The effect of inulin and wheat bran on intestinal health and microbiota in the early life of broiler chickens1

The effect of inulin and wheat bran on intestinal health and microbiota in the early life of broiler chickens1 Bing Li,∗, Julie Leblois,∗,† Bernard Taminiau,‡ Martine Schroyen,∗ Yves Beckers,∗ J´erˆome Bindelle,∗ and Nadia Everaert∗,2 ∗

Precision livestock and nutrition unit, Gembloux Agro-Bio Tech, TERRA, Teaching and Research Centre, University of Li`ege, Passage des D´eport´es, 2. 5030 Gembloux, Belgium; † Research Foundation for Industry and Agriculture, National Scientific Research Foundation (FRIA-FNRS), 1000 Brussels, Belgium; and ‡ FARAH Department of Food Sciences - Microbiology, University of Li`ege, Avenue de Cureghem 180, 4000 Liege, Belgium ABSTRACT Inulin and wheat bran were added to the starter diets of broiler chickens to investigate the potential of these ingredients to improve the host’s health and growth performance, as well as the underlying mechanisms of their effects. A total of 960 1-day-old chicks were assigned to 4 treatments: control (CON), 2% inulin (IN), 10% wheat bran (WB), and 10% wheat bran +2% inulin (WB+IN). On day 11, 6 chicks per treatment were euthanized. A general linear model procedure with Tukey’s multiple range test was performed to compare a series of parameters between treatments. The WB-containing treatments improved BW on day 7, day 11, day 35, and BW gain until day 11 (P < 0.05), but only the WB+IN treatment showed a lower feed conversion ratio than the CON treatment (P = 0.011). Furthermore, the WB+IN treatment showed the highest villus height in the jejunum and ileum (P < 0.05), and the highest jejunal ratio villus height/crypt depth

(P = 0.035). The concentration of acetate in the ceca was higher in the CON treatment compared to the IN treatment (P = 0.040). The IN treatment increased the concentration (P = 0.003) and ratio (P = 0.004) of iso-butyrate compared to the WB+IN and the CON treatments (P < 0.05). A clustering result exhibited similar intestinal microbiota profiles in the chicks receiving the IN and the WB+IN diets (P > 0.05), but these profiles were different from those found in chicks receiving the WB and the CON diets (P < 0.05). In conclusion, wheat bran and the combination of wheat bran and inulin ameliorated the growth performance and gut morphology of the starter chicks, which resulted in a higher BW until day 35. Inulin, on the other hand, had a greater ability to influence the microbiota profile. The beneficial results found in relation to BW and gut morphology during the starter period suggested a synergistic effect of inulin and wheat bran.

Key words: intestinal microbiota, intestinal health, chicken, wheat bran, inulin 2018 Poultry Science 0:1–10 http://dx.doi.org/10.3382/ps/pey195

INTRODUCTION

Lactobacillus, thus improving the host’s microbial balance (Courtin et al., 2008; Rebol´e et al., 2010; Nabizadeh, 2012). As per definition of prebiotics, inulin and wheat bran serve as a substrate for shortchain fatty acids (SCFA) synthesis by different types of bacteria, generating increased amounts of propionate and butyrate (Gibson et al., 2004; De Paepe et al., 2017). These trophic substances have been shown to ameliorate the development of gut morphology (Scheppach, 1994; Hosseini et al., 2011). Furthermore, inulin and wheat bran can also improve the intestinal barrier, protecting the host against pathogens (Neyrinck et al., 2012; Chen et al., 2013; Chen et al., 2017; Wu et al., 2017). Since the initial stage of microbiota colonization in the intestine starts immediately from birth or hatch, it is important to establish a beneficial microbial community as soon as possible to have a long-lasting positive effect on intestinal health (Edwards and Parrett, 2002, 2003; Amit-Romach et al., 2004; Thompson et al.,

Inulin, a heterogeneous blend of fructose polymers, extracted from chicory roots, is a widely recognized prebiotic. It is the only one to date that was awarded an EU health claim on improving bowel function (Gibson et al., 2017). Wheat bran is a byproduct of the wheat milling process and specific components of wheat bran, such as arabinoxylans, have been shown to display prebiotic effects (Neyrinck and Delzenne, 2010; Broekaert et al., 2011). In poultry, inulin and wheat bran enhance the abundance of Bifidobacterium and  C 2018 Poultry Science Association Inc. Received December 4, 2017. Accepted April 27, 2018. 1 The nucleotide sequence data reported in this paper have been submitted to National Center for Biotechnology Information (NCBI) nucleotide sequence database and have been assigned the accession number PRJNA419868. 2 Corresponding author: [email protected]

1 Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey195/5005859 by University Library UUtrecht user on 29 May 2018

2

LI ET AL.

