The effect of dendritic cells on the retinal cell transplantation

Biochemical and Biophysical Research Communications 363 (2007) 292–296 www.elsevier.com/locate/ybbrc

The effect of dendritic cells on the retinal cell transplantation Akio Oishi a, Takayuki Nagai b, Michiko Mandai Nagahisa Yoshimura a b

b,*

, Masayo Takahashi b,

a Department of Ophthalmology and Visual Sciences, Kyoto University Graduate School of Medicine, Japan Laboratory for Retinal Regeneration, Center for Developmental Biology, RIKEN, 2-2-3 Minatojima-minamimachi, Chuo-ku, Kobe 650-0047, Japan

Received 7 August 2007 Available online 5 September 2007

Abstract The potential of bone marrow cell-derived immature dendritic cells (myeloid iDCs) in modulating the efficacy of retinal cell transplantation therapy was investigated. (1) In vitro, myeloid iDCs but not BMCs enhanced the survival and proliferation of embryonic retinal cells, and the expression of various neurotrophic factors by myeloid iDCs was confirmed with RT-PCR. (2) In subretinal transplantation, neonatal retinal cells co-transplanted with myeloid iDCs showed higher survival rate compared to those transplanted without myeloid iDCs. (3) CD8 T-cells reactive against donor retinal cells were significantly increased in the mice with transplantation of retinal cells alone. These results suggested the beneficial effects of the use of myeloid iDCs in retinal cell transplantation therapy.  2007 Elsevier Inc. All rights reserved. Keywords: Retinal degeneration; Transplantation; Dendritic cell; Bone marrow cell; Immune tolerance

Retinal diseases with photoreceptor loss, for example retinitis pigmentosa or age-related macular degeneration, are major causes of acquired blindness in developed countries. Although there is no effective therapy to restore the cell death and recover retinal function to date, cell transplantation therapy now emerges as a promising treatment. Since Takahashi et al. showed that adult hippocampusderived neural stem cells transplanted into the vitreous of neonatal normal rats survived and integrated into the host retina [1], various types of donor cells have been studied for retinal transplantation. The cell source applied to date include brain-derived neural progenitor cells [2–6], bone marrow cells [7], genetically modulated retinal pigment epithelium cells [8], and retinal progenitor/stem cells [9–13]. Recently, MacLaren et al. demonstrated that neonatal retinal cells can differentiate into rod photoreceptors, form synaptic connections, and improve light reflex, if the cells were taken at the time coincident with the peak of rod gen-

*

Corresponding author. Fax: +81 78 306 0101. E-mail address: [email protected] (M. Mandai).

0006-291X/$ - see front matter  2007 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2007.08.152

esis [14]. However, the percentage of integrating cells remains to be only 0.03–0.1% of the transplanted cells. If a larger proportion of these cells integrate into host retina, the efficacy of the therapy will be much greater. DC, a professional antigen-presenting cell that primarily regulates immune response, is shown to promote proliferation, survival of neural stem/precursor cells, and functional recovery in spinal cord injury model [15]. The presumed mechanism of the effect includes neurotrophic factors that DC secretes or expresses on cell surface. Another probable mechanism is that host microglia/macrophages are activated by DC and scavenge scarring tissue and myelin debris containing inhibitors of axonal regeneration. DC also acts as an immune modulating agent. Immature DC can induce immune tolerance, while mature DC induces immune response [16,17]. Taking advantage of this nature, graft-specific immune tolerance are attempted and some experimental studies have already shown the effect on graft survival [18]. We assumed that these features of DC may provide overall beneficial effects for retinal transplantation. Therefore, in the present study, we attempted to evaluate the

