA component 1

PCA component 2 (24,4 %)

B

Rel

2 0 -2

ROS

Ferritin

-4

R² = 0.76

0

-2

-4

Density

-6

-6 -6

-4

-2

0

2

4

6

PCA component 1 (36,8 %)

0

101

102

103

104

V. harveyi concentration CFU/mL

Fig. 3. Factorial analyses of the global dataset obtained after the first hours of exposure of European abalone to V. harveyi. A: Discriminant analysis of global hemocyte response dataset, classed by time of exposure to V. harveyi. B: Principal component analysis of global hemocyte response dataset. An estimation of Spearman’s rank correlation was done between all the measured parameters to remove variable statistically correlated to other ones. C: Linear regression between PCA1 and V. harveyi concentration.

(Fig. 2). The concentration of V. harveyi in hemolymph significantly increased between 9 h and 24 h, from 1.18·102 ± 0.82·102 bacteria/mL to 1.32·103 ± 0.71·103 bacteria/mL. 3.2. Factorial analyses In the present study, we measured numerous parameters providing information on hemocyte ability to respond to infection at the cellular and molecular level. A discriminant analysis (DA) was used to confirm internal consistency of different samples from the same time point after infection (Fig. 3A). DA scatter plot revealed that 1/ T0 and not infected abalone clustered together with high canonical component 1 and 2 values and 2/ abalone collected 3 h, 9 h and 24 h after exposure to V. harveyi clustered apart from each other (Lambda Wilk < 0.0001). After 3 h of infection, samples clustered slightly apart from control individuals with slightly lower component 2 values. Component 1 decreased significantly in abalone collected after 9 h of exposure compared to noninfected individuals. Samples collected 24 h

from exposure clustered further apart with low component 1 and 2 values. Next, estimation of Spearman’s rank correlation showed that 5 immune measures were not correlated with each other and may explain the integrality of dataset: hemocyte concentration, ROS production, Clathrin, Ferritin and Rel gene expressions (Table S1). A Principal Component Analysis was performed using this subset of data (Fig. 3B). The two principal components of this PCA explained 61.2% of total variance. PCA1 was characterized by low Ferritin values – (and hence low Actin, according to Spearman’s rank correlation), high ROS values and to a lesser extent by high hemocyte concentration (and hence high hemocyte viability and phagocytosis index, according to Spearman’s rank correlation). Interestingly, PCA1 was inversely correlated with V. harveyi concentration (Fig. 3C), which results in a direct correlation between V. harveyi concentration, Ferritin and Actin gene expressions and an inverse correlation with hemocyte cellular parameters. PCA 2 was characterized by high Clathrin and Rel/NF-κB expression (and hence

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the European abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

ARTICLE IN PRESS M. Cardinaud et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

100

300 200

*

100

90 80

*

*

60 0 120

Unexposed Exposed

40

A.U.

90

ROS

50

%

*

70

0 60

Phagocytosis index

*

%

Hemocyte viability

x 104 cells/mL

Hemocyte density

400

7

60

* 30

30

20

T0

T3

T9

0

T24

T0

Exposure time T9

T9

T24

T24 150

R² = 0.80

250

400

T3

Exposure time

R² = 0.99

200 125 Density = 489.92 69.56*Log(concentration)

100

x 104 cells/mL

Hemocyte density

150

101

100

Density = 328.56 28.22*Log(concentration)

5.102

102

103

200

0 0

500

1000

1500

2000

2500

3000

V. harveyi concentration CFU/mL Fig. 4. Fluctuations of hemocyte cellular parameters in the European abalone after 0 h, 3 h, 9 h and 24 h of exposure to Vibrio harveyi – T0, T3, T9 and T24, and fluctuation of hemocyte density in the function of V. harveyi concentration. Hemocyte concentration, hemocyte viability, phagocytosis index, and ROS production were indicated during the earlier stages of vibriosis from 5 individuals per time. * indicates values that are significantly different for a two-sided student t-test with p < 0.05. Two regressions have been done between hemocyte concentration and V. harveyi concentration after 9 h and after 24 h of exposure to V. harveyi.

high Mpeg expression, according to Spearman’s rank correlation) and low hemocyte concentration values (and hence low hemocyte viability and phagocytosis index, according to Spearman’s rank correlation). Wilcoxon tests were executed on all measured parameters in order to determine if they were statistically influenced by the time of exposure and/or by the exposure to V. harveyi (Table 2). Additional statistical analyses were performed to identify the time point at which a significant difference was measured when the results were influenced by the joint factor of time and exposure. When the factor V. harveyi exposure alone was sufficient to explain the variance observed, complementary analyses were performed to characterize the

correlation between the measured factor and the concentration of V. harveyi in the hemolymph of sampled abalone. The results of parameters that were not significantly statistically different in response to exposure to V. harveyi were not further described. 3.3. Changes in immune parameters All cellular immune parameters were influenced by the joint factor time and exposure (Table 2). A significant reduction in hemocyte viability and ROS production was observed from 9 h of exposure, and hemocyte concentration and phagocytosis index were significantly reduced from 24 h of exposure to V. harveyi (Fig. 4).