2008). With this in mind, one strategy gaining increasing attention is to attempt to modulate the colonization of microbiota in early life. In poultry, effect of a temporary supplementation of prebiotics early in life is poorly investigated. Indeed, the standard strategy of using prebiotics or feed additives is to provide these ingredients during the entire rearing period, or from the growing period onwards (Jørgensen et al., 1996; Rebol´e et al., 2010; Nabizadeh, 2012). Therefore, in this study, a supplementation of inulin and wheat bran separately or in combination, limited to the starter period, was applied to investigate whether these ingredients would impact the cecal microbiota and intestinal health at this young age and if the potential changes would last later over the growing period and improve global performances, providing a guidance to further research on the longterm effect of these ingredients.

MATERIALS AND METHODS Ethics Statement The present animal experiment was approved by the Ethical Committee of Li`ege University (Ethical protocol 1703, Belgium) and was performed at the facilities of Gembloux Agro-Bio Tech (Gembloux, Belgium).

Experimental Design, Broilers, and Diets A total of 960 1-day-old male Ross 308 broiler chicks (Belgabroed, Merksplas, Belgium) were housed in 24 floor pens (3 m × 1 m), each containing 40 birds. Wood shavings were used as bedding material. Pens (n = 6) were randomly assigned to 1 of the following 4 groups: 1) IN (2% inulin diet); 2) WB (10% wheat bran diet); 3) WB+IN (10% wheat bran+2% inulin diet); 4) CON (control diet without inulin or wheat bran). Inulin was provided by COSUCRA (Warcoing, Belgium), and is composed of linear chains of fructose units with 1 terminal glucose unit with a degree of polymerization ranging from 2 to 60 and with average polymerization of about 10. Wheat bran was provided by Bauwens sprl (Sombreffe, Belgium). Nutrient levels of the diets (Table 1) were based on Aviagen guidelines (2014) for Ross 308 broilers recommendations and were iso-energetic and isonitrogenous between treatments. Birds had free access to water and feed throughout the whole experiment. The environmental temperature during the first 3 d of life was 34◦ C, and was reduced progressively to 25◦ C until day 11. The lighting program consisted of 23 h of light and 1 h of darkness per day during the first week and 18 h of light and 6 h of darkness thereafter.

Growth Performance and Nutrient Digestibility The average BW per pen on day 0, day 7, day 11, and the feed intake per pen during the starter period

Table 1. Composition and nutrient content of the starter diet. % Corn Soybean meal 49 Soybean oil Corn starch Extruded soybean Inulin Wheat bran Salt Cellulose Monocalcium phosphate Limestone 1 Vit:Min 0.1% L-Lysine HCl DL-Methionine L-Threonine Tryptophan

CON 50.50 19.62 2.96 6.97 15.00 0 0 0.15 0.40 1.54 1.46 0.10 0.52 0.48 0.27 0.03

IN

WB

50.50 22.69 4.78 4.10 11.00 2.00 0 0.15 0.41 1.55 1.46 0.10 0.51 0.47 0.26 0.02

27.75 24.34 6.50 17.70 9.21 0 10.00 0.15 0 1.58 1.41 0.10 0.49 0.49 0.27 0.01

WB+IN 20.31 26.46 7.00 21.76 7.89 2.00 10.00 0.15 0.09 1.61 1.39 0.10 0.46 0.50 0.27 0.01

Nutrient composition (analyzed, %) Crude protein 22.06 21.41 21.16 21.17 Crude fat 9.67 10.83 11.76 11.03 NDF 11.91 12.44 11.06 10.59 ADF 4.59 4.73 4.38 4.10 ME, kcal/kg 3088 3258 3289 2907 CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. 1 Providing per kilogram of complete feed: vitamin A (retinyl acetate) 13,500 IU, vitamin D3 3,000 IU, vitamin E (dl-alpha-tocopheryl acetate) 55 IU, vitamin E (dl-alpha-tocopherol) 55 IU, vitamin B1/ thiamine 1.6 mg, vitamin B1 2 mg, vitamin B2 5 mg, vitamin B3 15 mg, vitamin B5 30 mg, vitamin B6 4 mg, vitamin B9 1 mg, vitamin B12 25 mg, vitamin K3 5 mg, iron 100 mg, copper 36 mg, zinc 120 mg, iodine 2.4 mg, selenium 0.7 mg, manganese 192 mg. ADF, acid detergent fiber; NDF, neutral detergent fiber.

