The effect of flavonoids on transduction mechanisms in lipopolysaccharide-treated human gingival fibroblasts

International Immunopharmacology 7 (2007) 1199 – 1210 www.elsevier.com/locate/intimp

The effect of flavonoids on transduction mechanisms in lipopolysaccharide-treated human gingival fibroblasts Gloria Gutiérrez-Venegas a,⁎, Manuel Jiménez-Estrada b , Silvia Maldonado a a

Laboratorio de Bioquímica de la División de Estudios de Posgrado de la Facultad de Odontología, Universidad Nacional Autónoma de México (UNAM), Ciudad Universitaria, Mexico City, Mexico b Instituto de Química, Ciudad Universitaria, Mexico City, Mexico Received 28 February 2007; received in revised form 26 April 2007; accepted 10 May 2007

Abstract Periodontal disease comprises a group of infections that lead to inflammation of the gingival and destruction of periodontal tissues and is accompanied by the loss of the alveolar bone with eventual exfoliation of the teeth. Porphyromonas gingivalis is a Gramnegative bacteria obtained from the periodontal pocket of patients with aggressive and chronic periodontitis. This bacteria presents in the external membrane lipopolysaccharide (LPS). Flavonoids are molecules obtained from plants and possess anti-inflammatory properties. Herein we characterize the effect of the flavonoids quercetin, genistein, luteolin, and quercetagetin on LPS-activated transduction mechanism regulation in human gingival fibroblasts (HGF). In this study, we investigated the role of the previously mentioned flavonoids on mitogen-activated protein kinase (MAPK) activation induced by LPS obtained from P. gingivalis. Our results showed that LPS treatment induces activation of extracellular signal related kinase 1/2 (ERK1/2), p38, and c-jun-NH2-terminal kinase (JNK). All flavonoids demonstrated an inhibitory effect on MAPK activation, interleukin, 1β, and cyclooxygenase-2 (COX-2) expression, IL-1β and prostaglandin E2 (PGE2) synthesis. The most active flavonoid was quercetagetin. Finally we found that the treatment with quercetagetin had no effect on cellular viability or in genetic material integrity. Published by Elsevier B.V. Keywords: Human gingival fibroblasts; Extracellular regulated kinase 1/2 (ERK1/2), p38; Lipopolysaccharides; Flavonoids

1. Introduction Periodontitis is an infectious disease that leads to the destruction of the tooth-supporting tissues, the periodontal ligament, the gingival connective tissue, and the alveolar bone [22–24]. Accumulation of dental plaque,

⁎ Corresponding author. Tel./fax: + 525 56 22 55 54. E-mail address: [email protected] (G. Gutiérrez-Venegas). 1567-5769/$ - see front matter. Published by Elsevier B.V. doi:10.1016/j.intimp.2007.05.004

also denominated biofilm, is associated with periodontitis; there is clear evidence showing that the infection caused by a specific group of bacteria is sufficient for the disease to develop [2,26,35]. The biofilm is composed of N 300 different species of bacteria [25] that adhere to each other or to the connective tissue surface, which confers an increase in resistance to the diverse antimicrobial agents and to the host response [6,7,28]. Throughout the course of periodontal disease, there is an increase of up to 80% of Gram-negative microorganisms, which colonize the gingival groove forming sub-

1200

G. Gutiérrez-Venegas et al. / International Immunopharmacology 7 (2007) 1199–1210

gingival plaque; among the bacteria present are found Porphyromonas gingivalis, Actinobacillus actinomycetemcomitans, and Bacteroides forsythus. These bacteria present on the cell-wall surface of macromolecules termed lipopolysaccharides (LPS), which act on the cell surface, associating themselves with CD14 protein; because the latter lacks an intracellular domain, the LPSCD14 complex associates with and activates another protein receptor named the Toll-like receptor 4 (TLR-4) receptor, which stimulates a large number of intracellular signals, among which are found phospholipase A activation [11,34], phospholipase C activation, and an increase in intracellular calcium concentration [37]. Likewise, it produces an increase in the activity of tyrosine-kinase [15], p42/44 [39], and p38 [20], the activation of some or several of these proteins leading to the cell's production or liberation of inflammatory mediators such as prostaglandins, nitric oxide, and interleukins [20]. The LPS obtained from periodontal pathogens stimulate the host cells, among which are included gingival macrophages and fibroblasts, which produce and liberate cytokines such as interleukin-1 beta (IL-1β) and tumor necrosis factor alpha (TNF-α) [1,18,20,29,33,38]. Initial synthesis of these molecules comprises a palliative for combating the noxious effects of the microorganisms, but their continuous expression promotes chronic inflammatory processes. However, P. gingivalis LPS is an unusual molecule in that it engages TLR-2 but not TLR-4 in stably transfected CHO cell lines [3]. Therefore, a countless number of strategies have been designed to allow blocking of their expression. Among these are found neutralization with antibodies and the employment of diverse pharmaceuticals, which favors an improvement in disease management. On the other hand, flavonoids are compounds that are present in a large number of vegetables and plants. Flavonoids are divided into five sub-categories: flavones; flavanols; flavanons, flavanols, and anthocyanidins. Flavonoids possess antioxidant, anti-tumoral, anti-angiogenic, anti-inflammatory, anti-allergic, and anti-viral activity [10,12]. Among the molecular mechanisms in which flavonoids participate, we find kinase inhibition, because flavonoids compete for the binding site of the adenosine triphosphate (ATP) [8,13]; this action is of great importance in that activation of these kinases is a crucial event in the internal communication of the cell: on inhibiting its activity, it blocks cytokine synthesis and liberation. Luteolin is a flavone found at high concentrations in celery, green pepper, and chamomile, and has been characterized as the most potent and effective inhibitor of TNF-α and

