- Email: [email protected]
The effect of FOXO gene family variants and global DNA metylation on RRMS disease
Journal Pre-proofs Research paper THE EFFECT OF FOXO GENE FAMILY VARIANTS AND GLOBAL DNA METYLATION ON RRMS DISEASE Tuba Gökdoğan Edgünlü, Yasemin Ünal, Sevim Karakaş Çelik, Öyküm Genç, Ufuk Emre, Gülnihal Kutlu PII: DOI: Reference:
S0378-1119(19)30831-5 https://doi.org/10.1016/j.gene.2019.144172 GENE 144172
To appear in:
Gene Gene
Received Date: Revised Date: Accepted Date:
23 July 2019 14 October 2019 15 October 2019
Please cite this article as: T. Gökdoğan Edgünlü, Y. Ünal, S. Karakaş Çelik, O. Genç, U. Emre, G. Kutlu, THE EFFECT OF FOXO GENE FAMILY VARIANTS AND GLOBAL DNA METYLATION ON RRMS DISEASE, Gene Gene (2019), doi: https://doi.org/10.1016/j.gene.2019.144172
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2019 Published by Elsevier B.V.
THE EFFECT OF FOXO GENE FAMILY VARIANTS AND GLOBAL DNA METYLATION ON RRMS DISEASE
Tuba Gökdoğan Edgünlüa,*[email protected], Yasemin Ünalb, Sevim Karakaş Çelikc, Öyküm Gençd, Ufuk Emree, Gülnihal Kutlub aMuğla
Sitki Kocman University, Faculty of Medicine, Department of Medical Biology, Muğla,
Turkey bMuğla
Sitki Kocman University, Faculty of Medicine, Department of Neurology, Muğla, Turkey
cBülent
Ecevit University Faculty of Medicine, Department of Medical Genetic, Zonguldak, Turkey
dBülent
Ecevit University Faculty of Science, Department of Molecular Biology and Genetic,
Zonguldak, Turkey eIstambul bMuğla
teaching and Research Hospital, Department of Neurology, Muğla, Turkey
Sitki Kocman University, Faculty of Medicine, Department of Neurology, Muğla, Turkey2,
MD (Prof)
*Corresponding
author.at: Muğla Sitki Kocman University, Faculty of Medicine, Department of
Medical Biology, 48000, Mugla, Turkey
Highlights * Global DNA methylation and FOXO gene variants may be effective in neuronal loss in RRMS. * FOXO3A (rs2253310 rs4966936) FOXO1 (rs3900833) gene variants and global DNA methylation can independently affect RRMS disease.
Abstract: Multiple sclerosis is a chronic disease that usually occurs with exacerbations and remissions in young adults, affects the central nervous system white matter in multiple localization, and is thought to be the result of complex interactions of genetic and environmental factors, the most common form
is relapsing-remitting MS. Forkhead transcription factors O class (FOXO) are responsible for the regulation of various cellular processes including cell cycle, apoptosis, DNA repair, cellular resistance and metabolism. DNA methylation is such an epigenetic change and has been shown to be associated with almost any biological process. The aim of our study to show the relation between the genetic variants of FOXO3a (rs2253310 rs4966936) and FOXO1 (rs3900833, rs4581585) and global DNA methylation in RRMS. We analyzed DNA obtained from 79 RRMS patients and 104 healthy individuals by PCR-RFLP method for the detection of genetic variants. For the determination of global DNA methylation, results were obtained using ELISA method. The data were evaluated statistically. As a result of our analysis; global DNA methylation is higher in RRMS patients compared to control individuals and it can be effective on the disease. In addition, it has been determined that variants of FOXO3a (rs2253310, rs4966936) and FOXO1 (rs3900833), which have been genotyped, may be effective in disease pathogenesis. These results suggest that DNAmethylation and FOXO gene variants may be effective in neuronal loss in RRMS.
ABBREVIATION
DNMT, DNA methyltransferase EDSS, Expanded Disability Status Scale FOXO, Forkhead box protein miRNA, Micro RNA MS, Multiple Sclerosis PCR, Polymerase Chain Reaction RE, Restriction Endonuclease ROC, Receiver-operating characteristic analysis RRMS, Relapsing-remitting MS RPMS, progressive relapsing MS SPMS, secondary progressive MS
RFLP, Restriction Fragment Lenght Polymorphism SIRT1, Sirtuin 1 5MedCyd, 5-methyl-2'-deoxycytidine
INTRODUCTION Multiple Sclerosis (MS) is a chronic, autoimmune, and demyelinating disease that affects the central nervous system in young adults (Hafler et al., 2005). MS is a highly heterogeneous disease and may have very variable clinical signs and symptoms, including motor, sensory, autonomic, and cognitive disorders, depending on the region where the central nervous system is affected (Matsui et al., 2008; Prat et al., 2002). MS is a disease caused by a combination of environmental factors, viral or bacterial agents, cytokines secreted during an inflammatory and autoimmune response, and some unidentified etiologic agents. In MS patients, various lesions such as inflammatory infiltrations, astrogliosis, demyelination, and early axonal damage can be seen in the central nervous system (Sospedra et al., 2005; Hendersonn et al., 2009). Although the etiology of MS is still unclear, the main pathological features of the central nervous system tissues of MS patients are the clue for pathogenesis. As the debate on the autoimmune nature of MS continues, the direct involvement of the immune system in the destruction of myelin and nerve cells has been determined. MS is thought to be a multicomponent disease that overlaps the infection-related autoimmune process. The interaction of genetic, environmental, and immune factors plays a role in the etiopathogenesis of this complex and heterogeneous disease. Genome-wide association studies have revolutionized the genetic analysis of multiple sclerosis (Sospedra et al., 2005; Hendersonn et al., 2009; Hannenhalli et al., 2009). These variants have been consistently related to genes associated with immunological processes, consist of coding regions, and are often associated with other autoimmune diseases. The functional effects of these linked variants are often unknown; however, the balance between the various isoforms of the variants in the respective tissues has shown that they result in significant changes. The relationships of variants in genes encoding human leukocyte antigens have also been determined. MS is divided into four clinical types: relapsing-remitting MS (RRMS), secondary progressive MS (SPMS), progressive relapsing MS (RPMS), primary progressive MS (PPMS). We have chosen the RRMS group for our study. FOXO (Forkhead box protein)
controls the proliferation, apoptosis, differentiation, and metabolic processes of transcription factors. Loss of FOXO function has been detected in some human cancers, and cellular survival and susceptibility to neoplasia have been found, especially in epithelial cancer. Therefore, FOXO factors are well-intentioned tumor suppressors and their potential use as therapeutic targets in cancer is controversial. (Steinman et al., 2007). FOXO factors positively regulate cell survival by activation of various detoxification genes. The targeting of FOXO factors has also been suggested for the prevention of aging by preserving hematopoietic stem cell niche as well as metabolic dysfunctions such as diabetes mellitus, immunological disorders, and neurodegeneration. However, warnings against potential use of FOXO activators in these environments have been developed (Tran et al., 2003). Therefore, a better understanding of the regulation of FOXO target specificity is still necessary to increase its use as a therapeutic target. Four members of the FOXO family (FOXO1, FOXO3a, FOXO4, and FOXO6) have overlapping cellular functions, although they have a common set of DNA sites (Burgering et al., 2003). This emphasizes the fact that FOXO interactions with other transcription factors are very important for FOXO-mediated transcriptional programs, with the observation that FOXOs are only partially dependent on DNA binding activities to regulate their target genes. Epigenetic changes are inherited, stable and reversible. DNA methylation is also such an epigenetic change and has been shown to be associated with almost any biological process. DNA methylation is also dynamic and can therefore control the timing of cellular events. DNA methyltransferase 3B (DNMT3B) contributes to de novo DNA methylation and promotes overexpression, or tumorigenesis. However, it remains unclear whether DNMT3B is up-regulated by transcriptional deregulation. DNA methylation is predominantly found in CpG dinucleotides, many of which are found in gene promoter regions. DNA methylation is associated with transcription suppression and preservation of genomic stability (Hosaka et al., 2004; Yang et al., 2015; Bedford et al., 2007; Lin etal., 2014). Deregulation of DNA methylation is associated with multiple human diseases, including cancer. The three main enzymes DNMT3A, DNMT3B, and DNMT1 are necessary for methylation. Recent studies have shown that DNMT transcription levels are negatively correlated with FOXO3a, which suppresses the DNMT3B gene transcriptionally (Hafler et al., 2005). In our study, the association of variants of FOXO1 (rs3900833, rs4581585) and FOXO3a (rs2253310, rs4966936) genes, which are known to be effective in cell repair, DNA repair, and the cell cycle, was investigated for the first time in RRMS disease. The aim of our study
was to analyze FOXO gene variants as well as global DNA methylation (quantitative measurement of 5MedCyd) and to analyze their relationship with RRMS.