were recorded in order to measure the BW gain and feed conversion ratio (FCR). From day 11 onwards, 39 reserving birds per treatment were reared until day 35 on a standard grower (day 11 to day 24) (CP: 19.95% and ME: 2,864 kcal/kg) and finisher (day 24 to day 35) (CP: 18.11% and ME: 3,215 kcal/kg) diet. Individual BW of these broilers was determined on day 35. On day 3, 6 chicks per pen were transferred to digestibility cages. They were fed their respective experimental diets with the addition of 0.5% titanium dioxide as an indigestible marker. Droppings were collected from day 8 to day 10 and pooled per cage by mixing equal daily amounts together. On day 10, all chicks from the digestibility cages were euthanized by electrical stunning followed by decapitation and ileal contents were collected by saline flushing. Individual samples were pooled per cage for subsequent analyses. Dietary content and freeze-dried fecal and ileal matter were ground to 1 mm and analyzed for their contents in dry matter after drying at 105◦ C for 24 h (method 967.03, AOAC, 1990). The nitrogen (N) content was analyzed by using the Kjeldahl method and calculating the crude protein content (N × 6.25, method 981.10, AOAC, 1990); crude fat content was determined using the Soxhlet method with diethyl ether (method 920.29; AOAC, 1990), and gross energy was calculated by means of an adiabatic oxygen bomb calorimeter (1241 Adiabatic Calorimeter, PARR Instrument

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey195/5005859 by University Library UUtrecht user on 29 May 2018

INTESTINAL HEALTH AND MICROBIAL ECOLOGY

Co., IL). TiO2 was measured as described by Myers et al. (2004), and the results were used to calculate nutrient digestibility as follows: digestibility or retention = 1–[(diet TiO2/ digesta TiO2 ) × (digesta nutrient/diet nutrient)]. In addition, the diets were also analyzed for their content in neutral detergent fiber using thermostable amylase (Termamyl, Novo Nordisk, Bagsværd, Denmark) and in acid detergent fiber, both were corrected for ash (550◦ C for 8 h, method 923.03; AOAC, 1990).

3

at 60◦ C), and extension (30 s at 72◦ C). Three reference genes ACTB (β -actin), B2M (β 2-microglobulin), and EF1A1 (eukaryotic translation elongation factor 1 alpha 1) (Table 2) were selected for normalization purposes. A melting curve analysis was performed in order to check the specificity of the primers, and the standard curve was determined by using pooled samples to ensure an amplification efficiency of between 90 and 110%. The 2−ΔΔCt method was used automatically by the ABI StepOnePlus system to analyze Mucin 2, Occludin, and Claudin-1.

Sample Collection Within 5 min after euthanasia on day 11, the gastrointestinal tract was removed from 1 bird from each pen (n = 6). Cecal content was collected, snap-frozen in liquid nitrogen, and then stored at –80◦ C until further microbiota and SCFA analysis. Five-centimeter jejunal and ileal segments were taken and stored in 4% paraformaldehyde for gut morphology analysis. Another 5-cm segment from the jejunum and the ileum were snap-frozen in liquid nitrogen and stored at –80◦ C for gene expression analysis.

Gut Morphology After 48 h of fixation in 4% paraformaldehyde, the samples were stored in 70% ethanol and processed through a series of dehydration, clearing, and impregnation with wax. Paraffin-embedded samples were sliced into 5-μm sections using a microtome, fixed onto slides, and stained with hematoxylin and eosin. Villus height and crypt depth were measured at 4 × magnification using an OLYMPUS BX51 microscope and imaging software (Olympus Corporation, Hamburg, Germany) in 15 well-oriented villi and associated crypts per animal.

Gene Expression Total RNA was isolated from the sampled jejunum and ileum tissue using PureYield RNA Midiprep System (Promega, Madison), according to the manufacturer’s instructions. The isolated RNA was tested for purity and quantity using a spectrophotometer (Thermo Scientific NanoDrop 2000). In addition, RNA integrity was verified by visualization of 18 and 28S ribosomal RNA bands stained with Midori Green from Nippon Genetics (Filter Service, Eupen, Belgium) after gel electrophoresis on a 1% agarose gel. Singlestranded cDNA was synthesized from 0.95 μg of total RNA using the PrimeScript RT Reagent Kit (Perfect Real Time) (Takara, Japan). Real-time PCR was performed in ABI StepOnePlus (Applied Biosystems), using the SYBR Premix EX Taq II (Tli RNaseH plus) kit (Takara, Japan). The following PCR reaction program was applied: 30 s heating at 95◦ C, followed by 40 cycles of denaturation (5 s at 95◦ C), annealing (30 s