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the European abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

ARTICLE IN PRESS M. Cardinaud et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

8

Interestingly, hemocyte concentration was also influenced by the exposure to V. harveyi (Table 2). Fig. 4 shows that the hemocyte concentration was negatively correlated with the concentration of V. harveyi, after 9 h and 24 h of exposure.

103 102

AP, PO and SOD activities were not impacted by the abalone exposure to V. harveyi, while GLS and CCO activities were significantly dependent on the joint factor time and exposure to V. harveyi (Table 2). Both enzyme activities were significantly reduced after 24 h of exposure (Fig. 7). 4. Discussion This study aimed at revealing hemocyte responses in European abalone during the earlier stages of V. harveyi infection. Our results show two successive stages: (i) an early immune response to infection based on molecular immune response pathway and (ii) a V. harveyi induced cellular immuno-suppression and an alternative immune response with increase in Ferritin gene expression. Also, our results suggest a strong influence of V. harveyi concentration in the bacteria pathogenicity. Previous reports indicated that V. harveyi penetrates the gill– hypobranchial gland tissue after one hour of contact and can be detected in the abalone circulatory system after 3 h of exposure (Cardinaud et al., 2014a). In this study, the V. harveyi quantification revealed detectable quantities of the pathogen in the hemolymph of abalone after 9 h of exposure. The canonical discriminant analysis suggests that after only 3 h of exposure, V. harveyi has infected the abalone and initiates a response. The over expression of Rel/NF-kB gene after 3 h of exposure indicates that abalones are indeed responding to the presence of V. harveyi even though the bacteria concentration was below detection threshold. The family of Rel/NF-κB transcription factors is particularly known for its involvement in immunity, inflammation and apoptosis process (Hoffmann and Baltimore, 2006). After 9 h of exposure, an increase in expression of Clathrin and Mpeg gene confirmed that an immune response has been initiated. Moreover, a positive correlation between the Clathrin gene expression and V. harveyi concentration was observed after 9 h of exposure (Fig. 6). Clathrin is involved in bacterial internalization by phagocytic cells (Pauly and Drubin, 2007; Veiga and Cossart, 2006). An upregulation of Mpeg gene expression in response to pathogen contact has already

101 1

10-1 104

Actin

**

103

102

Relative gene expressions

3.5. Modulation of enzymatic activities

** *

3.4. Gene expression analysis Gls and Mnk were not significantly differentially expressed in presence of V. harveyi while the expression of Rel/NF-kB, Clathrin, Mpeg, Actin and Ferritin was dependent on the joint factor of V. harveyi exposure and time (Table 2). A significant increase in Rel/NF-kB gene expression was observed after 3 h of exposure which was followed by a downregulation after 24 h of exposure (Fig. 5). Clathrin and Mpeg genes had the same expression profiles, and were significantly overexpressed after 9 h of exposure and downregulated after 24 h (Fig. 5). Actin and Ferritin genes showed different expression profiles with a significant overexpression after 24 h of exposure to V. harveyi (Fig. 5). Interestingly, Clathrin gene expression was also dependent on V. harveyi concentration. Indeed, Clathrin gene expression initially increased at low V. harveyi concentration and then decreased when V. harveyi concentration reached about 200 CFU/mL (Fig. 6). As a result, a positive correlation between Clathrin gene expression and V. harveyi concentration was observed after 9 h of exposure (R2 = 0.79), and was followed by a negative correlation after 24 h of exposure (R2 = 0.96) (Fig. 6).