MATERIALS AND METHODS
Study Group Written permission was obtained from the Medical Ethics Committee of Mugla Sitki Kocman University (MSKU) for our study. In this study, 79 patients with RRMS who were admitted to Neurology Clinic of MSKU Research Hospital and 104 control subjects were informed and approved. RRMS diagnosis was made according to 2010 Mc Donalds criteria (Polman et al., 2011). All had baseline Expanded Disability Status Scale (EDSS) scores lower or equal to 4.5. None had contraindications for immunomodulatory drug use. All subjects had normal baseline liver, kidney and thyroid function tests. The patients were free from cardiovascular disease (including hypertension, coronary artery disease, valvular heart disease, heart failure with reduced ejection fraction, atrioventricular conduction abnormalities). Subjects had no evidence for obstructive and/or restrictive lung disease. For the isolation of DNA from the patients and the control group, 2 ml venous blood was collected and stored at 20 oC until DNA extraction. DNA extraction was performed by spin column kit (K182002 coded PureLink ™) method in the research laboratory. DNA isolation and Genotyping Polymorphic regions of FOXO3A and FOXO1 genes were selected with investigated by the link of http://bioinfo.bjmu.edu.cn/mirsnp analyzes. FOXO3A (rs2253310 rs4966936) and FOXO1 (rs3900833, rs4581585) PCR were performed. Then, Restriction Fragment Lenght Polymorphism (RFLP) was performed on the PCR samples with Restriction Endonuclease (RE) enzymes (Table 1). PCR processing; 100ng of DNA, 100mM dNTPs, 5 pmol of primer (each of F and R), 1.0 mM MgCl2 and 0.5U Taq polymerase will be carried out with distilled water in a volume of 20µl. At the end of amplification cycle, amplification products were
used with appropriate restriction enzymes. Restriction products were carried out in 3% agarose gel electrophoresis and visualized under UV light.
Global DNA methylation analysis DNA were analyzed by Global DNA Methylation ELISA Kit (5'-methyl-2'deoxycytidine Quantitation Catalog Number STA-380 Cellbiolabs). At first incubate the sample DNA at 95ºC for 5 minutes and then save sample on the ice. The denatured DNA was incubated in 20 mM Sodium Acetate (pH 5.2) for 2 hours at 37 0C. Then, it was incubated with 5-10 units of nuclease P1 for 2 hours. The reaction mixture was centrifuged at 6000 g for 5 minutes and the supernatant was used for the 5MedCyd ELISA assay. In the pre-treated DNA samples, the amount of 5MedCyd was determined by comparing with the absorbance of a known 5MedCyd standard curve. The kit has a 5MedCyd detection sensitivity from 300 nM to 40.000 nM. Absorbance detected automatically by Spectramax i3 microplate reader at 450 nm. Statistical analysis The results were evaluated by using chi-square and binary logistic regression analysis methods in relation to disease formation and disease findings and polymorphisms. In addition, the groups were analyzed to determine if they were in the Hardy Weinberg equilibrium. Haplotype analysis was performed. Continuous variables (age, height, weight ...) were compared with Mann-Whitney U Test for abnormal variables. Student t test was applied for normally distributed variables. P values less than 0.05 are considered significant. RESULTS In our study, the mean age of 79 patients with RRMS was 47.2 ± 0.5 and the mean age of the control group was 42 ± 3.0. There was no significant difference in age between the two groups (p = 0.158). Demographic data on groups are given in Table 2. Allele and genotype
distributions of FOXO1 (rs3900833, rs4581585), FOXO3A (rs2253310 rs4966936) are given in Table 3.
According to the obtained data, the genotypes of FOXO3A gene rs2253310 polymorphism were found to be significantly different between the patients and control subjects (p <0.001). It was determined that individuals with GC genotype could be significantly protective. There was also a significant difference between the groups (p = 0.015). It was determined that T allele may be a risk factor for the disease. The FOXO3A gene rs4966936 polymorphism was also found to be significantly associated with RRMS disease in terms of genotype (p = 0.019). TC and CC genotypes were found to be higher in the control individuals than the patients. When allele distribution was analyzed, it was determined that G allele could increase RRMS risk by 4.48 times (p <0.001). When the FOXO1 gene rs3900833 genotypes and alleles were analyzed, a significant difference was observed between the groups (p <0.001, p <0.001). Individuals with GG genotype and G alleles were found to have a significantly higher risk of developing RRMS than others. FOXO1 gene rs4581585 genotypes and alleles were compared, no significant difference was observed between the groups (p = 0.985). rs3900833 genetic variant of FOXO1 were analyzed in RRMS. Result of this analysis AA genotype and A allele may be a protective effect for RRMS disease (p<0.001). In our study, control individuals with RRMS patients were compared in terms of global DNA methylation. Based on the detection of ELISA-based 5'-methyl-2'-deoxycytidine (5MedCyd), we have found that the methylation rate of RRMS patients was significantly higher than the control subjects (p <0.001). (figure 4)
As a result, FOXO3A and FOXO family member FOXO1 gene variants and global DNA methylations analyzes were performed and the correlation between them was investigated. In RRMS patients with T alleles of the FOXO3A gene rs4966936 gene polymorphism and in the rs2253310 gene polymorphism, the methylation rate was found to be higher in RRMS patients with G allele (p = 0.000, p = 0.000) (fig. 5).