SCFA Analysis A mixture of cecal content and water 1:4 (wt/wt) was homogenized for 30 s and centrifuged at 13,000 g for 15 min. After centrifugation, 1 mL supernatant was collected and the pH was adjusted to 2–3 using 1 N H2 SO4 . The supernatant was filtered through a sterile acetate filter. Acetate, propionate, butyrate, valerate, iso-butyrate, and iso-valerate concentrations were analyzed by HPLC, using a Waters system fitted with an Aminex HPX-87H column (Bio-Rad, Hercules, CA) combined with a UV detector (210 nm), with sulfuric acid (5 mM) as the mobile phase at a flow rate of 0.6 mL/min.

Gut Microbiota Analysis DNA extraction of the cecal content was performed using the QIAamp DNA Stool Mini Kit (Qiagen, Hilden, Germany), following the manufacturer’s recommendations but adding a beadbeating step. PCR amplification of the V1-V3 region of the 16S rDNA and library preparation were performed with the following primers, forward (5 -GAGAGTTTGATYMTGGCTCAG-3 ) and reverse (5 -ACCGCGGCTGCTGGCAC-3 ). Sequencing was performed on an Illumina MiSeq platform, following Bindels et al. (2015).

Statistical Analysis Ordination analysis and 3d plots were performed with Vegan, Vegan3d, and rgl packages in R. Nonmetric dimensional scaling, based upon the BrayCurtis dissimilarity matrix, was applied in order to visualize the biodiversity between the groups. Analysis of molecular variance test was performed to assess the diversity clustering of the Bray-Curtis matrix treatments using MOTHUR software (Martin, 2002). Statistical differences between bacterial biodiversity, richness, and evenness were assessed with an unpaired t-test using PRISM 6 (Graphpad Software). The results regarding growth performance, gut morphology, gene expression, SCFA profile, and bacterial genera were analyzed by singlefactor ANOVA using the general linear model procedure

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey195/5005859 by University Library UUtrecht user on 29 May 2018

4

LI ET AL. Table 2. Primer information for quantitative RT-PCR assays. 5 -primer-3

GenBank Accession No.

Efficiency (%)

F-CAACACAGTGCTGTCTGGTGGTA R-ATCGTACTCCTGCTTGCTGATCC F-GGCACGCCATCACTATC R-CCTGCATCTGCCCATTT F-CGCCGTGCGGGTGTCGTTTC R-TTGCCGGAATCGACGTGGCC F-CACCAACGGCAACTGAAATAGTC R- GCCAAACCATGGGTAACTCACA F-TCATCGCCTCCATCGTCTAC R-TCTTACTGCGCGTCTTCTGG F-CTGATTGCTTCCAACCAG R-CAGGTCAAACAGAGGTACAAG

X00182.1

101

Z48922

99

NM 204,157.2

103

XM 421,035.2

101

NM 205,128.1

100

NM 0,010,13611

107

Gene ACTB B2M EF1A1 Mucin 2 Occludin Claudin-1

retention was observed (P > 0.05). However, the highest total tract digestibility of crude fat occurred in the WB treatment, which was higher compared to the CON treatment, with the IN and the WB+IN treatments showing intermediate values (P = 0.020).

of the SPSS software (IBM SPSS Statistics 21) with the dietary treatment as a variable. Significant differences between treatment means were determined by Tukey’s multiple range test. Significance was based on P < 0.05.

RESULTS Growth Performance and Nutrient Digestibility

Gut Morphology

Mortality was low for all treatments. The initial BW and feed intake until day 11 did not differ between the dietary treatments (P > 0.05) (Table 3). The WBcontaining treatments induced a higher BW on day 7 (P = 0.003) and on day 11 (P < 0.001), and increased BW gains until day 11 (P < 0.001) compared to the IN and the CON treatments. The beneficial effect of the WBcontaining treatments on BW remained until day 35 (P < 0.001). Only the WB+IN treatment showed a lower FCR compared to the CON treatment, whereas the other treatments showed intermediate values (P = 0.011). No significant treatment effect on apparent digestibility of ME, ileal crude protein, or total tract N

In the jejunum, the WB+IN treatment increased villus height compared to the IN and the CON treatments, with the WB treatment showing intermediate values (P = 0.001) (Table 4). The ileal villus height in the WB+IN treatment was higher compared to the other 3 treatments (P < 0.001). No difference in crypt depth was observed in the jejunum or ileum (P > 0.05). The dietary treatments were found not to affect the villus height/crypth depth (V/C) ratio in the ileum (P = 0.156), but the WB+IN treatment showed the highest V/C ratio in the jejunum compared to the IN and the CON treatments, whereas the WB treatment gave intermediate values (P = 0.035).