interleukin-6 production and nitric oxide expression in LPS-stimulated macrophages [40]. Similarly, reports in the literature cite that activation by LPS of a great number of intracellular signals in macrophages and neutrophils can be blocked by flavonoids [40]. Because periodontal disease is occasioned by bacterial endotoxins, we proposed to study the effect of diverse flavonoids on the actions of LPS in human gingival fibroblasts (HGF). Likewise, there are reports in the literature noting that activation by LPS in a high number of macrophage and neutrophil intracellular signals can be blocked by flavonoids [9]. In previous studies, our group found that treatment with luteolin inhibits LPS-stimulated mitogen-activated protein kinase (MAPK) and the serine–threonine kinase, protein kinase B (AKT) activation. Similarly, luteolin blocks NF-κB translocation, COX-2 expression, and PGE2 synthesis [14]. On the other hand, Tagetes erecta is a flowering plant that presents a yellow tonality and that is very aromatic; T. erecta is utilized commonly to decorate altars and gravesites on November 2nd in All Soul's Day celebrations. It also possesses alimentary and medicinal aims in that it is recommended for stomach pain, against intestinal parasites, for control of diarrhea, to prevent colic, to diminish dental pain, and for use in intestinal lavages; in addition, it acts as an anti-inflammatory and is employed for respiratory problems such as fever, grippe, and bronchitis. Among the biologically active components present in this plant we found quercetagin, quercetagetin, tagetin, and flavonoids. In this work, we explore the effect of querecetagetin (3,5,6,7,3′,4′hexahydroxyflavone) obtained from T. erecta on MAPKs and I-κB phosphorylation, as well as on the expression and synthesis of COX-2 and IL-1β, and the synthesis of PGE-2 induced by the LPS of P. gingivalis; we compared its effects with those of genistein, luteolin, and quercetin. 2. Materials and methods 2.1. Reagents Dulbecco's modified Eagle medium (DMEM), fetal bovine serum (FBS), and Super Script One Step (RT-PCR) were acquired from Invitrogen (Carlsbad, CA, USA), while antibodies ERK1/2, p-ERK1/2 (Thr 202Ityr 204), p38, p-p38 (Tyr 182), γ-tubulin, and p-lκB-α (Ser-32), NF-κB, and the luminol reagent were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The lipopolysaccharide obtained from P. gingivalis was acquired from InvivoGen (San Diego, CA, USA), while the flavonoids quercetin, luteolin, and genistein were purchased from Aldrich-Sigma (St. Louis, MI, USA).

G. Gutiérrez-Venegas et al. / International Immunopharmacology 7 (2007) 1199–1210

2.2. Methods 2.2.1. Quercetagetin extraction For flavonoid extraction, we employed flowers from T. erecta gathered during October and November at Cuautla, Morelos State, Mexico's cultivated zone. Once the flowers were cut, we separated ligules from receptacles and used three 450-g lots of ligules, which we treated in different ways for their drying and extraction, obtaining two different extracts from each lot: 1) Fresh extract. Fraction A) was macerated in ethanol, and fraction B) was macerated in acetone–water (dilution, 2:3); 2) dry extract. The flower was submitted to drying in a stove at 70 °C for 12 h. We immediately obtained fraction A), which was macerated in ethanol, and fraction B), which was macerated in acetone–water (2:3), and the 3) extract in powder. The flower was dried (7 days) at room temperature and ground, from which fraction A) was obtained, this macerated in ethanol, and fraction B), macerated in acetone–water (2:3). To obtain T. erecta flavonoids, the solution was filtered after 24 h of maceration. The acetone in acetone–water extracts was eliminated by distillation; this was saturated with NaCl, filtered, and extracted with butanol. The butanol was concentrated reduced pressure pumps and the solids were resuspended in ethanol–ethyl acetate (1:2). Finally, the total flavonoids were precipitated with ethyl ether. The ethanol extracts were carried out by means of the same procedure. Flavonoid separation was performed utilizing reverse-phase chromatography and preparative chromatography. We obtained quercetagetin as a greenish-yellow crystalline powder (400 mg of N 310). It was identified by the following data: 2.2.2. Elemental analysis Calc. C15H10O8.H2O. C:53.66%, H:3.56%. Enc. C:53.58, H:3.88. IR vmax cm− 1: 3263, 16662.1601,1520. Quercetagetin N C 13CRMN 1HRMN 2 148.18 (C) 3 136.84 (C) 4 177.35 (C_O) 5 94.36 (CH) 6.50, s, 1H 6 151.15 (C) 7 154.60 (C) 8 130.66 (C) 9 129.73 (C) 10 104.81 (C) 1′ 148.66 (C) 2′ 116.23(CH) 7.73, d, 1H, J = 7.7 3′ 124.36 (C) 4′ 146.80 (CH) 5′ 121.69 (CH) 7.62, dd, 1H, J = 7.6 6′ 116.30 (CH) 6.87, d, 1H, J = 6.8 The 1H NMR spectra were recorded on Varian Gemini2000 and Varian VXR-300S of 300 MHz instruments. Tetramethyl silane was used as internal reference and MeOD was used as solvent. Infrared spectra were run with a Nicolet