A. Oishi et al. / Biochemical and Biophysical Research Communications 363 (2007) 292–296

effect of DC on retinal cells both in vitro and in vivo as well as immunomodulatory effect of DC in transplantation models. Materials and methods Animals. Animals were always treated according to the regulations in the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and the Guideline for Animal Experiments of Kyoto University. All animal experiments were conducted with the approval of the Animal Research Committee, Graduate School of Medicine, Kyoto University. C3H/HeJ (C3H;H2Kk) mice were purchased from the Shimizu Laboratory Supplies (Kyoto, Japan). Green mice (CAG-GFP transgenic mice) were kindly provided by Dr. Masaru Okabe (Osaka University, Japan) [19]. Propagation of dendritic cells (DC). The BM-derived myeloid DCs were propagated as described previously [20,21]. The BMCs were flushed from femurs and tibias of 8-week-old C3H mice, and passed through mesh membrane to remove debris. The cells were cultured for 8 days in RPMI1640 (Invitrogen-Gibco, Rockville, MD) with 10% fetal calf serum , 2mM L-glutamine (Sigma–Aldrich, St. Louis, MO), 100 U/ml penicillin 100 lg/ ml streptomycin, HEPES (N-2-hydroxyethylpiperazine-N 0 -2-ethane-sulfonic acid), 50 lM 2-mercaptoethanol (all from Sigma). At day 0, BMCs were seeded at a density of 2 · 107 per 100-mm dish in 10 ml of medium containing 50 U/ml (=10 ng/ml) rmGM-CSF (Peprotech/Tebu, Frankfurt, Germany). On day 3, another 10 ml medium containing 50 U/ml rmGM-CSF was added to the plates. On day 6 half of the culture supernatant was collected, centrifuged, and the cell pellet resuspended in 10 ml fresh medium containing 25 U/ml rmGM-CSF were re-plated. On day 8–10, cells were collected and used for further experiments. For the characterization of the DC used in the experiment, FITC-conjugated CD86 and PE-conjugated CD11c (BD pharmingen) were used. In vitro effect of DC on retinal cells. Neural retinas without retinal pigment epitheliums were obtained from embryo day 17.5 GFP-expressing transgenic mice. They were processed with Papain Dissociation kit (Worthington, Lakewood, NJ) according to the manufacturer’s protocol and single separated cells were obtained. These cells were plated in 96-well plate at a concentration of 5 · 104 cells per well containing 100 ll serumfree Dulbecco’s modified Eagle’s medium–Ham’s F12 (DMEM–F12: Gibco, Rockville, MD) Each well was treated with one of the following: iDCs (4 · 104), fresh BMCs (4 · 104), supernatant of iDCs culture medium, 20 ng/ml basic fibroblast growth factor (bFGF; Genzyme, Cambridge, MA) + 1% N2 supplement (Gibco), bFGF + N2 supplement + iDCs supernatant, or none of them (n = 10). The iDCs supernatant was prepared from day 8 DC by culturing for 48 h using serum-free DMEM– F12. The number of GFP-positive neurospheres with diameter larger than 10 lm in each well was counted after 7 days. Polymerase chain reaction (PCR). Gene expression of mitogenic and neurotrophic factors was examined in iDCs and BMCs, respectively. Total RNA of day 10 iDCs and fresh BMCs was isolated following Trizol method (Gibco). Synthesis of cDNA was carried out with First-strand cDNA synthesis kit (Amersham Bioscience, Piscataway, NJ) according to the manufacturer’s protocol. The primers used were as follows: brainderived neurotrophic factor (Bdnf, NM_001048139.1): forward—atgtctatgagggttcggcg, reverse—gcgagttccagtgccttttg; basic fibroblast growth factor (bFGF, NM_008006.1): forward—ttcaaggaccccaagcgg, reverse— tagtttgacgtgtgggtcgctc; ciliary neurotrophic factor (Cntf, NM_053007.2): forward—aatccacagccaggaatttg, reverse—agtcgctctgcctcagtcat; epidermal growth factor (Egf, NM_010113.2): forward—taccagacgatgatgggaca, reverse—cagtgttgatgcacctggac; glial cell line-derived neurotrophic factor (Gdnf, NM_010275.2): forward—tatcctgaccagtttgatga, reverse— tctaaaaacgacaggtcgtc; insulin-like growth factor-1 (Igf1, NM_010512.3): forward—cacccacaaaacaacacctg, reverse—cacgaactgaagagcatcca; nerve growth factor-b (Ngfb, NM_013609.1): forward—gtgaagatgctgtgcctcaa, reverse—ctgtgtcaagggaatgctga; neurotrophin-3 (Nt-3, NM_008742.2): forward—cggatgccatggttacttct, reverse—agcgtctctgttgccgtagt; neurotrophin4/5(Nt-4/5), NM_198190.1: forward—agagtgaggaggtggaggtg, reverse—