Also result of our analyzed we have shown that persons who have RRMS patient and T allele (FOXO3A gene rs4966936 polymorphism) and G allele (FOXO3A gene rs2253310) were more methylated than control group. We wanted to evaluate global DNA methylation and its effect on RRMS disease and evaluated with ROC analysis method. ROC analysis was performed to evaluate the predictive power of global DNA methylation for RRMS. When a comparison was made between control and RRMS, the area under the ROC curve was determined to be 0.683. (95% confidence interval; CI = 0.620–0.746, P <0.0001). (Figure 6)
DISCUSSION Multiple sclerosis (MS) is a multifactorial disease, often characterized by inflammation. Neurodegeneration and central nervous system healing systems are damaged in the disease. The cause of MS is not yet clear, but environmental, genetic and immune factors are known to play a role in the etiopathogenesis of this complex disease. (Lazibat et al., 2018). In addition, multiple sclerosis is considered a neurodegenerative disease due to neuronal loss, permanent axonal damage, and neurological insufficiency in patients. (Lassmann et al., 2011 Shindler et al., 2010) FOXO transcription factors control apoptosis, proliferation, differentiation and metabolic processes. Loss of FOXO function was detected in some types of cancer. This loss in epithelial cancer has resulted in a tendency to cellular survival and neoplasia. FOXO factors are therefore well-intentioned tumor suppressors and their potential use as therapeutic targets in cancer is a matter of debate. FOXO factors can positively modulate cell survival through activation of various detoxification genes and complicate the hypothetical therapeutic potential (Monsalve et al., 2011). Activation of FOXO factors may cause both induction of survival genes and apoptosis. The interaction and post-transcriptional modification of FOXO with choreographers determines the balance. In response to increased oxidative stress, interaction with CBP / p300 acts as a coactivator in other FOXO target genes, reducing FOXO transcriptional activity on pro-survival genes (Frescas et al., 2005). CBP / p300 acetylates FOXO and induces its nuclear exclusion and its degradation by the proteasome. When the metabolic conditions are sufficient, SIRT1 and SIRT2s help deprotect FOXOs and facilitate translocation to the nucleus and initiate the apoptotic process. NAD-linked protein deacetylase SIRT1, including MS in neurological diseases involved in the pathogenesis of neurodegeneration has been shown to play a role (Nimmagadda et al., 2017). SIRT1 activates FOXO on pro-survival genes, while reducing its activity on pro-apoptotic genes. Studies showing that FOXO genes are regulated by SIRT and sirtuin have a direct relationship with MS suggest that the FOXO gene family may also have an effect on MS disease. Neurodegeneration is an important determinant of multiple sclerosis (MS), but currently approved therapies have reduced inflammation and have not been shown to reduce neurodegeneration (Motta et al., 2004). It is known that FOXO3A acts as a transcription factor in the regulation of many proapoptotic genes (PI3K-AKT pathway genes) (Potente et al., 2005; Czymai et al., 2010). However, FOXO3A is known to be effective in the regulation of DNMT3B acting on DNA methylation as an epigenetic agent (Herzog et al., 2009). Pathological epigenetic changes, chromosomal integrity and gene functions can be controlled by new mechanisms. DNA hypomethylation may induce the formation of chromosomal instability (Esteller et al., 2008; Hatziapostolou et al., 2011). DNA methylation is an epigenetic signal affected by environmental factors and associated with changes in gene expression and phenotypes. Brooke Rhead et al. 2018 suggested that MS patients have genomic regions that are differentiated in T cells compared to healthy controls (Rhead etal., 2018). Chomyk et al 2017 correlated DNA methylation with demyelination and gene
expression in hippocampus of MS patients. In this study, the MS hippocampus followed by demyelination and methylation changes identified candidate genes and MS brain in the synaptic plasticity, memory performance and neuronal survival may have played a role in changing (Chomyk et al.,2017). Previous studies have shown that hippocampal demyelination occurs in MS patients, leads to loss of synaptic severity, and may affect the expression of synaptic and neuronal genes and regulate the expression of neuronal miRNAs. (Dutta et al., 2011; Dutta et al., 2013). In another study, Kulakova et al. 2016 investigated the relationship between whole genome methylation and MS disease, it was shown the relation between DNA methylation in MS development. For the first time, it has been shown that DNA methylation as an epigenetic mechanism plays a role in the formation of two distinct clinical types of MS (PPMS and RRMS) (Kulakova et al.,2016). In our study, 5MedCyd levels were determined by binding to DNA and the relationship between FOXO3A and FOXO1 gene variants was investigated. The effects of global DNA methylation and FOXO gene variants on RRMS disease have been demonstrated in our study. In the light of our data, we can say that FOXO3A (rs2253310 rs4966936) FOXO1 (rs3900833) gene variants and global DNA methylation can independently affect RRMS disease. These results suggest that DNA methylation and FOXO gene variants may be effective in neuronal loss in RRMS. The biggest limitation in our study was that the protein levels of genes were not investigated due to lack of budget. In subsequent studies, it is possible to investigate miRNAs that regulate FOXO gene family and other gene variants that affect methylation.
Acknowledgement This investigation was supported by Muğla Sıtkı Koçman University Research Project Coordination Office (Project Number: 17/181). This study has published as a poster in 5th Congress of the European Academy of Neurology 2019.
REFERENCES Bedford, M.T., 2007. Arginine methylation at a glance. J Cell Sci.120:4243–4246. Bos, S.D., Barcellos, L.F., 2018. Increased DNA methylation of SLFN12 in CD4+ and CD8+ T cells from multiple sclerosis patients. PLoS One. 31,13(10):e0206511. Burgering, B.M., Medema, R.H., 2003. Decisions on life and death: FOXO Forkhead transcription factors are in command when PKB/Akt is off duty. J Leukoc Biol. 73: 689-701. Chomyk, AM., Volsko, C., Tripathi, A., et al., 2017. DNA methylation in demyelinated multiple sclerosis hippocampus. Sci Rep. 18:7(1):8623-5. Czymai, T., Viemann, D., Sticht, C., et al., 2010. FOXO3 modulates endothelial gene expression and function by classical and alternative mechanisms. J Biol Chem. 285, 10163–10178. Dutta, R., Chang, A., Doud, MK., et al., 2011. Demyelination causes synaptic alterations in hippocampi from multiple sclerosis patients. Ann Neurol. 69(3),445-54. Dutta, R., Chomyk, AM., Chang, A., et al., 2008. Epigenetics in cancer. N Engl J Med; 358, 1148-1159. Fox, RJ., Staugaitis, SM., Macklin, WB., Trapp, BD., 2013. Hippocampal demyelination and memory dysfunction are associated with increased levels of the neuronal microRNA miR-124 and reduced AMPA receptors.Ann Neurol.73(5), 637-45. Frescas, D., Valenti. L., Accili, D., 2005. Nuclear trapping of the forkhead transcription factor FoxO1 via Sirtdependent deacetylation promotes expression of glucogenetic genes. J Biol Chem. 280(21), 20589-95. Hafler, DA., Slavik. J.M., Anderson, D.E., O’Connor, K.C, De Jager, P., Baecher-Allan, C., 2005. Multiple sclerosis. Immunological Reviews. 204, 208-31. Hannenhalli, S., Kaestner, K.H., 2009. The evolution of Fox genes and their role in development and disease. Nat Rev Genet. 10, 233-40. Hatziapostolou, M., Iliopoulos, D., 2011. Epigenetic aberrations during oncogenesis. Cell Mol Life Sci. 68, 1681-1702. Henderson, A.P.D., Barnett, M.H., Parratt, J.D.E., Prineas, J.W., 2009. Multiple sclerosis: distribution of infl ammatory cells in newly forming lesions. Ann Neurol. 66(6), 739-53. Herzog, C.R., Blake, D.C Jr., Mikse, O.R., Grigoryeva L.S., Gundermann, E.L., 2009. FoxO3a gene is a target of deletion in mouse lung adenocarcinoma. Oncol Rep. 22, 837–843. Hosaka, T., Biggs, W.H., Tieu, D., 2004. Disruption of forkhead transcription factor (FOXO) family members in mice reveals their functional diversification. Proc Natl Acad Sci USA. 101, 2975-80. Kulakova, OG., Kabilov, MR., Danilova, LV., et al., 2016. Whole-Genome DNA Methylation Analysis of Peripheral Blood Mononuclear Cells in Multiple Sclerosis Patients with Different Disease Courses. Acta Naturae. 8(3), 103-110. Lassmann, H., 2011. Pathophysiology of inflammation and tissue injury in multiple sclerosis: what are the targets for therapy. J Neurol Sci.15;306(1-2), 167-9. Lazibat, I., Rubinić Majdak, M., Županić, S., 2018. Multiple Sclerosis: New Aspects of Immunopathogenesis. Acta Clin Croat. 57(2), 352-361.