1201

FT-IR 55X instrument. Melting point was determined on a Fisher–Johns apparatus. Human gingival fibroblast (HGF) culture. HGF were obtained in a sample of healthy tissue from patients presenting at the Exodontia Clinic after providing informed consent (Format FBQ-LIFO-001 ISO 9001:2000). The protocol for our human study was approved by the Ethical Committee of the División de Estudios de Posgrado de la Facultad de Odontología. Gingival tissue was cut surgically from the maxillary and washed six times with Hanks solution (Invitrogen) supplemented with penicillin/streptomycin/fungizone (Invitrogen). The gingival tissue was minced into 1–2-mm3 fragments and digested with mixture of trypsin 0.02% with EDTA 0.02% and collagenase 200 units/ml for 30–45 min at 36.7 °C until complete disaggregation occurred. The trypsin was removed by centrifugation and the cells were resuspended with DMEM (Invitrogen) supplemented with 2 mM of L-glutamine (Invitrogen), penicillin/streptomycin/fungizone (Invitrogen) 100 μg/ml, 100 μg/ml, and 1 mg/ml, respectively, and 10% of heatinactivated fetal bovine serum (FBS). The cells were incubated at 37 °C in an atmosphere of 5% of CO2. The fibroblasts were homologous, slim, and spindle-shaped. The colony of cells that presented this shape was isolated with clonal rings. The cells were tripsinized within the rings and seeded in 25-cm flasks. The cell culture was fed every 3 days until cells reached confluence; cells were utilized between passages 5 and 7 [32,36]. 2.2.3. Immunocytochemistry Cells were grown on glass coverslips and fixed for 30 min with 2% formaldehyde in PBS at 4 °C. Then, cells were permeabilized during 5 min with Triton 0.1% in PBS and washed five times with PBS. For NF-κB visualization, cells were treated for 1 h with primary antibodies, diluted 1:100 in PBS, and then washed five times with PBS. Cells were incubated 45 min with rhodamine conjugated to goat antimouse (Santa Cruz Biotechnology) diluted 1:100 in PBS. Samples were mounted in resin and examined with a confocal photomicroscope. Secondary antibodies were used as a control. Experiments were repeated at least three times each. 2.2.4. Western blot assay HGF (1 × 106 cells/well) were grown in 6-well plates during 24 h. After the stimulus, the medium was aspirated and the cells were detached aided by gendarme in PBS buffer (1 mM sodium orthovanadate): the sample was centrifuged at 5000 rpm for 10 min and the pastille was placed in 50 μg of lysis buffer (0.05 M Tris–HCI, pH 7.4, 0.15 M NaCl, 1% Nonidet P-40, 0.5 M PMSF, 10 μg/ml leupeptin, 0.4 mM sodium orthovanadate, 10 mM of sodium fluoride, and 10 mM of sodium pyrophosphate), all these reagents obtained from Sigma Chemical Co. The sample was sonicated (1 s × 30) in an ice bath. For Western blot assay, we used 50 μg of protein mixed 1:1 with 2× the sample buffer (20% glycerol, 4% sodium dodecyl sulfate (SDS), 10% 2-mercaptoethanol, 0.05% of bromophenol blue, and 1.25 M Tris–HCI pH 6.8 (all reagents from Sigma Chemical Co.), loaded this with a gel at 10% SDS-Polyacrylamide electrophoresis (SDS-PAGE), and ran it at 40 V for 2 h. The cellular proteins were transferred to a

1202

G. Gutiérrez-Venegas et al. / International Immunopharmacology 7 (2007) 1199–1210

Fig. 1. General structure of the flavonoids employed. Luteolin (3′,4′,5,7-tetrahydroxyflavone) presents biological activities such as antioxidant; Genistein (4′,5,7-trihydroxyisoflavone) is a phytoestrogen with a great variety of pharmacologic effects in animal cells, among which are included that of tyrosine-kinase inhibition. Luercetin (3,3′,4′,5,7-pentahydroxyflavone) is an abundant flavenol in onion that presents a broad range of pharmacologic properties such as anti-proliferative and protection effects against oxidative stress. Quercetagetin is a flavonol with the OH group in the 3,5,6,7,3′,4′ position. It presents anti-bacterial and anti-mycotic activities.

nitrocellulose membrane (Bio-Rad) for 30 min at 0.3 A and 5 V. To verify that an equal concentration of protein was placed in each situation, the membranes were dyed with Rojo de Ponceau (Sigma Chemical Co.). Subsequently, the membrane was blocked with 150 mM NaCl, 100 mM Tris–HCI pH 7.8 (TBST) and 5% of bovine albumin serum for 1 h, washed three times, and incubated with primary antibody, utilizing the following antibodies: antimouse monoclonal IgG phospho-extracellular signal-regulated kinase (ERK) (tyrosine-204) (1:5000), or anti-rabbit polyclonal extracellular signal-regulated kinase 1/2 (ERK1/2) (1:1000), or anti-mouse monoclonal pp38 (Tyr182) (1:5000), or anti-p38 (1:1000), or anti-goat polyclonal cyclooxygenase-2 (COX-2) (1:1000), or anti-mouse monoclonal p-lκB (1:1000) (Santa Cruz Biotechnology). The membranes were incubated overnight at 4 °C and were later washed three times with TBST and incubated for 2 h with the secondary antibody, HPR conjugated anti-mouse IgG (1:1000), or anti-rabbit IgG (1:1000), or anti-goat IgG (1:1000) (Santa Cruz Biotechnology). To demonstrate same protein contents, the membranes were denuded and incubated with antibodies that detect non-phosphorylated kinase forms. Immunoreactive bands were revealed utilizing chemoilluminescence (Santa Cruz Biotechnology) and auto X-ray was obtained after exposing the film for 2 min. Experiments were conducted on five separate occasions. Samples were analyzed by means of the digital LabWorks system. Experiments were carried out on three separate occasions, and a representative experiment was placed among the results. 2.2.5. Reverse transcriptase-polymerase chain reaction (RTPCR) assay Total RNA was isolated from HGF according to the Chomczynski and Sacchi method [5]. Total RNA (1 μg) was reverse transcribed (RT) utilizing One Step RT-PCR equipment (Invitrogen). PCR was performed using the following