293

actcactgcgtcgcatactg; platelet-derived growth factor A (Pdgfa, NM_008808.3) forward—acttcctgatctggcccc, reverse—gtgttcctctaacct cacctgg; platelet derived growth factor B(Pdgfb), NM_011057.3: forward—caggtactgcacgtatcag, reverse—acagtgtttctaagggtgac; tumor growth factor-b1 (Tgfb1, NM_011577.1): forward—ctttaggaaggacctgggtt, reverse—caggagcgcacaatcatgtt; 30-cycle PCR was performed using Ampli Taq Gold (Applied Biosystems, Foster, CA). Subretinal transplantation. Postnatal 3- to 5-day retinal cells from GFP mice were dissociated with trypsin EDTA. Three-week-old recipient C3H mice were divided into three groups: group1 transplantation with 150,000 retinal cells per eye; group 2 transplantation with 150,000 retinal cells with 50,000 host-strain-derived myeloid iDCs; group 3 transplantation with PBS only. Per scleral subretinal transplantation was performed for both eyes of each mouse. The animals were kept for 2 weeks and sacrificed. The eyes were enucleated, fixed with 4% paraformaldehyde, and processed for paraffin sections. A total of 12 eyes were evaluated for group 1 and 2, and 6 eyes for group 3. The eyes were examined to check whether grafted GFPpositive cells survive in the host retina or anywhere in the eye globe, ie. subretinal space or in the vitreous cavity. Immunologic evaluation using flow-cytometric analysis. The spleen was collected from the host mice (three mice from each group) at the time of sacrifice and splenic cells were dissociated using Pharmlyse (BD Pharmingen, San Diego, CA) according to the manufacturer’s protocol. The population of activated CD8 T-cells were evaluated by the CD107a mobilization [22] by flow-cytometric analysis as previously described by Rubio et al. [23] with modification. Briefly, cells (5 · 105) were placed in each well of 96-well round-bottomed plate and incubated in CO2 incubator with (1) anti-CD107a antibody alone, (2) anti-CD107a antibody with 1 · 105 dissociated retinal cells from BL-6 mouse, or (3) anti-CD107a antibody with PMA (25 ng/ml) and ionomycin (1 lg/ml) in 100-ll reaction medium (AIM-V, Invitrogen). Each reaction was performed in triplicate. The reaction was then stopped after 3 h by adding 1 ml PBS and the cells were rinsed, then stained with anti-CD3 antibody and anti-CD8 antibody. CD107a-positive cells among CD3+CD8+ cells were then determined using flow-cytometric analysis. Statistical analysis. Statistical analysis was carried out using the statistic software SPSS. Data between each group in co-culture examination were compared using one-way ANOVA followed by Bonferroni test. Chisquare test and unpaired t-test were used for the analysis of cell survival/ migration in transplantation and of immunologic reactivity of host T-cells, respectively. Statistical significance was declared at p < 0.05.

Results First, DC used in our experiment was characterized. Approximately 75% of cultured cells were CD11c-positive CD86-negative, which was compatible with the phenotype of immature DC (Fig. 1). Embryonic retinal cells cultured with myeloid iDCs or its supernatant produced larger numbers of neurospheres compared to those cultured in control medium or with BMCs. Although the mitogenic effect of myeloid iDCs or its supernatant was smaller than that of bFGF and N2 supplement, iDCs supernatant showed an additive effect to them (Fig. 2). Since myeloid iDCs seem to have neural mitogenic effect, we examined the RNA expressions of mitogenic as well as some neurotrophic factors by reverse transcription-PCR (RTPCR). Among the factors detected, EGF and GDNF were expressed in myeloid iDCs but not in BMCs, and the expression levels of BDNF, bFGF, PDGFA, and PDGFB were higher in iDCs than in BMCs (Fig. 3). Next, we investigated whether these myeloid iDCs modulate the survival and host integration of the transplanted

294

A. Oishi et al. / Biochemical and Biophysical Research Communications 363 (2007) 292–296

Fig. 1. FACS analysis of myeloid DCs used in the present study. Approximately 75% of cultured cells were CD11c-positive CD86-negative, which was consistent with immature DC phenotype.