Lin, R.K., Wang, Y.C., 2014. Dysregulated transcriptional and post-translational control of DNA methyltransferases in cancer. Cell Biosci.19(4),46. Matsui, M., 2008. Multiple sclerosis immunology for clinicians. Neurol Asia.13,195-8. Monsalve, M., Olmos, Y., 2011. The complex biology of FOXO. Curr Drug Targets.12(9),1322-50. Motta, M.C., Divecha, N., Lemieux, M., et al., 2004. Mammalian SIRT1 represses forkhead transcription factors. Cell. 16(4), 551-63. Prat, E., Martin, R., 2002.The immunopathogenesis of multiple sclerosis. J Rehabil Res Dev. 39(2),187-99. Nimmagadda, V.K., Makar, T.K., Chandrasekaran, K., et al., 2017. SIRT1 and NAD+ precursors: Therapeutic targets in multiple sclerosis a review. J Neuroimmunol. 15(304), 29-34. Potente, M., Urbich, C., Sasaki, K., et al., 2005. Immunology of multiple sclerosis. Annu Rev Immunol. 23(1),683-7475. Shindler, K.S, Ventura, E., Dutt, M., Elliott, P., Fitzgerald, D.C., Rostami, A., 2010. Oral resveratrol reduces neuronal damage in a model of multiple sclerosis. J Neuroophthalmol. 30(4),328-39. Steinman, L., Martin, R., Bernard, C., Conlon, P., Oksenberg, J.R., 2002. Multiple sclerosis: deeper understanding of its pathogenesis reveals new targets for therapy. Annu Rev Neurosci. 25, 491-505. Tran, H., Brunet, A., Griffith, E.C., Greenberg, M.E., 2003. The many forks in FOXO's road. Sci STKE. 4(2003), 172. Yang, Y., et al. 2015. PRMT9 is a type II methyltransferase that methylates the splicing factor SAP145. Nat Commun. 6, 6428. Zeiher, A.M., Dimmeler, S., 2005. Involvement of FOXO transcription factors in angiogenesis and postnatal neovascularization. J Clin Invest.115, 2382–2392.
Fig. 4. Distribution of global DNA methylation between patient and control subjects.
Fig. 5. Distribution of the relationship between FOXO3A gene rs2253310 and rs4966936 polymorphisms and global DNA methylation.
Fig. 6. ROC analysis curve for global DNA methylation.
Table 1. FOXO3a (rs2253310 rs4966936) FOXO1 (rs3900833, rs4581585) genes PCR-RFLP conditions. Gene
Polymorphism rs2253310
FOXO3A
Primer F: 5’-GAGCTTGCTTTGGAGATGCA-3’ R: 5’- CCCAGTCACTCACATAGTCCT-3’
An. Temp. 530C
RE DpnI
PCR product GG: 321 GC: 321, 127, 194 CC: 127, 194
rs4966936
F: 5’-GGGTCCTGAGAACTTCTGAGT-3’ R: 5’-GACATTCTGTAAGACATTCTGCCT-3’
530C
SfcI
rs3900833
F 5’ GCATTTGAAACAGGTCCCCA 3’ R 5’TCAGCATGTTTCCTGGTGGTT 3’
61 0C
Hhal1
rs4581585
F ’TTTGAGCATCATGTTGCCACTCAAGAAGTT 3’ R 5’CGAAGCCCACAACCCACT GAGCATTT 3’
61 0C
FOXO1
TT:224 TC:224, 152, 72 CC:152, 72 GA: 623, 473, 150 GG: 473, 150 AA: 623 CT: 151, 125, 26 CC: 125, 26 TT:151, 26
Dra1
Table 2. Demographic information of RRMS and control individuals. Clinical Features Age Average (Min-Max) Gender Male (n%) Female (n%) Expanded disability status scale (EDSS)
RRMS (n=79) 47.2 ± 0.5 22 % 27.8 57 % 72.2 3.32 (0.42–4.32)
Control (n=104) 42 ± 3.0 34 % 34.7 70 % 67.3
P 0.158
Table 3. Genotype distributions of FOXO1 (rs3900833, rs4581585), FOXO3A (rs2253310 rs4966936). FOXO3A
Genotype
P
rs2253310
Control n (%)
RRMS n (%)
GG
17 21.5%
85 81.7%
GC
60 75.9%
19 18.3%
CC
2 2.5%
-
16 20.3% 35 44.3% 28 35.4% Control n (%)
41 39.4% 34 32.7% 29 27.9% RRMS n (%)
58 73.4% 20 25.3% 1 1.3%
31 49.2% 11 17.5% 21 33.3%
52 65.8% 19 24.1% 8 10.1%
68 65.4% 26 25.0% 10 9.6%
OR (% 95 CI)
Reference <0.001
0.063
(0.030-0.132) -
rs4966936 TT TC CC FOXO1 rs3900833 AA GA GG
Reference 0.019
0.379 0.404
(0.180-0.799) (0.186-0.879)
Reference <0.001
1.029
(0.438
39.290 (5.043
2.420) 306.100)
rs4581585 TT CT CC
1 0.985 1.046
(0.523-2.093)
0.956
(0.353-2.591)
Table 4. Alleles and genotype distributions of FOXO3A (rs2253310 rs4966936) FOXO1 (rs3900833, rs4581585). FOXO3A rs2253310 G Allele C Allele
ALLELES Control n (%) 94 59.5% 64 40.5%
RRMS n (%) 189 90.9% 19 9.1%
67 42.4%
116 55.8%
91 57.6%
92 44.2%
Control n (%) 136 86.1% 22 13.9%
RRMS n (%) 73 (57.9%) 53 42.1%
123 77.8% 35 22.2%
162 77.9% 46 22.1%
P
OR (% 95 CI) 1
<0.001 0.148 (0.084-0.261)
rs4966936 T Allele C Allele
1 <0.001 0.584 (0.385-0.887)
FOXO1 rs3900833 A Allele G Allele
P
OR (% 95 CI) 1
<0.001 4.488 (2.531-7.958)
rs4581585 T Allele C Allele
1 0.546 0.998 (0.606-1.642)
S0378-1119(19)30831-5 https://doi.org/10.1016/j.gene.2019.144172 GENE 144172
To appear in:
Gene Gene
Received Date: Revised Date: Accepted Date:
23 July 2019 14 October 2019 15 October 2019
Please cite this article as: T. Gökdoğan Edgünlü, Y. Ünal, S. Karakaş Çelik, O. Genç, U. Emre, G. Kutlu, THE EFFECT OF FOXO GENE FAMILY VARIANTS AND GLOBAL DNA METYLATION ON RRMS DISEASE, Gene Gene (2019), doi: https://doi.org/10.1016/j.gene.2019.144172
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2019 Published by Elsevier B.V.