oligonucleotides: 5′GGCTGCAGTTCAGTGATCGTACAGG3′ (sense) and 5′AGATCTAGAGTACCTGA GCTCGCCAGTGAA3′ (non-sense) derived from IL-1β (10), and 5′-TCCCTCAAGA TTGTCAGCAA-3′ (sense) and 5′-AGATCCACAACGGATACATT-3′ (non-sense) derived from the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene [27]. Amplifications comprised the following: denaturalization at 94 °C for 1 min, alignment at 55 °C for 1 min, and extension at 72 °C for 1.5 min. PCR was conducted for 35 cycles, and as RT-PCR results we obtained a 356 base-pair single band for IL-1β and a 309 base-pair single band for GAPDH. Fragment identity was characterized by its apparent size in ethidium bromide-dyed agarose gels, and five separate experiments were carried out for each treatment. 2.2.6. ELISA We positioned HGF-culture supernatants, and quantified PGE2 expression with the Quantitative ELISA Kit for PGE2 (Titer Zyme ELIA Kit Assay Designs). 2.3. Assay for IL-1β production IL-1β was determined in triplicate with a [125I] IL-1β assay system (Amersham). The assay is based on the competition between unlabelled IL-1β and fixed quantity of [125I]-labelled IL-1β for a limited number of binding sites on IL-1β specific antibodies. The radioactivity in each tube was determined with a gamma scintillation counter. 2.3.1. DNA fragmentation analysis. Human gingival fibroblasts at logarithmic growth phase were treated with luteolin. Cells were then collected by cell scraper and centrifuged at 500 ×g for 5 min. The cell pellet was then washed twice with PBS, and DNA was isolated and

G. Gutiérrez-Venegas et al. / International Immunopharmacology 7 (2007) 1199–1210

1203

Fig. 2. The dose response of quercetagin on lipopolysaccharide (LPS)-induced mitogen-activated protein kinase (MAPK) phosphorylation in human gingival fibroblasts (HGF). The cells (5 × 106 cells/ml) were pre-treated with different doses of quercetagetin (1, 5, 10, 12 μM for 30 min and afterward with LPS (1 μg/ml). A) Extracellular signal-regulated kinase 1/2 (ERK1/2) for 10 min, and B) p38, and C) Jun-N-terminal (JNK) for 15 min. The cells were processed for their analysis by Western blot utilizing anti-phospho ERK1/2, anti-phospho p38, and anti-phospho JNK. The membranes were denuded and antibodies were directed against ERK1/2, p38, and JNK non-phosphorylated forms as controls to demonstrate that the same protein concentration was loaded. The results obtained were similar in the three separate experiments processed; mean ± standard error of the mean (SEM) was obtained by densitometry, as shown in the graphic analysis.

quantified by DNAzol kit according to manufacturer specifications (Invitrogen). Ten micrograms of DNA were loaded into each 1% agarose gel well and electrophoresed in a buffer containing 0.04 M Tris, 0.04 M sodium acetate, and 1 mM EDTA, pH 8.0, at 100 V for 3 h at room temperature. Gels were stained with ethidium bromide, visualized by ultraviolet fluorescence, and photographed. The experiments were realized in three separate occasions. 2.3.2. Cell viability Cell viability was determined using the 3-(4,5dimethylthiazol.2.yl)-2.5-diphenyl tetrazolium bromide (MTT) assay. HFP were plated at 1 × 104 cells/well in a 96well culture plate. After an overnight culture period, cells were washed with DMEM medium and incubated with various

concentrations of luteolin, including DMFA: ethanol (1:1) was used as vehicle. After 24 h of incubation, 10 μl of MTT (5 mg/ml) was added to each well and cultured for another 4 h at 37 °C under 5% CO2 in air. Supernatants were discarded, and 100 μl of DMFA was added to each well to dissolve the formazan crystals produced. The optical density (OD) of formazan was measured at 540 nm using an ELISA reader. The mean values of three experiments carried out by triplicate were calculated in percentage values of control samples. 2.3.3. Statistical and data analysis The data presented correspond to the standard error of the mean (SEM) of the number of observations indicated previously. Nitrites were expressed as nmoles/12,000 cells, and PGE2 as ng/ml or even as a percentage of the control

1204

G. Gutiérrez-Venegas et al. / International Immunopharmacology 7 (2007) 1199–1210

value. Statistical comparisons were performed by post hoc, Newman–Keuls, or Student t tests. Differences between means were considered significant when p b 0.05. 3. Results 3.1. The effect of flavonoids on LPS-induced kinase activities of P. gingivalis With the purpose of determining the effect of flavonoids on transduction mechanism regulation, we utilized luteolin (a flavone), quercetin and quercetagetin (flavonols), and genistein (an isoflavone). The structure of these flavonoids is shown in Fig. 1.

3.2. The effect of quercetagetin on LPS-induced mitogenactivated protein kinase (MAPK) phosphorylation in HGF The genus Tagetes (Asteraceae) is composed of many species employed in traditional medicine. Infusions with leaves are used in intestinal diseases and also presented antimicrobial, anti-inflammatory, and antioxidant activities. The majority of activities have been focused on the characterization of flavonoids for conducting chemotaxonomy studies, and few reports exist concerning the determination of the effects of their bioactive components. Thus, we proposed to characterize the effect of quercetagetin on MAPK phosphorylation in LPS-treated human gingival fibroblasts.

Fig. 3. The effect of genistein, quercetin, luteolin, and quercetagetin on the phosphorylation of extracellular signal-regulated kinase ½ (ERK1/2), p38, and Jun-N-terminal (JNK) induced by lipopolysaccharides (LPS) in human gingival fibroblasts (HGF). The cells (5 × 106 cells/ml) were pre-treated with the different flavonoids (10 μM) for 30 min and afterward with LPS (1 μg/ml). A) Extracellular signal-regulated kinase 1/2 (ERK1/2) for 10 min, and B) p38, and C) Jun-N-terminal (JNK) for 15 min. The cells were processed for their analysis by Western blot utilizing anti-phospho ERK1/2, antiphospho p38, and anti-phospho JNK. The membranes were denuded and antibodies were directed against ERK1/2, p38, and JNK nonphosphorylated forms as controls to demonstrate that the same protein concentration was loaded. The results obtained were similar in the three separate experiments processed; mean ± standard error of the mean (SEM) was obtained by densitometry, as shown in the graphic analysis.