Fig. 2. The number of neurospheres in each culture condition. Data are shown as means ± SEM; *p < 0.05 one-way ANOVA followed by Bonferroni test. Note the enhancement in neurosphere formation-inducing activity by myeloid iDCs or its supernatant, as compared to BMCs or control medium. The effect of bFGF was larger than that of myeloid iDCs or its supernatant but iDC supernatant added with bFGF showed additional effect.

cells in vivo. The eyes with surviving transplanted cells were counted for each group. The injection site was confirmed in all the eyes. The transplanted retinal cells had a better chance for survival when co-transplanted with myeloid iDCs. The number of eyes with surviving grafted cells anywhere in the globe was 10 out of 12 eyes in iDCs co-transplantation group while the rate declines to 5 eyes out of 12 when retinal cells were transplanted without iDCs. The difference between the two groups was statistically significant (v2-test, p = 0.035). Among the eyes with surviving cells, grafted retinal cells were observed in the host retina in 10/10 of the eyes transplanted with iDCs and 4/5 eyes of

Fig. 3. The result of RT-PCR for various mitogenic and neurotrophic factors. (Left) cDNA from myeloid iDCs, (right) cDNA from fresh BMCs. Note that EGF and GDNF are detected in iDC but not in BMCs and signal intensity of BDNF, bFGF, PDGFA, and PDGFB are higher in iDCs.

the group transplanted without iDCs. By defining the migration rate as the number of eyes with grafted retinal cells in the host retina vs the number of eyes with grafted retinal cells anywhere in the eye globe, the migration rates of the two groups were not significantly different (v2-test, p = 0.17). Finally, we investigated the immune-modulating potential of iDCs in retinal transplantation. The splenic T-cells

A. Oishi et al. / Biochemical and Biophysical Research Communications 363 (2007) 292–296

Fig. 4. Population of CD107a-positive cells among CD8 splenic cells of host mice. Control, transplanted with PBS only; RPC, transplanted with 150,000 retinal cells; RPC + DC, transplanted with 150,000 retinal cells with 50,000 iDCs. The population is the average from three mice with the subtraction of background CD107a-positive population (CD107a-positive population of CD8 cells from control mice after 3 h incubation with no stimulation). T-cells are activated by RPC but it was inhibited with the cotransplantation of iDCs.

were obtained from the host mice 2 weeks after transplantation. In the group transplanted with PBS (no cells), 3.6% of CD8 T-cells became CD107a-positive by the incubation with allo-retinal cells. The percentage of CD107a-positive CD8 T-cells was significantly increased in the group with retinal cell transplantation without host-strain iDC (10%, p = 0.02, unpaired t-test), whereas there was no significant increase in CD107a-positive CD8 T-cell population in the mice with retinal-iDC co-transplantation (5.8%) (Fig. 4). Discussion Here we demonstrated the effects of myeloid iDCs on retinal cells in vitro and in vivo retinal transplantation models. Retinal neurosphere formation was enhanced by iDCs co-culture as well as by the addition of iDCs supernatant. This suggested that the iDCs may secrete some soluble mitogenic factors for retinal neurospheres. Although bFGF, known to be a potent mitogenic factor for neural progenitor cells, showed stronger mitogenic activity than iDCs, the combined treatment of iDCs supernatant with bFGF further enhanced the sphere formation, which may indicate that these cell secret some mitogenic factors other than bFGF. Among the mitogenic factors investigated, GDNF and EGF were expressed by myeloid iDCs but not in BMCs; signal intensity of bFGF, PDGFA and PDGFB was somewhat higher in myeloid iDCs than in BMCs. Myeloid iDCs also expressed a higer level of BDNF, a well-known neurotrophic factor. From the in vitro effect of the myeloid iDCs observed in our results, these cells were expected to contribute to the survival and, possibly, integration of the transplanted retinal cells. As expected, retinal cells transplanted with iDCs survived in more than 80% (10/12) of the eyes with retinal degeneration, compared to 5/12 of those without iDCs. The surviving cells were mostly present within the host ret-