Table 3. Effect of inulin and wheat bran in the starter diets on the growth performance of broiler chickens from day 1 to day 11, final individual BW on day 35 and digestibility of feces and ileal content on day 10. CON

IN

WB

WB+IN

SEM

P

BW on day 0, g BW on day 7, g BW on d 11, g BW gain, day 0 to day 11, g/bird Feed intake day 0 to day 11, g/bird FCR, day 0 to day 11 Final BW on day 35, g

46 136b 258b 213b 294 1.38a 1845b

44 136b 254b 210b 278 1.33a,b 1796b

45 143a 269a 224a 296 1.32a,b 2027a

45 147a 277a 232a 293 1.27b 1953a

0.23 1.40 2.16 2.11 2.79 0.01 20.20

0.358 0.003 < 0.001 < 0.001 0.081 0.011 < 0.001

AME (%) Total tract crude fat digestibility (%) Total tract N retention (%) Ileal crude protein digestibility (%)

0.64 0.63b 0.55 0.79

0.67 0.66a,b 0.58 0.76

0.68 0.75a 0.61 0.78

0.61 0.71a,b 0.52 0.79

0.01 0.02 0.01 0.00

0.103 0.020 0.180 0.102

CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, n = 6 per treatment and n = 33–38 for final BW on day 35. a,b Means in the same row not sharing a common superscript are significantly different (P < 0.05).

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey195/5005859 by University Library UUtrecht user on 29 May 2018

5

INTESTINAL HEALTH AND MICROBIAL ECOLOGY

ter removing chimeric sequences, 103,817 high-quality sequences were selected to generate Operational Taxonomic Units (OTUs) with a 97% sequence similarity across 22 samples (1 sample of IN treatment and 1 sample of WB treatment were marked as outliers and were removed). The OTU table was filtered, leaving 10,080 OTUs for subsequent analysis. The differences within the intestinal microbial population between treatments were visualized by nonmetric dimensional scaling built upon a Bray-Curtis distance matrix, based on the species taxonomic level (Figure 1a). A distinct cluster was observed in the chicks receiving the IN and the WB+IN diets compared to those receiving the WB and the CON diets, and this was confirmed by analysis of molecular variance of the distance matrix (P < 0.05). Alpha-diversity showed a slightly lower bacterial diversity, bacterial richness, and bacterial evenness in the WB+IN treatment, but none of these effects reached significance (Figure 1b). At the phylum level (Figure 1c), most of the bacteria were found to belong to Firmicutes, followed by Proteobacteria, Tenericutes, and Bacteroidetes, but we did not observe any shift between phyla. Genera that were each represented by >0.05% of total sequences in at least 1 of the 22 samples were used for further statistical comparison (Figure 1d and Table 7). The 4 predominant genera were vadin BB60 unclassified, Ruminococcaceae unclassified, Lachnospiraceae unclassified, and Blautia. For the Firmicutes phylum, Vadin BB60 unclassified was the most predominant genus and its relative abundance was highest in the WB+IN treatment (P = 0.015), but Flavonifractor, Defluviitaleaceae unclassified, Anaerotruncus, Intestinimonas, and Clostridia unclassified showed a lower relative abundance in the WB+IN treatment compared to the CON treatment (P < 0.05). The same differences occurred in the WB treatment compared to the CON treatment, except for Flavonifractor, Anaerotruncus, and Defluviitaleaceae unclassified (P < 0.05). Furthermore, the relative abundance of Faecalibacterium and Anaerostipes was higher and the relative abundance of Flavonifractor, Intestinimonas, and Clostridia unclassified were lower in the IN treatment

Table 4. Effect of inulin and wheat bran in the starter diets on the villus height (μm), crypt depth (μm), and the ratio villus height/crypt depth (V/C ratio) in the jejunum and ileum of broiler chickens on day 11.