THE EFFECT OF FOXO GENE FAMILY VARIANTS AND GLOBAL DNA METYLATION ON RRMS DISEASE
Tuba Gökdoğan Edgünlüa,*[email protected], Yasemin Ünalb, Sevim Karakaş Çelikc, Öyküm Gençd, Ufuk Emree, Gülnihal Kutlub aMuğla
Sitki Kocman University, Faculty of Medicine, Department of Medical Biology, Muğla,
Turkey bMuğla
Sitki Kocman University, Faculty of Medicine, Department of Neurology, Muğla, Turkey
cBülent
Ecevit University Faculty of Medicine, Department of Medical Genetic, Zonguldak, Turkey
dBülent
Ecevit University Faculty of Science, Department of Molecular Biology and Genetic,
Zonguldak, Turkey eIstambul bMuğla
teaching and Research Hospital, Department of Neurology, Muğla, Turkey
Sitki Kocman University, Faculty of Medicine, Department of Neurology, Muğla, Turkey2,
MD (Prof)
*Corresponding
author.at: Muğla Sitki Kocman University, Faculty of Medicine, Department of
Medical Biology, 48000, Mugla, Turkey
Highlights * Global DNA methylation and FOXO gene variants may be effective in neuronal loss in RRMS. * FOXO3A (rs2253310 rs4966936) FOXO1 (rs3900833) gene variants and global DNA methylation can independently affect RRMS disease.
Abstract: Multiple sclerosis is a chronic disease that usually occurs with exacerbations and remissions in young adults, affects the central nervous system white matter in multiple localization, and is thought to be the result of complex interactions of genetic and environmental factors, the most common form
is relapsing-remitting MS. Forkhead transcription factors O class (FOXO) are responsible for the regulation of various cellular processes including cell cycle, apoptosis, DNA repair, cellular resistance and metabolism. DNA methylation is such an epigenetic change and has been shown to be associated with almost any biological process. The aim of our study to show the relation between the genetic variants of FOXO3a (rs2253310 rs4966936) and FOXO1 (rs3900833, rs4581585) and global DNA methylation in RRMS. We analyzed DNA obtained from 79 RRMS patients and 104 healthy individuals by PCR-RFLP method for the detection of genetic variants. For the determination of global DNA methylation, results were obtained using ELISA method. The data were evaluated statistically. As a result of our analysis; global DNA methylation is higher in RRMS patients compared to control individuals and it can be effective on the disease. In addition, it has been determined that variants of FOXO3a (rs2253310, rs4966936) and FOXO1 (rs3900833), which have been genotyped, may be effective in disease pathogenesis. These results suggest that DNAmethylation and FOXO gene variants may be effective in neuronal loss in RRMS.
ABBREVIATION
DNMT, DNA methyltransferase EDSS, Expanded Disability Status Scale FOXO, Forkhead box protein miRNA, Micro RNA MS, Multiple Sclerosis PCR, Polymerase Chain Reaction RE, Restriction Endonuclease ROC, Receiver-operating characteristic analysis RRMS, Relapsing-remitting MS RPMS, progressive relapsing MS SPMS, secondary progressive MS
RFLP, Restriction Fragment Lenght Polymorphism SIRT1, Sirtuin 1 5MedCyd, 5-methyl-2'-deoxycytidine
INTRODUCTION Multiple Sclerosis (MS) is a chronic, autoimmune, and demyelinating disease that affects the central nervous system in young adults (Hafler et al., 2005). MS is a highly heterogeneous disease and may have very variable clinical signs and symptoms, including motor, sensory, autonomic, and cognitive disorders, depending on the region where the central nervous system is affected (Matsui et al., 2008; Prat et al., 2002). MS is a disease caused by a combination of environmental factors, viral or bacterial agents, cytokines secreted during an inflammatory and autoimmune response, and some unidentified etiologic agents. In MS patients, various lesions such as inflammatory infiltrations, astrogliosis, demyelination, and early axonal damage can be seen in the central nervous system (Sospedra et al., 2005; Hendersonn et al., 2009). Although the etiology of MS is still unclear, the main pathological features of the central nervous system tissues of MS patients are the clue for pathogenesis. As the debate on the autoimmune nature of MS continues, the direct involvement of the immune system in the destruction of myelin and nerve cells has been determined. MS is thought to be a multicomponent disease that overlaps the infection-related autoimmune process. The interaction of genetic, environmental, and immune factors plays a role in the etiopathogenesis of this complex and heterogeneous disease. Genome-wide association studies have revolutionized the genetic analysis of multiple sclerosis (Sospedra et al., 2005; Hendersonn et al., 2009; Hannenhalli et al., 2009). These variants have been consistently related to genes associated with immunological processes, consist of coding regions, and are often associated with other autoimmune diseases. The functional effects of these linked variants are often unknown; however, the balance between the various isoforms of the variants in the respective tissues has shown that they result in significant changes. The relationships of variants in genes encoding human leukocyte antigens have also been determined. MS is divided into four clinical types: relapsing-remitting MS (RRMS), secondary progressive MS (SPMS), progressive relapsing MS (RPMS), primary progressive MS (PPMS). We have chosen the RRMS group for our study. FOXO (Forkhead box protein)
controls the proliferation, apoptosis, differentiation, and metabolic processes of transcription factors. Loss of FOXO function has been detected in some human cancers, and cellular survival and susceptibility to neoplasia have been found, especially in epithelial cancer. Therefore, FOXO factors are well-intentioned tumor suppressors and their potential use as therapeutic targets in cancer is controversial. (Steinman et al., 2007). FOXO factors positively regulate cell survival by activation of various detoxification genes. The targeting of FOXO factors has also been suggested for the prevention of aging by preserving hematopoietic stem cell niche as well as metabolic dysfunctions such as diabetes mellitus, immunological disorders, and neurodegeneration. However, warnings against potential use of FOXO activators in these environments have been developed (Tran et al., 2003). Therefore, a better understanding of the regulation of FOXO target specificity is still necessary to increase its use as a therapeutic target. Four members of the FOXO family (FOXO1, FOXO3a, FOXO4, and FOXO6) have overlapping cellular functions, although they have a common set of DNA sites (Burgering et al., 2003). This emphasizes the fact that FOXO interactions with other transcription factors are very important for FOXO-mediated transcriptional programs, with the observation that FOXOs are only partially dependent on DNA binding activities to regulate their target genes. Epigenetic changes are inherited, stable and reversible. DNA methylation is also such an epigenetic change and has been shown to be associated with almost any biological process. DNA methylation is also dynamic and can therefore control the timing of cellular events. DNA methyltransferase 3B (DNMT3B) contributes to de novo DNA methylation and promotes overexpression, or tumorigenesis. However, it remains unclear whether DNMT3B is up-regulated by transcriptional deregulation. DNA methylation is predominantly found in CpG dinucleotides, many of which are found in gene promoter regions. DNA methylation is associated with transcription suppression and preservation of genomic stability (Hosaka et al., 2004; Yang et al., 2015; Bedford et al., 2007; Lin etal., 2014). Deregulation of DNA methylation is associated with multiple human diseases, including cancer. The three main enzymes DNMT3A, DNMT3B, and DNMT1 are necessary for methylation. Recent studies have shown that DNMT transcription levels are negatively correlated with FOXO3a, which suppresses the DNMT3B gene transcriptionally (Hafler et al., 2005). In our study, the association of variants of FOXO1 (rs3900833, rs4581585) and FOXO3a (rs2253310, rs4966936) genes, which are known to be effective in cell repair, DNA repair, and the cell cycle, was investigated for the first time in RRMS disease. The aim of our study
was to analyze FOXO gene variants as well as global DNA methylation (quantitative measurement of 5MedCyd) and to analyze their relationship with RRMS.