Unexposed Exposed

101 1 10-1 103

Ferritin

*

102 101

*

1 10-1 10-2 102

Rel/NF-kB

101

*

1

*

10-1 10-2

Mpeg T0

T3 T9 Exposure time

T24

Fig. 5. Expression profiles of Glutamine synthase (Gls), Ferritin, Rel/nuclear factorkappa B (Rel/NF-κB) and Macrophage expressed protein (Mepg) genes after 0 h, 3 h, 9 h and 24 h of exposure to Vibrio harveyi – T0, T3, T9 and T24, in European abalone hemocytes. The relative gene expression was calculated by Pfaffl’s method (Pfaffl, 2001) using Elongation Factor 2 as reference gene and relative to expression of a pool of all samples considered in this study. * and ** indicate values that are significantly different for a non-parametric Wilcoxon test with p < 0.05 and p < 0.01, respectively.

been observed in marine invertebrates such as the giant oyster C. gigas, the small abalone Haliotis diversicolor supertexta and in the sponge Suberites domuncula (He et al., 2011; Wang et al., 2008b; Wiens et al., 2005). Abalone Mepg like-protein genes have been first

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the European abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

ARTICLE IN PRESS M. Cardinaud et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

T9

9

T24

101

1

Relative Clathrin expression

R² = 0.79

R² = 0.96

10-1

101

101

Log(Clathrin) = 3.03 + 0.025*Log(concentration)

* 1

1/Log(Clathrin) = -0.90 + 0.0038*Log(concentration)

10-2

1

*

1

102

101

102

103

104

10-1

10-1 Unexposed Exposed

10-2

10-2

T0

T3

T9

T24

0

500

1000

1500

2000

2500

3000

3500

V. harveyi concentration

Exposure time

CFU/mL Fig. 6. Expression profile of Clathrin gene in the function of time of exposure to V. harveyi and of V. harveyi concentration, in European abalone hemocytes. A: Clathrin gene expression after 0 h, 3 h, 9 h and 24 h of exposure to Vibrio harveyi – T0, T3, T9 and T24. * indicates values that are significantly different for a non-parametric Wilcoxon test with p < 0.05. B: Correlation between Clathrin gene expression and V. harveyi concentration. Two regressions have been done after 9 h and after 24 h of exposure to V. harveyi.

characterized in the pink abalone, Haliotis corrugata, and the red abalone, Haliotis rufescens, and have almost 50% similarity with the mouse Mpeg1 gene (Mah et al., 2004). Abalone Mpeg also possesses perforin typical structures as a “membrane attack complex/

10.0 8.0

Unexposed Exposed

6.0

Unit/mg protein

Enzymatic activities

4.0

*

2.0 0.0 1.2

GLS

0.9 0.6

*

0.3 0.0

CCO T0

T3

T9

T24

Exposure time Fig. 7. Enzymatic activities of Glutamine synthase (GLS) and Cytochrome c oxidase (CCO) after 0 h, 3 h, 9 h and 24 h of exposure to Vibrio harveyi – T0, T3, T9, T24 in European abalone hemocytes. The measures were made by spectrophotometric methods. * indicates values that are significantly different for a non-parametric Wilcoxon test with p < 0.05.

perforin-homology domain” containing the cytolytic helix-turnhelix functional domain (Kemp and Coyne, 2011; Mah et al., 2004; Wang et al., 2008a). The precocious upregulation of Clathrin and Mpeg gene expressions in European abalone hemocytes after 9 h of contact with V. harveyi suggests the induction of both cellular and molecular immune response processes during the earlier hours of exposure. However, from 9 h of exposure, this study showed that V. harveyi has intensively reproduced and impacted hemocyte viability and ROS measurements. It has previously been demonstrated that strains of pathogenic V. harveyi produce a hemolytic factor called hemolysin. Hemolysin could be responsible for the reduced hemocyte viability of infected abalones. Regarding ROS production, Travers et al. suggested that V. harveyi regulates the p38 MAPK pathway to reduce hemocyte phagocytosis and ROS production (Travers et al., 2009b). However, in the present study, Mnk was not differentially expressed, which prevented us from confirming this hypothesis. A significant reduction in ROS production has been described during other types of Vibrio infection in marine mollusks, notably in the giant oyster C. gigas, and may correspond to a component of their virulence strategy (Lambert et al., 2003). Here, the reduction of ROS level after 9 h of exposure to V. harveyi, measured using the DCFHDA probe, may also be linked with the reduction of hemocyte viability due to impairment in cell membrane integrity. Further studies are so necessary to decipher the molecular mechanisms involved in the reduction of hemocyte phagocytosis and ROS production by V. harveyi. After 24 hours of exposure, we observed an impairment of cellular immunity resulting from V. haryeyi reproduction and infection. All cellular parameters measured (hemocyte concentration and viability, phagocytosis index and ROS production) were significantly lower than control individuals (Fig. 4). It further suggests that V. harveyi alters immune functions via toxin production. The reduced hemocyte viability can also be explained by the observed reduction in general metabolism. The activities of GLS and CCO were significantly reduced after 24 h of exposure (Fig. 7). A modulation of Glutamine metabolism via activation or inhibition of GLS synthesis or gene expression during infection process has been previously reported in humans and marine invertebrates such as the bivalvia Tegillarca granosa and Chlamys farreri (Karinch et al., 2001;