Villus height Jejunum Ileum Crypt depth Jejunum Ileum V/C ratio Jejunum Ileum

CON

IN

WB

WB+IN

SEM

P

832b 463b

760b 475b

941a,b 484b

1075a 579a

33.47 12.36

0.001 < 0.001

152 126

146 119

150 121

164 134

3.00 3.12

0.165 0.345

5.48b 3.72

5.21b 4.02

6.31a,b 4.01

6.61a 4.35

0.21 0.10

0.035 0.156

CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, 6 chicks per treatment and 15 units per chick. a,b Means in the same row not sharing a common superscript are significantly different (P < 0.05).

Gene Expression The expressions of Mucin 2, Occludin, and Claudin1, as shown in Table 5, were not affected by the dietary treatments (P > 0.05).

SCFA Analysis The concentration of acetate was higher in the CON treatment compared to the IN treatment, with the WB and the WB+IN treatments showing intermediate values (P = 0.040) (Table 6). The IN treatment was found to increase the concentration (P = 0.003) and molar ratio (P = 0.004) of iso-butyrate compared to the WB+IN and the CON treatments, whereas WB showed intermediate values. No differences between dietary treatments were shown for the concentration of total SCFA, propionate, butyrate, or iso-valerate, or for the molar ratio of acetate, propionate, butyrate, or iso-valerate (P > 0.05). Valerate was not detectible in these samples.

16S rDNA High-Throughput Sequencing A total of 24 DNA samples of cecal content were used in 16S rDNA high-throughput sequencing. Af-

Table 5. Effect of inulin and wheat bran in the starter diets on the relative abundance (arbitrary units) of gene expression in the jejunum and ileum of broiler chickens on day 11. CON

IN

WB

WB+IN

SEM

P

Jejunum Mucin 2 Occludin Claudin-1

0.47 1.00 0.61

0.47 1.13 0.69

0.43 1.17 0.69

0.50 1.08 0.58

0.05 0.04 0.02

0.960 0.574 0.305

Ileum Mucin 2 Occludin Claudin-1

0.78 1.15 1.14

0.76 1.16 1.00

0.64 1.13 0.80

0.69 1.15 0.77

0.07 0.05 0.07

0.884 0.996 0.217

CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, n = 6 per treatment. Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey195/5005859 by University Library UUtrecht user on 29 May 2018

6

LI ET AL. Table 6. Effect of inulin and wheat bran in the starter diets on the SCFA profile in the cecal content of broiler chickens on day 11. CON

IN

WB

WB+IN

SEM

P

3.70 3.23 0.50 1.15 0.14 0.41

0.060 0.040 0.601 0.782 0.003 0.542

1.49 0.75 1.21 0.26 0.51

0.255 0.596 0.538 0.004 0.410

Total SCFA Acetate Propionate Butyrate Iso-butyrate Iso-valerate

88.27 69.18a 4.60 14.50 0.64b 1.70

mmol/L wet intestinal contents 63.21 76.60 66.55 46.10b 61.89a,b 51.54a,b 4.89 3.57 3.09 12.22 11.14 11.93 1.61a 0.92a,b 0.39b 0.44 1.27 2.10

Acetate Propionate Butyrate Iso-butyrate Iso-valerate

76.58 5.16 15.72 0.71b 1.83

70.47 7.44 18.71 2.71a 0.67

Molar ratio (%) 78.46 4.71 13.92 1.18a,b 1.73

73.46 5.16 17.68 0.55b 3.15

CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, n = 6 per treatment. a,b Means in the same row not sharing a common superscript are significantly different (P < 0.05). SCFA, short-chain fatty acid.

compared to the CON treatment (P < 0.05). In the Proteobacteria phylum, only the relative abundance of Escherichia-Shigella was significant, showing a higher value in the WB+IN treatment compared to the WB and the CON treatments (P = 0.031).

DISCUSSION The objective of the present study was to investigate whether inulin and wheat bran provided either separately or in combination during the starter period exert prebiotic effects, have an impact on growth performance, on fermentation in the ceca, or on the morphology and the intestinal barrier function of the small intestine. Our study showed that the presence of 2% inulin in the starter diet did not improve the growth performance of broiler chickens, and this finding is in agreement with those of other studies (Biggs et al., 2007; Rehman et al., ´ atkiewicz et al., 2011). 2008; Alzueta et al., 2010; Swi  However, Rebol´e et al. (2010) and Nabizadeh (2012) reported a beneficial effect of inulin (0.5 to 1%) in the broiler diet on BW gain. On the other hand, in the present study, the inclusion of 10% wheat bran was found to improve BW on day 7 and on day 11, and to increase BW gain until day 11. The use of high amounts of wheat bran (18.7 and 37.5%) from day 12 onwards has been shown to increase BW and daily BW gain of broilers of 7 wk of age (Jørgensen et al., 1996). A similar beneficial effect on BW has been shown to occur in laying pullets from 10 to 16 wk with 15% wheat bran in the diet (Mart´ınez et al., 2015). In the present study, the addition of wheat bran to the diet increased total tract fat digestibility, which might have been partly responsible for the improved growth in the starter period. The improved BW found here, as a result of the WB and WB+IN treatments, remained until day 35. Whether the effect of wheat bran on the intestinal physiology