MATERIALS AND METHODS
Study Group Written permission was obtained from the Medical Ethics Committee of Mugla Sitki Kocman University (MSKU) for our study. In this study, 79 patients with RRMS who were admitted to Neurology Clinic of MSKU Research Hospital and 104 control subjects were informed and approved. RRMS diagnosis was made according to 2010 Mc Donalds criteria (Polman et al., 2011). All had baseline Expanded Disability Status Scale (EDSS) scores lower or equal to 4.5. None had contraindications for immunomodulatory drug use. All subjects had normal baseline liver, kidney and thyroid function tests. The patients were free from cardiovascular disease (including hypertension, coronary artery disease, valvular heart disease, heart failure with reduced ejection fraction, atrioventricular conduction abnormalities). Subjects had no evidence for obstructive and/or restrictive lung disease. For the isolation of DNA from the patients and the control group, 2 ml venous blood was collected and stored at 20 oC until DNA extraction. DNA extraction was performed by spin column kit (K182002 coded PureLink ™) method in the research laboratory. DNA isolation and Genotyping Polymorphic regions of FOXO3A and FOXO1 genes were selected with investigated by the link of http://bioinfo.bjmu.edu.cn/mirsnp analyzes. FOXO3A (rs2253310 rs4966936) and FOXO1 (rs3900833, rs4581585) PCR were performed. Then, Restriction Fragment Lenght Polymorphism (RFLP) was performed on the PCR samples with Restriction Endonuclease (RE) enzymes (Table 1). PCR processing; 100ng of DNA, 100mM dNTPs, 5 pmol of primer (each of F and R), 1.0 mM MgCl2 and 0.5U Taq polymerase will be carried out with distilled water in a volume of 20µl. At the end of amplification cycle, amplification products were
used with appropriate restriction enzymes. Restriction products were carried out in 3% agarose gel electrophoresis and visualized under UV light.
Global DNA methylation analysis DNA were analyzed by Global DNA Methylation ELISA Kit (5'-methyl-2'deoxycytidine Quantitation Catalog Number STA-380 Cellbiolabs). At first incubate the sample DNA at 95ºC for 5 minutes and then save sample on the ice. The denatured DNA was incubated in 20 mM Sodium Acetate (pH 5.2) for 2 hours at 37 0C. Then, it was incubated with 5-10 units of nuclease P1 for 2 hours. The reaction mixture was centrifuged at 6000 g for 5 minutes and the supernatant was used for the 5MedCyd ELISA assay. In the pre-treated DNA samples, the amount of 5MedCyd was determined by comparing with the absorbance of a known 5MedCyd standard curve. The kit has a 5MedCyd detection sensitivity from 300 nM to 40.000 nM. Absorbance detected automatically by Spectramax i3 microplate reader at 450 nm. Statistical analysis The results were evaluated by using chi-square and binary logistic regression analysis methods in relation to disease formation and disease findings and polymorphisms. In addition, the groups were analyzed to determine if they were in the Hardy Weinberg equilibrium. Haplotype analysis was performed. Continuous variables (age, height, weight ...) were compared with Mann-Whitney U Test for abnormal variables. Student t test was applied for normally distributed variables. P values less than 0.05 are considered significant. RESULTS In our study, the mean age of 79 patients with RRMS was 47.2 ± 0.5 and the mean age of the control group was 42 ± 3.0. There was no significant difference in age between the two groups (p = 0.158). Demographic data on groups are given in Table 2. Allele and genotype
distributions of FOXO1 (rs3900833, rs4581585), FOXO3A (rs2253310 rs4966936) are given in Table 3.
According to the obtained data, the genotypes of FOXO3A gene rs2253310 polymorphism were found to be significantly different between the patients and control subjects (p <0.001). It was determined that individuals with GC genotype could be significantly protective. There was also a significant difference between the groups (p = 0.015). It was determined that T allele may be a risk factor for the disease. The FOXO3A gene rs4966936 polymorphism was also found to be significantly associated with RRMS disease in terms of genotype (p = 0.019). TC and CC genotypes were found to be higher in the control individuals than the patients. When allele distribution was analyzed, it was determined that G allele could increase RRMS risk by 4.48 times (p <0.001). When the FOXO1 gene rs3900833 genotypes and alleles were analyzed, a significant difference was observed between the groups (p <0.001, p <0.001). Individuals with GG genotype and G alleles were found to have a significantly higher risk of developing RRMS than others. FOXO1 gene rs4581585 genotypes and alleles were compared, no significant difference was observed between the groups (p = 0.985). rs3900833 genetic variant of FOXO1 were analyzed in RRMS. Result of this analysis AA genotype and A allele may be a protective effect for RRMS disease (p<0.001). In our study, control individuals with RRMS patients were compared in terms of global DNA methylation. Based on the detection of ELISA-based 5'-methyl-2'-deoxycytidine (5MedCyd), we have found that the methylation rate of RRMS patients was significantly higher than the control subjects (p <0.001). (figure 4)
As a result, FOXO3A and FOXO family member FOXO1 gene variants and global DNA methylations analyzes were performed and the correlation between them was investigated. In RRMS patients with T alleles of the FOXO3A gene rs4966936 gene polymorphism and in the rs2253310 gene polymorphism, the methylation rate was found to be higher in RRMS patients with G allele (p = 0.000, p = 0.000) (fig. 5).