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the European abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

ARTICLE IN PRESS 10

M. Cardinaud et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

Wilmore and Shabert, 1998). A down-regulation of GLS expression has also been observed in infected muscle of abalone after 6 days of exposure (Travers et al., 2010). This reduced general metabolism may be a consequence of vibriosis or a response of the European abalone to vibriosis. Indeed, it has been demonstrated that stress conditions may induce a metabolic depression which is correlated with lower survival capacity to infection and lower hemocyte function, in invertebrates and notably in the European abalone (Arnold et al., 2013; Cardinaud et al., 2014b). Moreover, a recent study about the effect of a V. harveyi infection in two clam species shows that this pathogen leads to an alteration of energy metabolism and immune stress (Liu et al., 2013). Vibriosis has direct consequences on the European abalone cellular immune capacities as illustrated by the observed variation in immune-related gene expression. After 24 h of exposure, we observed a significant down-expression of Clathrin, Mpeg and Rel/NFkB genes (Figs. 5 and 6). As discussed above, these genes are involved in the initial stages of the European abalone response to V. harveyi infection: signal transduction, recognition and phagocytosis. The alteration of these pathways may result from the lower viability of hemocytes, or from a more direct effect of V. harveyi toxins on the immune function as previously proposed by Travers et al. (2009b). However, a significant increase in Actin and Ferritin gene expressions was observed after 24 h of exposure. In addition to the involvement of actin cytoskeleton in many cellular mobile processes and phagocytosis, actin fibers are implicated in the control of cell mitosis and cytokinesis, in the regulation of the cell signaling pathway and production of ROS, and constitute one of the main targets of pathogen toxins (Aktories et al., 2011). An upregulation of Actin gene expression during the first hours of vibriosis in the European abalone may counteract a hypothetical subversion of hemocyte actin cytoskeleton by V. harveyi to enter and to multiply in these host cells, as previously described in the giant oyster C. gigas infected by V. splendidus and in the Manila clam R. philippinarum infected by V. tapetis (Brulle et al., 2012; Duperthuy et al., 2011) or may offset the decrease in hemocyte concentration and viability by stimulating the mitotic division of the remaining hemocytes. Ferritin is a globular protein that enables ferrous ion sequestration, preventing its toxic effects, and is involved in ROS production control via the Fenton reaction (Fenton and Jackson, 1899). Iron sequestration may constitute a component of the immune response in invertebrates, limiting its bioavailability for Vibrio proliferation (Beck et al., 2002; Doherty, 2007; Stork et al., 2002; Wright et al., 1981). In shrimps, ferritin protects against V. harveyi infection (Maiti et al., 2010). In the European abalone, Ferritin was among the few genes upregulated in individuals that survived the infection by V. harveyi (Travers et al., 2010). Therefore, the late Actin and Ferritin overexpression could represent an alternative response of the abalone to V. harveyi infection to counter the impaired phagocytosis. Further studies would be necessary to determine if there is a causal relation between Ferritin gene expression, V. harveyi concentration and abalone survival (6% of individuals after 12 days in this study). 5. Conclusion This study characterized the earlier stages of the European abalone hemocyte responses to vibriosis infection at the cellular and molecular levels. In the light of our results, we believe that the effectiveness of V. harveyi invasion in H. tuberculata tissues is due to its rapid reproduction and capacity to reduce the concentration and immune competencies of hemocytes before they can develop an effective response. It would be interesting to follow hemocyte responses and the production of virulence factors by V. harveyi during the first hours of contact to reveal if the parasite reduces cytotoxic effectors production by H. tuberculata. An in vitro study would allow a tight control of the number of bacteria per hemocyte. The present