G. Gutiérrez-Venegas et al. / International Immunopharmacology 7 (2007) 1199–1210

1205

Fig. 4. The effect of the flavonoids on I-κB phosphorylation. Flavonoids inhibit lipopolysaccharide (LPS)-induced IκB phosphorylation. The cells were pre-treated with the flavonoids (10 μM) for 30 min and later were exposed to LPS (1 μg/ml) for 15 min and were lysed. The entirety of the lysed cells was processed by Sodium dodecyl sulfate-Polyacrylamide gel electrophoresis (SDS-PAGE), and the membranes were blotted with IκB-specific phosphoantibodies. Results are representative of three separate experiments. Densitometric analysis represents mean ± standard error of the mean (SEM).

As shown in Fig. 1, we found that incubation with different doses of quercetagetin inhibits LPS-induced extracellular signal-regulated kinase (ERK1/2) phosphorylation (Fig. 2A), p38 (Fig. 2B), and c-Jun-N-terminal kinase (JNK) (Fig. 2C).

Inhibition of ERK1/2 phosphorylation is noted from the 1 μM dose, an interesting effect because the maximum dose (12 μM) of quercetagetin inhibits phosphorylation of this kinase under basal level; this effect was also observed for JNK (Fig. 2C).

Fig. 5. The effect of the flavonoids on lipopolysaccharide (LPS)-induced cyclooxygenase (COX-2) expression and PGE2 production in human gingival fibroblasts (HGF). The cells were pre-treated with the flavonoids (10 μM) for 30 min prior to being incubated with LPS (1 μg/ml) for 24 h. A) The cells were prepared for immunodetection with anticyclooxygenase-2 antibodies. The membranes were denuded and γ-tubulin was employed to demonstrate that the same protein concentration was loaded. Three experiments were conducted separately, and densitometry represents mean ± standard error of the mean (SEM); B) PGE-2 production was measured from recuperation of the culture medium from the previously mentioned condition, and these were processed for analysis by ELISA.

1206

G. Gutiérrez-Venegas et al. / International Immunopharmacology 7 (2007) 1199–1210

We found that the 10-μM dose produces complete inhibition of MAPK phosphorylation. Therefore, we decided to compare the effect of quercetagetin with that of other flavonoids such as genistein, quercetin, and luteolin. 3.3. The effect of flavonoids on LPS-induced ERK1/2 phosphorylation in HGF To determine flavonoid actions on LPS-induced ERK1/ 2 phosphorylation, cells were pre-incubated with genistein, luteolin, quercetin, and quercetagetin, all at 10-μM doses, for 30 min, and were later treated with LPS. Our results showed that treatment with LPS (1 μg/ml) during 10 min promoted ERK1/2 phosphorylation (p44 and p42). Treatment with flavonoids completely blocked LPSinduced (1 μg/ml) phosphorylation of p44 and p42 (Fig. 3A). 3.4. The effect of flavonoids on LPS-induced p38 phosphorylation in HGF We tested the capacity of flavonoids in inhibiting p38 phosphorylation (Fig. 3B). Exposure of human gingival fibroblasts to LPS (1 μg/ml) for 15 min produced an increase of p38 phosphorylation three times below basal activity. Treatment with luteolin (10 μM) completely inhibited p38 phosphorylation; nonetheless, genistein and quercetin demonstrated a lesser inhibitory effect (Fig. 3B).

3.5. The effect of flavonoids on JNK phosphorylation in HGF Finally, we studied the effect of flavonoids on JNK phosphorylation (Fig. 3C). Exposure of HGF to LPS (1 μg/ ml) during 15 min produced a 2.5-fold increase in JNK phosphorylation above basal activity. Treatment with luteolin (10 μM), quercetin (10 μM), and quercetagetin (10 μM) completely attenuated JNK phosphorylation; however, genistein demonstrated no inhibitory effect (Fig. 3C). 3.6. The effect of flavonoids on I-κB phosphorylation in HGF The nuclear-κB factor is a transcription factor that is associated in non-stimulated cells with the I-κB inhibitory protein in cytoplasm. After stimulation with LPS, I-κB is phosphorylated, ubiquitinated, and degraded. Removal of I-κB allows for NF-κB translocation to the nucleus, where it associates with κB elements in immune- and inflammationinvolved gene promoter regions. To determine whether flavonoids interfere with the effects of LPS on I-κB phosphorylation, we analyzed the effect of flavonoids on the I-κB phosphorylation pattern by Western blotting. As expected, we observed that treatment with LPS (1 μg/ml) for 15 min induces I-κB phosphorylation, and that the flavonoids quercetin, luteolin, and quercetagetin blocked I-κB phosphorylation. Nevertheless, genistein did not affect LPS-induced IκB phosphorylation (Fig. 4). In the immunohistochemical assays (Fig. 4B), we observed that NF-κB in basal human

Fig. 6. The effect of the flavonoids on IL-1β expression in HGF. The cells were treated with the flavonoids (10 μM) for 30 min and later were incubated with lipopolysaccharides (LPS) (1 μg/ml) for 3 h. Total RNA was extracted from the cells, and induction of IL-1 mRNA was measured by reverse transcriptase-polymerase chain reaction (RT-PCR) assay. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the control. Densitometric analysis represents the mean ± standard error of the mean (SEM) of five separate experiments.