295

ina in both groups and therefore the migration rate (cells detected within the host retina/anywhere in the eye globe) was not different with or without the transplantation of myeloid DCs. Whether the better chance of survival contributed to a better migration rate, or only the migrated cells had a better chance of survival, are still to be determined, but considering the profile of soluble factors secreted by myeloid iDCs, these cells could positively contribute to either of these effects. Our immunologic analysis suggested some additional mechanism for the enhancement of donor cell survival. While mature DCs act as antigen-presenting cells and promote inflammation, immature DCs induce immune tolerance and can reduce rejecting reaction against donor graft (see reviews, [18,24]). Retinal cells, particularly those of neonates, are considered to have low antigenicity but they are not completely antigen free [25]. They also have a possibility to become antigenic when they become mature enough to express HLAII. Furthermore, donor microglias, which are normally present in retinal allograft, can be potent antigen-presenting cells in situ to exacerbate immune reaction [26,27]. Several reports have shown that immature DC injected prior to the transplantation prolonged heart [28–33], pancreatic islet [34], and intestine [35] allograft survival. Likewise, our result supports the possibility that immature DC can reduce the risk of graft rejection in retinal transplantation therapy. In our experiments, although these iDCs improved the survival rate of transplanted cells, the number of survived cells was still too few for the therapeutic purpose. In rd mice, photoreceptors degenerate rapidly in 2–4 weeks after birth and degenerated cells are swiftly removed. Considering this cleaning process, poorly integrated graft cells may have few chances to survive in the subretinal space. The timing of transplantation in these models should be further premeditated. The survived cells did not express retinal markers efficiently either (data not shown). Additional strategy is needed to adjust the environment for the graft cells to stably survive and mature. Acknowledgment This study was supported by the Advanced and Innovational Research program in Life Sciences from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) of the Japanese Government. References [1] M. Takahashi, T.D. Palmer, J. Takahashi, F.H. Gage, Widespread integration and survival of adult-derived neural progenitor cells in the developing optic retina, Mol. Cell. Neurosci. 12 (1998) 340–348. [2] M.J. Young, J. Ray, S.J. Whiteley, H. Klassen, F.H. Gage, Neuronal differentiation and morphological integration of hippocampal progenitor cells transplanted to the retina of immature and mature dystrophic rats, Mol. Cell. Neurosci. 16 (2000) 197–205. [3] A. Nishida, M. Takahashi, H. Tanihara, I. Nakano, J.B. Takahashi, A. Mizoguchi, C. Ide, Y. Honda, Incorporation and differentiation of

296

[4]

[5]

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16] [17]

[18] [19]

[20]