study of gene expression analysis was limited to the short number of immune response genes that had previously been described in the genus. We believe next generation sequencing technologies, that can now be employed on any non-model species (Dheilly et al., 2014), should be employed in order to provide an integrated and unbiased picture of the interaction at the molecular level through the combined study of H. tuberculata and V. harveyi transcriptomes. Acknowledgements This study was supported by the partners of the Pole Mer Bretagne: the region of Brittany, the consil of the Finistère and Morbilhan and the city community Brest Metropole Oceane, and the Université de Bretagne Occidentale. Appendix: Supplementary material Supplementary data to this article can be found online at doi:10.1016/j.dci.2015.02.019. References Aktories, K., Lang, A.E., Schwan, C., Mannherz, H.G., 2011. Actin as target for modification by bacterial protein toxins. FEBS J. 278, 4526–4543. Allam, B., Ford, S.E., 2006. Effects of the pathogenic Vibrio tapetis on defence factors of susceptible and non-susceptible bivalve species: I. Haemocyte changes following in vitro challenge. Fish Shellfish Immunol. 20, 374–383. Allam, B., Paillard, C., Auffret, M., Ford, S.E., 2006. Effects of the pathogenic Vibrio tapetis on defence factors of susceptible and non-susceptible bivalve species: II. Cellular and biochemical changes following in vivo challenge. Fish Shellfish Immunol. 20, 384–397. Arnold, P.A., Johnson, K.N., White, C.R., 2013. Physiological and metabolic consequences of viral infection in Drosophila melanogaster. J. Exp. Biol. 216, 3350–3357. Austin, B., 2010. Vibrios as causal agents of zoonoses. Vet. Microbiol. 140, 310–317. Bass, D.A., Parce, J.W., Dechatelet, L.R., Szejda, P., Seeds, M.C., Thomas, M., 1983. Flow cytometric studies of oxidative product formation by neutrophils – a graded response to membrane stimulation. J. Immunol. 130, 1910–1917. Baud, V., Karin, M., 2001. Signal transduction by tumor necrosis factor and its relatives. Trends Cell Biol. 11, 372–377. Bayne, C.J., 1990. Phagocytosis and no-self recognition in invertebrates. Bioscience 40, 723–731. Beck, G., Ellis, T.W., Habicht, G.S., Schluter, S.F., Marchalonis, J.J., 2002. Evolution of the acute phase response: iron release by echinoderm (Asterias forbesi) coelomocytes, and cloning of an echinoderm ferritin molecule. Dev. Comp. Immunol. 26, 11–26. Bergmeyer, H.U., Gawehn, K., Grassl, M., 1974. Enzymatic assay of acid phosphatase. In: Methods of Enzymatic Analysis. Academic Press, New York and London. Brulle, F., Jeffroy, F., Madec, S., Nicolas, J.-L., Paillard, C., 2012. Transcriptomic analysis of Ruditapes philippinarum hemocytes reveals cytoskeleton disruption after in vitro Vibrio tapetis challenge. Dev. Comp. Immunol. 38, 368–376. Cardinaud, M., Barbou, A., Capitaine, C., Bidault, A., Dujon, A.M., Moraga, D., et al., 2014a. Vibrio harveyi adheres to and penetrates tissues of the European abalone Haliotis tuberculata within the first hours of contact. Appl. Environ. Microbiol. 80, 6328–6333. Cardinaud, M., Offret, C., Huchette, S., Moraga, D., Paillard, C., 2014b. The impacts of handling and air exposure on immune parameters, gene expression, and susceptibility to vibriosis of European abalone Haliotis tuberculata. Fish Shellfish Immunol. 36, 1–8. Cheng, W., Hsiao, I.S., Chen, J.C., 2004. Effect of ammonia on the immune response of Taiwan abalone Haliotis diversicolor supertexta and its susceptibility to Vibrio parahaemolyticus. Fish Shellfish Immunol. 17, 193–202. Conejero, M.J.U., Hedreyda, C.T., 2003. Isolation of partial toxR gene of Vibrio harveyi and design of toxR-targeted PCR primers for species detection. J. Appl. Microbiol. 95, 602–611. Dang, V.T., Speck, P., Benkendorff, K., 2012. Influence of elevated temperatures on the immune response of abalone, Haliotis rubra. Fish Shellfish Immunol. 32, 732–740. De Zoysa, M., Nikapitiya, C., Lee, Y., Lee, S., Oh, C., Whang, I., et al., 2010a. First molluscan transcription factor activator protein-1 (Ap-1) member from disk abalone and its expression profiling against immune challenge and tissue injury. Fish Shellfish Immunol. 29, 1028–1036. De Zoysa, M., Nikapitiya, C., Oh, C., Whang, I., Lee, J.S., Jung, S.J., et al., 2010b. Molecular evidence for the existence of lipopolysaccharide-induced TNF-alpha factor (LITAF) and Rel/NF-kB pathways in disk abalone (Haliotis discus discus). Fish Shellfish Immunol. 28, 754–763. Dheilly, N.M., Adema, C., Raftos, D.A., Gourbal, B., Grunau, C., Du Pasquier, L., 2014. No more non-model species: the promise of next generation sequencing for comparative immunology. Dev. Comp. Immunol. 45, 56–66.