G. Gutiérrez-Venegas et al. / International Immunopharmacology 7 (2007) 1199–1210

1207

Fig. 7. Effect of quercetagetin-induced cell death and DNA fragmentation. A) Cells were exposed to various concentrations of quercetagetin for 24 h or quercetagetin (10 μM) for various times. Cell viability was estimated by a MTT assay. Data are the mean ± SE of three independent experiments performed in triplicate. B) Analysis of DNA fragmentation by agarose gel electrophoresis. Cells were exposed to various concentrations of quercetagetin for 24 h or 10 μM quercetagetin for various times. DNA fragmentation assay was estimated in agarose gel were stained with ethidium bromide. The gel is a representative of a triplicate.

gingival fibroblasts cytoplasm (Fig. 4B-A) treatment with LPS caused stained material to concentrate in the cellular nucleus (Fig. 4B-B). Quercetagetin had no effect upon NF-κB translocation (Fig. 4B-C), but inhibited LPS effects on NFκB nuclear location (Fig. 4B-D). 3.7. The effect of flavonoids on COX-2 expression The cyclooxygenase-2 enzyme (COX-2) converts arachidonic acid into prostaglandins such as PGE2, which plays an important role in the periodontal-disease inflammatory process. This, we proposed to study the effect of flavonoids on COX-2 expression and PGE-2 synthesis. We evaluated COX-2 synthesis by means of Western blot assays; these experiments demonstrated that flavonoids inhibit LPS-induced COX-2 expression (Fig. 5). On densitometric analysis of three separate experiments, we found that all significantly inhibit COX-2 expression; genistein, quercetin, and quercetagetin completely inhibited COX-2 expression, while luteolin

showed a lesser effect (Fig. 6A). PGE-2 production was also inhibited by the flavonoids (Fig. 6B). 3.8. The effect of flavonoids on IL-1β expression Previous studies have demonstrated that stimulation of diverse cellular lines with LPS induces the expression of proinflammatory molecules such as IL-1β [16,17,19]. Among the effects of IL-1β are induction and systematic response to the invasion by pathogens, because IL-1β induces the transcription of other inflammatory mediators such as IL8 and tumor necrosis factor (TNF) [4,21]. We found that treatment with quercetin, luteolin, and quercetagetin completely blocked LPS-induced IL-1 expression in human gingival fibroblasts (Fig. 7A); nonetheless, genistein did not block IL-1β expression. The effects of LPS on IL-1β production and different doses of quercetagetin (0, 5, and 10 μM) were examined (Table 1). Cells without LPS challenge produced 15.7 fmol/106 cells, whereas the LPS (1 μg/ml by

1208

G. Gutiérrez-Venegas et al. / International Immunopharmacology 7 (2007) 1199–1210

Table 1 Effect of quercetagetin on the IL-1β production in human gingival fibroblasts Addition

IL-1β (fmol/106)

IL-1 (% of LPS)

Basal LPS (1 μg/ml) Quercetagetin (5 μM) + LPS (1 μg/ml) Quercetagetin (10 μM) + LPS (1 μg/ml)

15.7 ± 0.87 41 ± 0.53 26.8 ± 1.2 17.46

100 65.36 42.58

The cells were treated with quercetagetin (5 o 10 μM) for 30 min at 37 °C. LPS was then added further for 3 h at 37 °C and IL-1β was determined. Each value represents the mean of triplicate determinations (± SEM).

3 h) treatment showed a significant increase of 41 fmol/106 cells. LPS-challenged HGF cells were incubated with quercetagetin (30 min) at different doses. We found that 10 μM of quercetagetin significantly inhibited IL-1β production (17.46 fmol 7 106 cells). 3.9. Luteolin effects on cellular proliferation and DNA integrity, and cell viability The concentration-dependent effect of quercetagetin on cell death was examined (Fig. 7A). The cells were treated with various concentrations of quercetagetin (0–100 μM) for 24 h. Quercetagetin treatment did not result in significant differences with respect to untreated cells. Similar results were obtained when the cells were treated with quercetagetin (10 μM) at different times. The induction of DNA fragmentation by quercetagetin was analyzed. No DNA fragments were detected in the HGF treated at different times and doses (Fig. 7B).

4. Discussion Periodontal disease comprises a group of infections that lead to gum inflammation, periodontal tissue destruction, and that in severe cases is accompanied by alveolar bone and tooth loss [22–24]. Host responses initiate due to recognition of microbial structures such as lipopolysaccharides, which are present in Gram-negative bacteria. Some of these bacteria present in dentobacterial plaque are designated as periodontal-disease-associated bacteria. P. gingivalis is oral, black-pigmented, Gram-negative bacteria present at sites where periodontal disease is active. These bacteria contain lipopolysaccharides in their external membrane that interact with Toll receptors, this causing transduction pathways to be activated and culminating in inflammatory cytokine expression. Some cytokines involved in periodontal-disease pathogenesis are IL-1 and PGE2, which are present at high concentrations in crevicular fluid and in the periodontal tissues of diseased sites. On the other hand, flavonoids