A. Oishi et al. / Biochemical and Biophysical Research Communications 363 (2007) 292–296 hippocampus-derived neural stem cells transplanted in injured adult rat retina, Invest. Ophthalmol. Vis. Sci. 41 (2000) 4268–4274. Y. Kurimoto, H. Shibuki, Y. Kaneko, M. Ichikawa, T. Kurokawa, M. Takahashi, N. Yoshimura, Transplantation of adult rat hippocampus-derived neural stem cells into retina injured by transient ischemia, Neurosci. Lett. 306 (2001) 57–60. J. Akita, M. Takahashi, M. Hojo, A. Nishida, M. Haruta, Y. Honda, Neuronal differentiation of adult rat hippocampus-derived neural stem cells transplanted into embryonic rat explanted retinas with retinoic acid pretreatment, Brain Res. 954 (2002) 286–293. H. Mizumoto, K. Mizumoto, M.A. Shatos, H. Klassen, M.J. Young, Retinal transplantation of neural progenitor cells derived from the brain of GFP transgenic mice, Vision Res. 43 (2003) 1699–1708. M. Tomita, Y. Adachi, H. Yamada, K. Takahashi, K. Kiuchi, H. Oyaizu, K. Ikebukuro, H. Kaneda, M. Matsumura, S. Ikehara, Bone marrow-derived stem cells can differentiate into retinal cells in injured rat retina, Stem Cells 20 (2002) 279–283. L. Liang, R.T. Yan, W. Ma, H. Zhang, S.Z. Wang, Exploring RPE as a source of photoreceptors: differentiation and integration of transdifferentiating cells grafted into embryonic chick eyes, Invest. Ophthalmol. Vis. Sci. 47 (2006) 5066–5074. D.M. Chacko, J.A. Rogers, J.E. Turner, I. Ahmad, Survival and differentiation of cultured retinal progenitors transplanted in the subretinal space of the rat, Biochem. Biophys. Res. Commun. 268 (2000) 842–846. P. Yang, M.J. Seiler, R.B. Aramant, S.R. Whittemore, In vitro isolation and expansion of human retinal progenitor cells, Exp. Neurol. 177 (2002) 326–331. P. Yang, M.J. Seiler, R.B. Aramant, S.R. Whittemore, Differential lineage restriction of rat retinal progenitor cells in vitro and in vivo, J. Neurosci. Res. 69 (2002) 466–476. K. Canola, B. Angenieux, M. Tekaya, A. Quiambao, M.I. Naash, F.L. Munier, D.F. Schorderet, Y. Arsenijevic, Retinal stem cells transplanted into models of late stages of retinitis pigmentosa preferentially adopt a glial or a retinal ganglion cell fate, Invest. Ophthalmol. Vis. Sci. 48 (2007) 446–454. K. Warfvinge, J.F. Kiilgaard, H. Klassen, P. Zamiri, E. Scherfig, W. Streilein, J.U. Prause, M.J. Young, Retinal progenitor cell xenografts to the pig retina: immunological reactions, Cell Transplant. 15 (2006) 603–612. R.E. MacLaren, R.A. Pearson, A. MacNeil, R.H. Douglas, T.E. Salt, M. Akimoto, A. Swaroop, J.C. Sowden, R.R. Ali, Retinal repair by transplantation of photoreceptor precursors, Nature 444 (2006) 203–207. Y. Mikami, H. Okano, M. Sakaguchi, M. Nakamura, T. Shimazaki, H.J. Okano, Y. Kawakami, Y. Toyama, M. Toda, Implantation of dendritic cells in injured adult spinal cord results in activation of endogenous neural stem/progenitor cells leading to de novo neurogenesis and functional recovery, J. Neurosci. Res. 76 (2004) 453–465. M.A. Wallet, P. Sen, R. Tisch, Immunoregulation of dendritic cells, Clin. Med. Res. 3 (2005) 166–175. J. Kubach, C. Becker, E. Schmitt, K. Steinbrink, E. Huter, A. Tuettenberg, H. Jonuleit, Dendritic cells: sentinels of immunity and tolerance, Int. J. Hematol. 81 (2005) 197–203. S.M. Barratt-Boyes, A.W. Thomson, Dendritic cells: tools and targets for transplant tolerance, Am. J. Transplant. 5 (2005) 2807–2813. M. Okabe, M. Ikawa, K. Kominami, T. Nakanishi, Y. Nishimune, ‘Green mice’ as a source of ubiquitous green cells, FEBS Lett. 407 (1997) 313–319. M.B. Lutz, N. Kukutsch, A.L. Ogilvie, S. Rossner, F. Koch, N. Romani, G. Schuler, An advanced culture method for generating

[21]

[22]

[23]