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the European abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019

ARTICLE IN PRESS M. Cardinaud et al./Developmental and Comparative Immunology ■■ (2015) ■■–■■

Diggles, B.K., Moss, G.A., Carson, J., Anderson, C.D., 2000. Luminous vibriosis in rock lobster Jasus verreauxi (Decapoda : Palinuridae) phyllosoma larvae associated with infection by Vibrio harveyi. Dis. Aquat. Organ. 43, 127–137. Doherty, C.P., 2007. Host-pathogen interactions: the role of iron. J. Nutr. 137, 1341–1344. Duperthuy, M., Schmitt, P., Garzón, E., Caro, A., Rosa, R.D., Le Roux, F., et al., 2011. Use of OmpU porins for attachment and invasion of Crassostrea gigas immune cells by the oyster pathogen Vibrio splendidus. Proc. Natl. Acad. Sci. U.S.A. 108, 2993–2998. Ekanayake, P.M., Kang, H.S., De Zyosa, M., Jee, Y., Lee, Y.H., Lee, J., 2006. Molecular cloning and characterization of Mn-superoxide dismutase from disk abalone (Haliotis discus discus). Comp. Biochem. Physiol. B Biochem Mol. Biol. 145, 318–324. Farto, R., Armada, S.P., Montes, M., Guisande, J.A., Pérez, M.J., Nieto, T.P., 2003. Vibrio lentus associated with diseased wild octopus (Octopus vulgaris). J. Invertebr. Pathol. 83, 149–156. Fenton, H.J.H., Jackson, H.J., 1899. I. The oxidation of polyhydric alcohols in presence of iron. J. Chem. Soc., Trans. 75, 1–11. Ford, S.E., Paillard, C., 2007. Repeated sampling of individual bivalve mollusks I: intraindividual variability and consequences for haemolymph constituents of the Manila clam, Ruditapes philippinarum. Fish Shellfish Immunol. 23, 280– 291. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98. He, X.C., Zhang, Y., Yu, Z.N., 2011. An Mpeg (macrophage expressed gene) from the Pacific oyster Crassostrea gigas: molecular characterization and gene expression. Fish Shellfish Immunol. 30, 870–876. Hoffmann, A., Baltimore, D., 2006. Circuitry of nuclear factor κB signaling. Immunol. Rev. 210, 171–186. Hooper, C., Day, R., Slocombe, R., Handlinger, J., Benkendorff, K., 2007. Stress and immune responses in abalone: limitations in current knowledge and investigative methods based on other models. Fish Shellfish Immunol. 22, 363–379. Jiang, Y.S., Wu, X.Z., 2007. Characterization of a Rel\NF-kappa B homologue in a gastropod abalone, Haliotis diversicolor supertexta. Dev. Comp. Immunol. 31, 121–131. Karinch, A.M., Pan, M., Lin, C.M., Strange, R., Souba, W.W., 2001. Glutamine metabolism in sepsis and infection. J. Nutr. 131, 2535S–2538S. Keller, A., Mohamed, A., Drose, S., Brandt, U., Fleming, I., Brandes, R.P., 2004. Analysis of dichlorodihydrofluorescein and dihydrocalcein as probes for the detection of intracellular reactive oxygen species. Free Radic. Res. 38, 1257–1267. Kemp, I.K., Coyne, V.E., 2011. Identification and characterisation of the Mpeg1 homologue in the South African abalone, Haliotis midae. Fish Shellfish Immunol. 31, 754–764. Kim, K.Y., Lee, S.Y., Cho, Y.S., Bang, I.C., Kim, K.H., Kim, D.S., et al., 2007. Molecular characterization and mRNA expression during metal exposure and thermal stress of copper/zinc- and manganese-superoxide dismutases in disk abalone, Haliotis discus discus. Fish Shellfish Immunol. 23, 1043–1059. Kingdon, H.S., Hubbard, J.S., Stadtman, E.R.B., 1968. Glutamine synthase activity assay. Biochemistry 7, 2136–2142. Kumazawa, N.H., Mine, A., 2001. Migratory responses of hemocytes to Vibrio parahaemolyticus in the alimentary tract of an estuarine neritid gastropod, Clithon retropictus. J. Vet. Med. Sci. 63, 1257–1261. Lambert, C., Soudant, P., Choquet, G., Paillard, C., 2003. Measurement of Crassostrea gigas hemocyte oxidative metabolism by flow cytometry and the inhibiting capacity of pathogenic vibrios. Fish Shellfish Immunol. 15, 225–240. Leaño, E.M., Lavilla-Pitogo, C.R., Paner, M.G., 1998. Bacterial flora in the hepatopancreas of pond-reared Penaeus monodon juveniles with luminous vibriosis. Aquaculture 164, 367–374. Li, C.-C., Yeh, S.-T., Chen, J.-C., 2008. The immune response of white shrimp Litopenaeus vannamei following Vibrio alginolyticus injection. Fish Shellfish Immunol. 25, 853–860. Li, H.F., Sun, X.F., Cai, Z.H., Cai, G.P., Xing, K.Z., 2010. Identification and analysis of a Cu/Zn superoxide dismutase from Haliotis diversicolor supertexta with abalone juvenile detached syndrome. J. Invertebr. Pathol. 103, 116–123. Liu, X., Zhao, J., Wu, H., Wang, Q., 2013. Metabolomic analysis revealed the differential responses in two pedigrees of clam Ruditapes philippinarum towards Vibrio harveyi challenge. Fish Shellfish Immunol. 35, 1969–1975. Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265–275. Mah, S.A., Moy, G.W., Swanson, W.J., Vacquier, V.D., 2004. A perforin-like protein from a marine mollusk. Biochem. Biophys. Res. Comm. 316, 468–475. Maiti, B., Khushiramani, R., Tyagi, A., Karunasagar, I., 2010. Recombinant ferritin protein protects Penaeus monodon infected by pathogenic Vibrio harveyi. Dis. Aquat. Organ. 88, 99. McCord, J.M., Fridovich, I., 1969. Superoxide dismutase. J. Biol. Chem. 244, 6049–6055. Myhre, O., Andersen, J.M., Aarnes, H., Fonnum, F., 2003. Evaluation of the probes 2′,7′-dichlorofluorescin diacetate, luminol, and lucigenin as indicators of reactive species formation. Biochem. Pharmacol. 65, 1575–1582. Nicolas, J.L., Basuyaux, O., Mazurie, J., Thebault, A., 2002. Vibrio carchariae, a pathogen of the abalone Haliotis tuberculata. Dis. Aquat. Organ. 50, 35–43. Nikapitiya, C., De Zoysa, M., Lee, J., 2008. Molecular characterization and gene expression analysis of a pattern recognition protein from disk abalone, Haliotis discus discus. Fish Shellfish Immunol. 25, 638–647. Pauly, B.S., Drubin, D.G., 2007. Clathrin: an amazing multifunctional dreamcoat? Cell Host Microbe 2, 288–290.