comprise a large family of phenol compounds that are present in plants; from the pharmacologic viewpoint, flavonoids possess a broad spectrum of biochemical and pharmacologic activities including antioxidant, antibacterial, anti-inflammatory, anti-allergic, anti-mutagenic, anti-viral, and anti-neoplastic, as well as vasodilatory properties. For pharmacologic effects, the white cells of flavonoids are unknown, but diverse reports note that these inhibit a broad spectrum of kinases [8,10,12,13]. In this study, we evaluated the role of flavonoids in transduction pathway regulation in LPS-stimulated HGF: our group previously showed that luteolin inhibits LPSinduced ERK1/2, p38, and JNK phosphorylation. Utilizing this information as a take-off point, we found that MAPK activity is inhibited by the flavonoid quercetagetin, obtained from T. erecta, which demonstrates an inhibitory effect similar to that at previously reported doses. T. erecta is a heavily ramified herbaceous plant that reaches 50–100 cm in height. It originated in Mexico and is found in hot, semi-hot, dry, and temperate climates. This plant has been widely employed in the Herbolarium for treatment of intestinal infections, as an antioxidant, and as an anti-inflammatory; as we mentioned previously, it has even been utilized in chemotaxonomy. There are no reports of the biological activities of its components. Thus, we isolated quercetagetin, a molecule belonging to the flavonoid group. We found that lipopolysaccharides induce ERK and JNK, and p38 activation, and have been reported in other biological models such as macrophages, lymphocytes, and epithelial cells. In previous reports [37], we found that treatment with flavonoids inhibits MAPK activation at 10-μM doses; however, it is noteworthy that quercetagenin, in addition to inhibiting MAPK phosphorylation, also promotes a diminution in the phosphorylation pattern. These results suggest that flavonoids inhibit kinase protein activity and possibly exert effects on the activity of phosphatases, these results correlating with proinflammatory cytokine expression inhibition. On the other hand, Rangan et al. in 1999 [31] reported that flavonoids and in particular quercetin inhibit cytokine production by lipopolysaccharides, blocking necrosis factor κB (NF-κB) activation. We found that quercetin, luteolin, and quercetagetin block the I-κB phosphorylation pattern. Notwithstanding this, we should carry out more specific studies such as EMSA to clarify the role of NF-κB on the expression of these proinflammatory cytokines. In addition, the effects of flavonoids on LPS-induced PGE2 production are controversial because there is a complex number of pathways involved in the expression of this molecule [30]. Some reports indicate that flavonoids such as

G. Gutiérrez-Venegas et al. / International Immunopharmacology 7 (2007) 1199–1210

wogonin and quercetin can induce PGE2 expression. Nonetheless, we found that genistein, quercetin, luteolin, and quercetagetin block COX-2 expression, and that PGE2 synthesis is not blocked by genistein (a tyrosinekinase inhibitor); this suggests that genistein does not block any other pathway involved in PGE2 synthesis, and that it possibly exerts effects through COX-2 or by means of the regulation of some alternate pathway that is not blocked by genistein. Thus, we will now proceed to study the effect of LPS on the phosphorylation of another kinase, such as protein kinase C. In conclusion, we showed evidence demonstrating that flavonoids block MAPK activity, and that these inhibit COX-2 and IL-1β expression as well. In conclusion, research carried out within the confines of flavonoid activity is highly intriguing, above all because some of these compounds have been used in the treatment of diseases in humans. Regulation of proinflammatory cytokine expression is without doubt of field that engages great interest due to the fact that the expression of proinflammatory molecules is a palliative as a defense mechanism against infectious processes. Prolonged expression of these molecules leads to chronic inflammation processes and therefore to magnifying the severity of periodontal disease. Acknowledgment This work was supported by the Dirección General de Asuntos del Personal Académico grant PAPIIT IN206806-3. References [1] Agarwal S, Baran C, Piesco NP, Quintero JC, Langkamp HH, Johns LP, et al. Synthesis of proinflammatory cytokines by human gingival fibroblasts in response to lipopolysaccharides and interleukin-1 beta. J Periodontal Res 1995;30:382–9. [2] Albandar JM, Brown LJ, Lee H. Putative periodontal pathogens in subgingival plaque of young adults with and without earlyonset periodontitis. J Periodontol 1997;68:973–81. [3] Bainbridge BW, Darveau RP. Porphyromonas gingivalis lipopolysaccharide: an unusual pattern recognition receptor ligand for the innate host defense system. Acta Odontol Scand 2001;59:131–8. [4] Chaudhary LR, Avioli LV. Regulation of interleukin-8 gene expression by interleukin-1, osteotropic hormones, and protein kinase inhibitors in normal human bone marrow stromal cells. J Biol Chem 1996;271:16591–6. [5] Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal Biochem 1987;162:156–9. [6] Costerton JW, Lewandowski Z. The biofilm lifestyle. Adv Odonatol Res 1997;11:192–5. [7] Costerton JW, Stewart PS, Greenberg EP. Bacterial biofilms: a common cause of persistent infections. Science 1999;284:1318–22.