[24] [25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

large quantities of highly pure dendritic cells from mouse bone marrow, J. Immunol. Methods 223 (1999) 77–92. M.B. Lutz, R.M. Suri, M. Niimi, A.L. Ogilvie, N.A. Kukutsch, S. Rossner, G. Schuler, J.M. Austyn, Immature dendritic cells generated with low doses of GM-CSF in the absence of IL-4 are maturation resistant and prolong allograft survival in vivo, Eur. J. Immunol. 30 (2000) 1813–1822. G. Alter, J.M. Malenfant, M. Altfeld, CD107a as a functional marker for the identification of natural killer cell activity, J. Immunol. Methods 294 (2004) 15–22. V. Rubio, T.B. Stuge, N. Singh, M.R. Betts, J.S. Weber, M. Roederer, P.P. Lee, Ex vivo identification, isolation and analysis of tumor-cytolytic T cells, Nat. Med. 9 (2003) 1377–1382. G. Raimondi, A.W. Thomson, Dendritic cells, tolerance and therapy of organ allograft rejection, Contrib. Nephrol. 146 (2005) 105–120. T.F. Ng, H. Osawa, J. Hori, M.J. Young, J.W. Streilein, Allogeneic neonatal neuronal retina grafts display partial immune privilege in the subcapsular space of the kidney, J. Immunol. 169 (2002) 5601–5606. N. Ma, J.W. Streilein, Contribution of microglia as passenger leukocytes to the fate of intraocular neuronal retinal grafts, Invest. Ophthalmol. Vis. Sci. 39 (1998) 2384–2393. D.S. Gregerson, T.N. Sam, S.W. McPherson, The antigen-presenting activity of fresh, adult parenchymal microglia and perivascular cells from retina, J. Immunol. 172 (2004) 6587–6597. F. Fu, Y. Li, S. Qian, L. Lu, F.D. Chambers, T.E. Starzl, J.J. Fung, A.W. Thomson, Costimulatory molecule-deficient dendritic cell progenitors induce T cell hyporesponsiveness in vitro and prolong the survival of vascularized cardiac allografts, Transplant. Proc. 29 (1997) 1310. L. Lu, W. Li, F. Fu, F.G. Chambers, S. Qian, J.J. Fung, A.W. Thomson, Blockade of the CD40–CD40 ligand pathway potentiates the capacity of donor-derived dendritic cell progenitors to induce long-term cardiac allograft survival, Transplantation 64 (1997) 1808–1815. H.A. DePaz, O.O. Oluwole, A.O. Adeyeri, P. Witkowski, M.X. Jin, M.A. Hardy, S.F. Oluwole, Immature rat myeloid dendritic cells generated in low-dose granulocyte macrophage-colony stimulating factor prolong donor-specific rat cardiac allograft survival, Transplantation 75 (2003) 521–528. J.X. Gao, J. Madrenas, W. Zeng, M.J. Cameron, Z. Zhang, J.J. Wang, R. Zhong, D. Grant, CD40-deficient dendritic cells producing interleukin-10, but not interleukin-12, induce T-cell hyporesponsiveness in vitro and prevent acute allograft rejection, Immunology 98 (1999) 159–170. M.M. Tiao, L. Lu, R. Tao, L. Wang, J.J. Fung, S. Qian, Prolongation of cardiac allograft survival by systemic administration of immature recipient dendritic cells deficient in NF-kappaB activity, Ann. Surg. 241 (2005) 497–505. P. Bjorck, P.T. Coates, Z. Wang, F.J. Duncan, A.W. Thomson, Promotion of long-term heart allograft survival by combination of mobilized donor plasmacytoid dendritic cells and anti-CD154 monoclonal antibody, J. Heart Lung Transplant. 24 (2005) 1118–1120. C. Rastellini, L. Lu, C. Ricordi, T.E. Starzl, A.S. Rao, A.W. Thomson, Granulocyte/macrophage colony-stimulating factor-stimulated hepatic dendritic cell progenitors prolong pancreatic islet allograft survival, Transplantation 60 (1995) 1366–1370. D. Sheng Sun, H. Iwagaki, M. Ozaki, T. Ogino, S. Kusaka, Y. Fujimoto, H. Murata, H. Sadamori, H. Matsukawa, N. Tanaka, T. Yagi, Prolonged survival of donor-specific rat intestinal allograft by administration of bone-marrow-derived immature dendritic cells, Transplant. Immunol. 14 (2005) 17–20.