11

Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory Press. New York. Sangster, C.R., Smolowitz, R.M., 2003. Description of Vibrio alginolyticus infection in cultured Sepia officinalis, Sepia apama, and Sepia pharaonis. Biol. Bull. 205, 233–234. Schikorski, D., Renault, T., Paillard, C., Bidault-Toffin, A., Tourbiez, D., Saulnier, D., 2013. Development of Taqman real-time PCR assay targeting both the marine bacteria Vibrio harveyi, a pathogen of European abalone Haliotis tuberculata, and plasmidic DNA harbored by virulent strains. Aquaculture 392–395, 106– 112. Smith, L., 1955. Spectrophotometric assay of cytochrome c oxidase. Methods Biochem. Anal. 2, 427. Soonthornchai, W., Rungrassamee, W., Karoonuthaisiri, N., Jarayabhand, P., Klinbunga, S., Söderhäll, K., et al., 2010. Expression of immune-related genes in the digestive organ of shrimp, Penaeus monodon, after an oral infection by Vibrio harveyi. Dev. Comp. Immunol. 34, 19–28. Spearman, C., 1904. The proof and measurement of association between two things. Am. J. Psychol. 15, 72–101. Stork, M., Di Lorenzo, M., Welch, T.J., Crosa, L.M., Crosa, J.H., 2002. Plasmid-mediated iron uptake and virulence in Vibrio anguillarum. Plasmid 48, 222–228. Sugumar, G., Nakai, T., Hirata, Y., Matsubara, D., Muroga, K., 1998. Vibrio splendidus biovar II as the causative agent of bacillary necrosis of Japanese oyster Crassostrea gigas larvae. Dis. Aquat. Organ. 33, 111–118. Sussarellu, R., Dudognon, T., Fabioux, C., Soudant, P., Moraga, D., Kraffe, E., 2013. Rapid mitochondrial adjustments in response to short-term hypoxia and re-oxygenation in the Pacific oyster, Crassostrea gigas. J. Exp. Biol. 216, 1561–1569. Tiscar, P.G., Mosca, F., 2004. Defense mechanisms in farmed marine molluscs. Vet. Res. Commun. 28, 57–62. Travers, M.A., Barbou, A., Le Goic, N., Huchette, S., Paillard, C., Koken, M., 2008a. Construction of a stable GFP-tagged Vibrio harveyi strain for bacterial dynamics analysis of abalone infection. FEMS Microbiol. Lett. 289, 34–40. Travers, M.A., da Silva, P.M., Le Goic, N., Marie, D., Donval, A., Huchette, S., et al., 2008b. Morphologic, cytometric and functional characterisation of abalone (Haliotis tuberculata) haemocytes. Fish Shellfish Immunol. 24, 400–411. Travers, M.A., Le Goic, N., Huchette, S., Koken, M., Paillard, C., 2008c. Summer immune depression associated with increased susceptibility of the European abalone, Haliotis tuberculata to Vibrio harveyi infection. Fish Shellfish Immunol. 25, 800–808. Travers, M.A., Basuyaux, O., Le Goic, N., Huchette, S., Nicolas, J.L., Koken, M., et al., 2009a. Influence of temperature and spawning effort on Haliotis tuberculata mortalities caused by Vibrio harveyi: an example of emerging vibriosis linked to global warming. Glob. Change Biol. 15, 1365–1376. Travers, M.A., Le Bouffant, R., Friedman, C.S., Buzin, F., Cougard, B., Huchette, S., et al., 2009b. Pathogenic Vibrio harveyi, in contrast to non-pathogenic strains, intervenes with the p38 MAPK pathway to avoid an abalone haemocyte immune response. J. Cell. Biochem. 