Also result of our analyzed we have shown that persons who have RRMS patient and T allele (FOXO3A gene rs4966936 polymorphism) and G allele (FOXO3A gene rs2253310) were more methylated than control group. We wanted to evaluate global DNA methylation and its effect on RRMS disease and evaluated with ROC analysis method. ROC analysis was performed to evaluate the predictive power of global DNA methylation for RRMS. When a comparison was made between control and RRMS, the area under the ROC curve was determined to be 0.683. (95% confidence interval; CI = 0.620–0.746, P <0.0001). (Figure 6)
DISCUSSION Multiple sclerosis (MS) is a multifactorial disease, often characterized by inflammation. Neurodegeneration and central nervous system healing systems are damaged in the disease. The cause of MS is not yet clear, but environmental, genetic and immune factors are known to play a role in the etiopathogenesis of this complex disease. (Lazibat et al., 2018). In addition, multiple sclerosis is considered a neurodegenerative disease due to neuronal loss, permanent axonal damage, and neurological insufficiency in patients. (Lassmann et al., 2011 Shindler et al., 2010) FOXO transcription factors control apoptosis, proliferation, differentiation and metabolic processes. Loss of FOXO function was detected in some types of cancer. This loss in epithelial cancer has resulted in a tendency to cellular survival and neoplasia. FOXO factors are therefore well-intentioned tumor suppressors and their potential use as therapeutic targets in cancer is a matter of debate. FOXO factors can positively modulate cell survival through activation of various detoxification genes and complicate the hypothetical therapeutic potential (Monsalve et al., 2011). Activation of FOXO factors may cause both induction of survival genes and apoptosis. The interaction and post-transcriptional modification of FOXO with choreographers determines the balance. In response to increased oxidative stress, interaction with CBP / p300 acts as a coactivator in other FOXO target genes, reducing FOXO transcriptional activity on pro-survival genes (Frescas et al., 2005). CBP / p300 acetylates FOXO and induces its nuclear exclusion and its degradation by the proteasome. When the metabolic conditions are sufficient, SIRT1 and SIRT2s help deprotect FOXOs and facilitate translocation to the nucleus and initiate the apoptotic process. NAD-linked protein deacetylase SIRT1, including MS in neurological diseases involved in the pathogenesis of neurodegeneration has been shown to play a role (Nimmagadda et al., 2017). SIRT1 activates FOXO on pro-survival genes, while reducing its activity on pro-apoptotic genes. Studies showing that FOXO genes are regulated by SIRT and sirtuin have a direct relationship with MS suggest that the FOXO gene family may also have an effect on MS disease. Neurodegeneration is an important determinant of multiple sclerosis (MS), but currently approved therapies have reduced inflammation and have not been shown to reduce neurodegeneration (Motta et al., 2004). It is known that FOXO3A acts as a transcription factor in the regulation of many proapoptotic genes (PI3K-AKT pathway genes) (Potente et al., 2005; Czymai et al., 2010). However, FOXO3A is known to be effective in the regulation of DNMT3B acting on DNA methylation as an epigenetic agent (Herzog et al., 2009). Pathological epigenetic changes, chromosomal integrity and gene functions can be controlled by new mechanisms. DNA hypomethylation may induce the formation of chromosomal instability (Esteller et al., 2008; Hatziapostolou et al., 2011). DNA methylation is an epigenetic signal affected by environmental factors and associated with changes in gene expression and phenotypes. Brooke Rhead et al. 2018 suggested that MS patients have genomic regions that are differentiated in T cells compared to healthy controls (Rhead etal., 2018). Chomyk et al 2017 correlated DNA methylation with demyelination and gene
expression in hippocampus of MS patients. In this study, the MS hippocampus followed by demyelination and methylation changes identified candidate genes and MS brain in the synaptic plasticity, memory performance and neuronal survival may have played a role in changing (Chomyk et al.,2017). Previous studies have shown that hippocampal demyelination occurs in MS patients, leads to loss of synaptic severity, and may affect the expression of synaptic and neuronal genes and regulate the expression of neuronal miRNAs. (Dutta et al., 2011; Dutta et al., 2013). In another study, Kulakova et al. 2016 investigated the relationship between whole genome methylation and MS disease, it was shown the relation between DNA methylation in MS development. For the first time, it has been shown that DNA methylation as an epigenetic mechanism plays a role in the formation of two distinct clinical types of MS (PPMS and RRMS) (Kulakova et al.,2016). In our study, 5MedCyd levels were determined by binding to DNA and the relationship between FOXO3A and FOXO1 gene variants was investigated. The effects of global DNA methylation and FOXO gene variants on RRMS disease have been demonstrated in our study. In the light of our data, we can say that FOXO3A (rs2253310 rs4966936) FOXO1 (rs3900833) gene variants and global DNA methylation can independently affect RRMS disease. These results suggest that DNA methylation and FOXO gene variants may be effective in neuronal loss in RRMS. The biggest limitation in our study was that the protein levels of genes were not investigated due to lack of budget. In subsequent studies, it is possible to investigate miRNAs that regulate FOXO gene family and other gene variants that affect methylation.
Acknowledgement This investigation was supported by Muğla Sıtkı Koçman University Research Project Coordination Office (Project Number: 17/181). This study has published as a poster in 5th Congress of the European Academy of Neurology 2019.
REFERENCES Bedford, M.T., 2007. Arginine methylation at a glance. J Cell Sci.120:4243–4246. Bos, S.D., Barcellos, L.F., 2018. Increased DNA methylation of SLFN12 in CD4+ and CD8+ T cells from multiple sclerosis patients. PLoS One. 31,13(10):e0206511. Burgering, B.M., Medema, R.H., 2003. Decisions on life and death: FOXO Forkhead transcription factors are in command when PKB/Akt is off duty. J Leukoc Biol. 73: 689-701. Chomyk, AM., Volsko, C., Tripathi, A., et al., 2017. DNA methylation in demyelinated multiple sclerosis hippocampus. Sci Rep. 18:7(1):8623-5. Czymai, T., Viemann, D., Sticht, C., et al., 2010. FOXO3 modulates endothelial gene expression and function by classical and alternative mechanisms. J Biol Chem. 285, 10163–10178. Dutta, R., Chang, A., Doud, MK., et al., 2011. Demyelination causes synaptic alterations in hippocampi from multiple sclerosis patients. Ann Neurol. 69(3),445-54. Dutta, R., Chomyk, AM., Chang, A., et al., 2008. Epigenetics in cancer. N Engl J Med; 358, 1148-1159. Fox, RJ., Staugaitis, SM., Macklin, WB., Trapp, BD., 2013. Hippocampal demyelination and memory dysfunction are associated with increased levels of the neuronal microRNA miR-124 and reduced AMPA receptors.Ann Neurol.73(5), 637-45. Frescas, D., Valenti. L., Accili, D., 2005. Nuclear trapping of the forkhead transcription factor FoxO1 via Sirtdependent deacetylation promotes expression of glucogenetic genes. J Biol Chem. 280(21), 20589-95. Hafler, DA., Slavik. J.M., Anderson, D.E., O’Connor, K.C, De Jager, P., Baecher-Allan, C., 2005. Multiple sclerosis. Immunological Reviews. 204, 208-31. Hannenhalli, S., Kaestner, K.H., 2009. The evolution of Fox genes and their role in development and disease. Nat Rev Genet. 10, 233-40. Hatziapostolou, M., Iliopoulos, D., 2011. Epigenetic aberrations during oncogenesis. Cell Mol Life Sci. 68, 1681-1702. Henderson, A.P.D., Barnett, M.H., Parratt, J.D.E., Prineas, J.W., 2009. Multiple sclerosis: distribution of infl ammatory cells in newly forming lesions. Ann Neurol. 66(6), 739-53. Herzog, C.R., Blake, D.C Jr., Mikse, O.R., Grigoryeva L.S., Gundermann, E.L., 2009. FoxO3a gene is a target of deletion in mouse lung adenocarcinoma. Oncol Rep. 22, 837–843. Hosaka, T., Biggs, W.H., Tieu, D., 2004. Disruption of forkhead transcription factor (FOXO) family members in mice reveals their functional diversification. Proc Natl Acad Sci USA. 101, 2975-80. Kulakova, OG., Kabilov, MR., Danilova, LV., et al., 2016. Whole-Genome DNA Methylation Analysis of Peripheral Blood Mononuclear Cells in Multiple Sclerosis Patients with Different Disease Courses. Acta Naturae. 8(3), 103-110. Lassmann, H., 2011. Pathophysiology of inflammation and tissue injury in multiple sclerosis: what are the targets for therapy. J Neurol Sci.15;306(1-2), 167-9. Lazibat, I., Rubinić Majdak, M., Županić, S., 2018. Multiple Sclerosis: New Aspects of Immunopathogenesis. Acta Clin Croat. 57(2), 352-361.