provides a lasting result needs to be further investigated. Given that the WB+IN treatment resulted in the most beneficial BW, concomitant with the lowest FCR, we can deduce that the combination of inulin and wheat bran in the starter diet may have had a synergistic effect. We can also hypothesize that these combined ingredients played a particular role on the gut morphology of the chicks, increasing villus height and its ratio, both in the jejunum and ileum. Interestingly, the inclusion of wheat bran alone in the diet did not influence the gut morphology results. In that regard, our results are similar to those of Chen et al. (2013), who found no effect on gut morphology when 10% wheat bran was added to the diet of pigs. Along similar lines, Jenab and Thompson (2000) reported no difference in the crypt depth of the colon tissue in rats, as a result of the same dietary addition. Inversely, in the present study, inulin tended to decrease jejunal villus height and V/C ratio, which is surprising, as several studies have shown an improved intestinal mucosal architecture as a result of adding this prebiotic to broiler chicken diets (Rehman et al., 2007; Rebol´e et al., 2010; Nabizadeh, 2012). It is possible that, in our case, the inclusion level of 2% inulin might have been too high for these young chicks. An experiment conducted by Xu et al. (2003), examining the effects of fructooligosaccharides (FOS) in the diet of broiler chickens, reported that feeding 0.8% FOS slightly decreased villus height and the V/C ratio in the animals’ jejunum and ileum, in comparison with feeding 0.2% and 0.4% FOS. Some studies in pigs, humans, and mice have suggested that the addition of either inulin or wheat bran might alter some of the tight junction or mucus proteins affecting the epithelial barrier function (Neyrinck et al., 2012; Chen et al., 2013; Chen et al., 2017; Wu et al., 2017). However, in our study, no differences between treatments were revealed for the gene expressions of Mucin 2, Occludin, or Claudin-1 in the jejunum or

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey195/5005859 by University Library UUtrecht user on 29 May 2018

INTESTINAL HEALTH AND MICROBIAL ECOLOGY

7

Figure 1. Spatial ordination, bacterial diversity, and taxonomical distribution deduced by 16S profiling CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. (a) Non-metric dimensional scaling (NMDS, 3 axes) showing standard deviation, CON treatment in black, IN treatment in red, WB treatment in green, and WB+IN treatment in blue. (b) Bacterial diversity (Inverse Simpson Biodiversity Index), bacterial richness (Chao1 Richness Index), and bacterial evenness (deduced from Simpson Index). (c) and (d) Mean phylotype distribution (phylum (c) and genus (d) levels) expressed as mean cumulative relative abundance in the cecal content of chicks on day 11.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey195/5005859 by University Library UUtrecht user on 29 May 2018

8

LI ET AL.

Table 7. Bacterial genera that accounted for >0.05% of the total sequences in at least 1 of the 22 samples in the cecal content of chicks on day 11 (abundance of the phylum and genera was expressed as %). Phylum Firmicutes

Proteobacteria

Genus

CON

IN

WB

WB+IN

SEM

P

vadinBB60 unclassified Flavonifractor Faecalibacterium Defluviitaleaceae unclassified Anaerotruncus Intestinimonas Anaerostipes Clostridia unclassified Ruminococcaceae unclassified Lachnospiraceae unclassified Blautia Clostridiales unclassified Subdoligranulum Erysipelotrichaceae unclassified Lactobacillus Pseudoflavonifractor Firmicutes unclassified Candidatus Arthromitus Escherichia-Shigella

27.93a,b 5.71a 0.00b 2.33a 2.25a 2.04a 0.09b 0.04a 19.87 20.15 6.74 3.53 1.72 0.66 0.87 0.23 0.22 0.08 0.49b

17.79b 0.67b 9.56a 0.98a,b 1.66a,b 0.33b 0.98a 0.00b 22.93 20.05 9.00 3.07 3.55 2.22 0.85 0.34 0.07 0.08 1.03a,b

35.18a,b 2.57a,b 1.05b 2.10a 0.94a,b 0.33b 0.27b 0.00b 21.66 19.04 5.67 2.62 1.38 0.44 0.70 0.18 0.27 0.03 0.55b