106, 152–160. Travers, M.A., Meistertzheim, A.L., Cardinaud, M., Friedman, C.S., Huchette, S., Moraga, D., et al., 2010. Gene expression patterns of abalone, Haliotis tuberculata, during successive infections by the pathogen Vibrio harveyi. J. Invertebr. Pathol. 105, 289–297. van der Merwe, M., Franchini, P., Roodt-Wilding, R., 2011. Differential growth-related gene expression in abalone (Haliotis midae). Mar. Biotechnol. 13, 1125–1139. Veiga, E., Cossart, P., 2006. The role of clathrin-dependent endocytosis in bacterial internalization. Trends Cell Biol. 16, 499–504. Vidal-Dupiol, J., Dheilly, N.M., Rondon, R., Grunau, C., Cosseau, C., Smith, K.M., et al., 2014. Thermal stress triggers broad Pocillopora damicornis transcriptomic remodeling, while Vibrio coralliilyticus infection induces a more targeted immuno-suppression response. PLoS ONE 9, e107672. Wang, G.D., Zhang, K.F., Zhang, Z.P., Zou, Z.H., Jia, X.W., Wang, S.H., et al., 2008a. Molecular cloning and responsive expression of macrophage expressed gene from small abalone Haliotis diversicolor supertexta. Fish Shellfish Immunol. 24, 346–359. Wang, K.J., Ren, H.L., Xu, D.D., Cai, L., Yang, M., 2008b. Identification of the up-regulated expression genes in hemocytes of variously colored abalone (Haliotis diversicolor Reeve, 1846) challenged with bacteria. Dev. Comp. Immunol. 32, 1326–1347. Wang, N., Whang, I., Lee, J., 2008c. A novel C-type lectin from abalone, Haliotis discus discus, agglutinates Vibrio alginolyticus. Dev. Comp. Immunol. 32, 1034–1040. Wang, S.H., Wang, Y.L., Zhang, Z.X., Jack, R., Weng, Z.H., Zou, Z.H., et al., 2004. Response of innate immune factors in abalone Haliotis diversicolor supertexta to pathogenic or nonpathogenic infection. J. Shellfish Res. 23, 1173–1177. Wiens, M., Korzhev, M., Krasko, A., Thakur, N.L., Perovic-Ottstadt, S., Breter, H.J., et al., 2005. Innate immune defense of the sponge Suberites domuncula against bacteria involves a MyD88-dependent signaling pathway – induction of a perforin-like molecule. J. Biol. Chem. 280, 27949–27959. Wilcoxon, F., 1945. Individual comparisons by ranking methods. Biometr. Bull. 1, 80–83. Wilmore, D.W., Shabert, J.K., 1998. Role of glutamine in immunologic responses. Nutrition 14, 618–626. Wright, A.C., Simpson, L.M., Oliver, J.D., 1981. Role of iron in the pathogenesis of Vibrio vulnificus infections. Infect. Immun. 34, 503–507. Yuan, J.S., Reed, A., Chen, F., Stewart, C.N., 2006. Statistical analysis of real-time PCR data. BMC Bioinformatics 7.

Please cite this article in press as: Marion Cardinaud, Nolwenn M. Dheilly, Sylvain Huchette, Dario Moraga, Christine Paillard, The early stages of the immune response of the European abalone Haliotis tuberculata to a Vibrio harveyi infection, Developmental and Comparative Immunology (2015), doi: 10.1016/j.dci.2015.02.019