1209

[8] Ferriola PC, Cody V, Middleton Jr E. Protein kinase C inhibition by plant flavonoids. Kinetic mechanisms and structure activity relationships. Biochem Pharmacol 1989;38:1617–24. [9] Forehand JR, Johnston Jr R, Bomalaski S. Phospholipase A2 activity in human neutrophils. Stimulation by lipopolysaccharide and possible involvement in priming for an enhanced respiratory burst. I. Immunology 1993;151:4918–25. [10] Formica JV, Regelson W. Review of the biology of quercitin and related bioflavonoids. Food Chem Toxicol 1995;33:1061–80. [11] Fort P, Marty L, Pichaczyk M, Sabrouty SE, Dani C, Jeanteur P, et al. Various rat adult tissues express only one major mRNA species from the glyceraldehyde-3-phosphate-dehydrogenase multigenic family. Nucleic Acids Res 1985;13:1431–42. [12] Fotsis T, Pepper MS, Akatas E, Breit S, Rasku S, Adlercreutz H, et al. Flavonoids, dietary derived inhibitors of cell proliferation and in vitro angiogenesis. Cancer Res 1997;57:2916–21. [13] Graziani Y, Erikson E, Erikson RL. The effect of quercetin on the phosphorylation of the Rous sarcoma virus transforming gene product in vitro and in vivo. Eur J Biochem 1983;135:583–9. [14] Gutiérrez-Venegas G, Kawasaki-Cárdenas P, Arroyo-Cruz SR, Maldonado-Frías S. Luteolin inhibits lipopolysaccharide actions on human gingival fibroblasts. Eur J Pharmacol 2006;541: 95–105. [15] Han J, Lee JO, Tobias PS, Ulevitch RJ. Endotoxin induces rapid protein tyrosine phosphorylation in 70Z13 cells expressing CD14. J Biol Chem 1993;268:25009–14. [16] Higgins GC, Foster JL, Postlethwaite AE. Interleukin 1 propeptide is detected intracellularly and extracellularly when human monocytes are stimulated with LPS in vitro. J Exp Med 1994;180:607–14. [17] Hoffmann E, Dittrich-Breiholz O, Holtmann H, Kracht M. Multiple control of interleukin-8 gene expression. J Leukoc Biol 2002;72:847–55. [18] Imatani T, Kato T, Okuda K. Production of inflammatory cytokines by human gingival fibroblasts stimulated by cell-surface preparations of Porphyromonas gingivalis. Oral Microbiol Immunol 2001;16:65–72. [19] Koide S, Steinman RM. Induction of murine interleukin 1: stimuli and responsive primary cells. Proc Natl Acad Sci U S A 1987;84:3802–6. [20] Lee JC, Laydon JT, McDonnell PC, Gallagher TF, Kumar S, Green O, et al. A protein kinase involved in the regulation of inflammatory cytokine biosynthesis. Nature 1994;372:739–46. [21] Lisby S, Hauser C. Transcriptional regulation of tumor necrosis factor in keratinocytes mediated by interleukin-1 and tumor necrosis factor. Exp Dermatol 2002;11:592–8. [22] Listgarten MA. A rationale for monitoring the periodontal microbiota after periodontal treatment. J Periodontol 1988;5(9):439–44. [23] Loe H, Anerud A, Boysen H, Smith M. The natural history of periodontal disease in man. J Periodontal Res 1978;49:553–9. [24] Loe H, Theilade E, Jensen SB. Experimental gingivitis in man. J Periodontol 1965;36:177–87. [25] Moore W, Moore L. The bacterial periodontal diseases. Periodontology 2000 1994; 5: 66–77. [26] Newman MG, Grinenco V, Weiner M, Angel L, Karge H, Nisengard R. Predominant microbiota associated with periodontal health in the aged. J Periodontol 1978;49:53–559. [27] O'Neill PG, Ford-Hutchinson AW. Expression of mRNA for cyclooxygenase-1 and cyclooxygenase-2 in human tissues. FEBS Lett 1993;330:156–60. [28] Oarveau RP, Tanner A, Page RC. The microbial challenge in periodontitis. Periodontology 2000; 1997; 14: 12–32.

1210

G. Gutiérrez-Venegas et al. / International Immunopharmacology 7 (2007) 1199–1210

[29] Ohguchi Y, Ishihara Y, Ohguchi M, Koide M, Shirozu N, Naganawa T, et al. Capsular polysaccharide from Actinobacillus actinomycetemcomitans inhibits IL-6 and IL-8 production in human gingival fibroblast. J Periodontal Res 2003;380:191–7. [30] Pistritto G, Ciabattoni G, Mancuso C, Tringali G, Preziosi P, Navarra P. Signaling pathways involved in lipopolysaccharide stimulation of prostaglandin production by rat hypothalamic astroglial cells. J Endotoxin Res 2000;6:7–11. [31] Rangan GK, Wang Y, Tay YC, Harris DC. Inhibition of NFkappaB activation with antioxidants is correlated with reduced cytokine transcription in PTC. Am J Physiol 1999;277:79–89. [32] Rose GG, Yajima T, Mahan CJ. Human gingival fibroblast cell lines in vitro. I. Electron microscopic studies of collagenolysis. J Periodontal Res 1980;15:53–70. [33] Schytte Blix IJ, Helgeland K, Hvattum E, Lyberg T. Lipopolysaccharide from Actinobacillus actinomycetemcomitans stimulates production of interleukin-1beta, tumor necrosis factor alpha, interleukin-6 and interleukin-1 receptor antagonist in human whole blood. J Periodontal Res 1999;34:34–40. [34] Slomiany BL, Slomiany A. Porphyromonas gingivalis lipopolysaccharide induced cytosolic phospholipase A2 activation interferes with salivary mucin synthesis via platelet activating factor generation. Inflammopharmacology 2006;14:144–9.

[35] Slots J, Hausmann E. Longitudinal study of experimentally induced periodontal disease in Macaca arcotoides. Relationship between microflora and alveolar bone loss. Infect Immun 1979;23:260–9. [36] Stevens RH, Gatewood C, Hammond BF. Cytotoxicity of the bacterium Actinobacillus actinomycetemcomitans extracts in human gingival fibroblasts. Arch Oral Biol 1983;28:981–7. [37] Waga I, Nakamura M, Honda Z, Ferby I, Toyoshima S, Ishiguro S. Two distinct signal transduction pathways for the activation of guinea-pig macrophages and neutrophils by endotoxin. Biochem Biophys Res Commun 1993;15:465–72. [38] Watanabe A, Takeshita A, Kitano S, Hanazawa S. CD-14 mediated signal pathway of Porphyromonas gingivalis lipopolysaccharide in human gingival fibroblast. Infect Immun 1996;64:4488–94. [39] Weinstein SL, Sanghera JS, Lemke KO, Franco AL, Pelech SL. Bacterial lipopolysaccharide induces tyrosine phosphorylation and activation of mitogen-activated protein kinases in macrophages. J Biol Chem 1992;267:14955–62. [40] Xagoari A, Papapetropoulos A, Mauromatis A, Economou M, Fotsis T, Roussos C. Luteolin inhibits an endotoxin-stimulated phosphorylation. Cascade and proinflammatory cytokine production in macrophages. J Pharmacol Exp Ther 2001;296:181–7.