Lin, R.K., Wang, Y.C., 2014. Dysregulated transcriptional and post-translational control of DNA methyltransferases in cancer. Cell Biosci.19(4),46. Matsui, M., 2008. Multiple sclerosis immunology for clinicians. Neurol Asia.13,195-8. Monsalve, M., Olmos, Y., 2011. The complex biology of FOXO. Curr Drug Targets.12(9),1322-50. Motta, M.C., Divecha, N., Lemieux, M., et al., 2004. Mammalian SIRT1 represses forkhead transcription factors. Cell. 16(4), 551-63. Prat, E., Martin, R., 2002.The immunopathogenesis of multiple sclerosis. J Rehabil Res Dev. 39(2),187-99. Nimmagadda, V.K., Makar, T.K., Chandrasekaran, K., et al., 2017. SIRT1 and NAD+ precursors: Therapeutic targets in multiple sclerosis a review. J Neuroimmunol. 15(304), 29-34. Potente, M., Urbich, C., Sasaki, K., et al., 2005. Immunology of multiple sclerosis. Annu Rev Immunol. 23(1),683-7475. Shindler, K.S, Ventura, E., Dutt, M., Elliott, P., Fitzgerald, D.C., Rostami, A., 2010. Oral resveratrol reduces neuronal damage in a model of multiple sclerosis. J Neuroophthalmol. 30(4),328-39. Steinman, L., Martin, R., Bernard, C., Conlon, P., Oksenberg, J.R., 2002. Multiple sclerosis: deeper understanding of its pathogenesis reveals new targets for therapy. Annu Rev Neurosci. 25, 491-505. Tran, H., Brunet, A., Griffith, E.C., Greenberg, M.E., 2003. The many forks in FOXO's road. Sci STKE. 4(2003), 172. Yang, Y., et al. 2015. PRMT9 is a type II methyltransferase that methylates the splicing factor SAP145. Nat Commun. 6, 6428. Zeiher, A.M., Dimmeler, S., 2005. Involvement of FOXO transcription factors in angiogenesis and postnatal neovascularization. J Clin Invest.115, 2382–2392.
Fig. 4. Distribution of global DNA methylation between patient and control subjects.
Fig. 5. Distribution of the relationship between FOXO3A gene rs2253310 and rs4966936 polymorphisms and global DNA methylation.
Fig. 6. ROC analysis curve for global DNA methylation.
Table 1. FOXO3a (rs2253310 rs4966936) FOXO1 (rs3900833, rs4581585) genes PCR-RFLP conditions. Gene
Polymorphism rs2253310
FOXO3A
Primer F: 5’-GAGCTTGCTTTGGAGATGCA-3’ R: 5’- CCCAGTCACTCACATAGTCCT-3’
An. Temp. 530C
RE DpnI
PCR product GG: 321 GC: 321, 127, 194 CC: 127, 194
rs4966936
F: 5’-GGGTCCTGAGAACTTCTGAGT-3’ R: 5’-GACATTCTGTAAGACATTCTGCCT-3’
530C
SfcI
rs3900833
F 5’ GCATTTGAAACAGGTCCCCA 3’ R 5’TCAGCATGTTTCCTGGTGGTT 3’
61 0C
Hhal1
rs4581585
F ’TTTGAGCATCATGTTGCCACTCAAGAAGTT 3’ R 5’CGAAGCCCACAACCCACT GAGCATTT 3’
61 0C
FOXO1
TT:224 TC:224, 152, 72 CC:152, 72 GA: 623, 473, 150 GG: 473, 150 AA: 623 CT: 151, 125, 26 CC: 125, 26 TT:151, 26
Dra1
Table 2. Demographic information of RRMS and control individuals. Clinical Features Age Average (Min-Max) Gender Male (n%) Female (n%) Expanded disability status scale (EDSS)
RRMS (n=79) 47.2 ± 0.5 22 % 27.8 57 % 72.2 3.32 (0.42–4.32)
Control (n=104) 42 ± 3.0 34 % 34.7 70 % 67.3
P 0.158
Table 3. Genotype distributions of FOXO1 (rs3900833, rs4581585), FOXO3A (rs2253310 rs4966936). FOXO3A
Genotype
P
rs2253310
Control n (%)
RRMS n (%)
GG
17 21.5%
85 81.7%
GC
60 75.9%
19 18.3%
CC
2 2.5%
-
16 20.3% 35 44.3% 28 35.4% Control n (%)
41 39.4% 34 32.7% 29 27.9% RRMS n (%)
58 73.4% 20 25.3% 1 1.3%
31 49.2% 11 17.5% 21 33.3%
52 65.8% 19 24.1% 8 10.1%
68 65.4% 26 25.0% 10 9.6%
OR (% 95 CI)
Reference <0.001
0.063
(0.030-0.132) -
rs4966936 TT TC CC FOXO1 rs3900833 AA GA GG
Reference 0.019
0.379 0.404
(0.180-0.799) (0.186-0.879)
Reference <0.001
1.029
(0.438
39.290 (5.043
2.420) 306.100)
rs4581585 TT CT CC
1 0.985 1.046
(0.523-2.093)
0.956
(0.353-2.591)
Table 4. Alleles and genotype distributions of FOXO3A (rs2253310 rs4966936) FOXO1 (rs3900833, rs4581585). FOXO3A rs2253310 G Allele C Allele
ALLELES Control n (%) 94 59.5% 64 40.5%
RRMS n (%) 189 90.9% 19 9.1%
67 42.4%
116 55.8%
91 57.6%
92 44.2%
Control n (%) 136 86.1% 22 13.9%
RRMS n (%) 73 (57.9%) 53 42.1%
123 77.8% 35 22.2%
162 77.9% 46 22.1%
P
OR (% 95 CI) 1
<0.001 0.148 (0.084-0.261)
rs4966936 T Allele C Allele
1 <0.001 0.584 (0.385-0.887)
FOXO1 rs3900833 A Allele G Allele
P
OR (% 95 CI) 1
<0.001 4.488 (2.531-7.958)
rs4581585 T Allele C Allele
1 0.546 0.998 (0.606-1.642)