59.39a 0.36b 0.38b 0.72b 0.45b 0.26b 0.35a,b 0.00b 13.84 13.34 3.16 2.06 0.38 1.07 0.66 0.34 0.14 0.05 2.86a

5.16 0.79 1.19 0.25 0.24 0.27 0.10 0.00b 1.52 1.62 1.45 0.33 0.67 0.29 0.13 0.07 0.04 0.01 0.36

0.015 0.034 0.006 0.037 0.023 0.029 0.009 0.003 0.141 0.384 0.587 0.438 0.437 0.133 0.923 0.813 0.449 0.469 0.031

CON: control diet without inulin or wheat bran, IN: 2% inulin diet, WB: 10% wheat bran diet, WB+IN: 10% wheat bran and 2% inulin diet. Values are mean, n = 5 to 6 per treatment, where 1 IN sample and 1 WB sample have been canceled entirely. a,b Means in the same row not sharing a common superscript are significantly different (P < 0.05).

ileum. In agreement with our finding, the expression of Mucin 2 or Occludin in the colon of mice after a high fat diet was found not to be affected by feeding wheatderived AXOS (Neyrinck et al., 2012). Moreover, Chen et al. (2013) observed no alteration in the Claudin-1 mRNA level in the ileum and colon of weaned pigs, following wheat bran supplementation. Furthermore, Wu et al. (2017) failed to detect, via cell culture, any effect of inulin on the gene or protein expression of Claudin-1 in human intestinal organoids. Our study did not reveal a strong effect of either inulin or wheat bran on the SCFA or microbiota profile. Only an alteration in the levels of acetate and isobutyrate was observed in the ceca. The lack of a greater impact on the SCFA profile might be explained by one or more of the following: 1) the possible occurrence of fermentation earlier in the gastrointestinal tract; 2) the fact that a relatively poor fermentation process occurs at this young age (Amit-Romach et al., 2004); 3) the fact that SCFAs are immediately absorbed by the host or are otherwise utilized by other bacteria (Topping and Clifton, 2001; Duncan et al., 2004a, 2004b; Louis et al., 2007); or 4) the possibility that a different amount of digesta was present in the ceca, affecting the absolute amount of SCFA rather than the concentration. All these possible explanations mean that differences in SCFA profile can be difficult to interpret. The SCFA profile found in the present study, i.e., showing the highest levels of acetate, followed by butyrate, and propionate, is in accordance with the studies of Jørgensen et al. (1996), Rehman et al. (2008), and Rebol´e et al. (2010). With regard to the results found for the gut microbiota in the present study, 4 major phyla (Firmicutes, Proteobacteria, Tenericutes, and Bacteroidetes) were predominant in the ceca and the relative abundance

of Firmicutes was more than 90%, which is consistent with other studies (Corrigan et al., 2015; Pourabedin and Zhao, 2015; Awad et al., 2016). Amit-Romach et al. (2004) found that chicken intestinal microbiota started to colonize at between day 2 and day 4 post-hatch, but could take 14 to 30 d to fully develop in the ceca. Awad et al. (2016) reported that Proteobacteria was significantly more present in chicks during the first days of life and decreased thereafter, whereas Firmicutes was the predominant phylum from the second week onwards. In our study, this situation had already occurred by day 11 and in the study of Corrigan et al. (2015) by day 7. In the present study, a distinct cluster was found in the inulin-containing treatments compared to the WB and the CON treatments. It seemed that, compared to wheat bran, inulin in the diet had a greater ability to influence the microbiota profile. We found that vadinBB60 was the predominant genus in the WB+IN treatment, followed by the WB and the CON treatments, whereas the IN treatment showed the lowest abundance. This finding of a lower abundance of vadinBB60 unclassified induced by inulin is in agreement with the results of a study of the effect of inulin in mice (Neyrinck et al., 2016). However, so far, the reason why the combination of inulin and wheat bran would have increased the abundance of this genus remains unclear. Most of the significant bacteria found (i.e., Flavonifractor, Faecalibacterium, Intestinimonas, and Anaerostipes) have been shown to be related to butyrate production (Schoefer et al., 2003; Sokol et al., 2008; Eeckhaut et al., 2010; Kl¨ aring et al., 2013; Van-den-Abbeele et al., 2013). In the present study, inulin was found to increase the relative abundance of Faecalibacterium and Anaerostipes in comparison with the other 3 alternative treatments used here. Studies in humans (Ramirez-Farias et al., 2008; Dewulf et al.,

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey195/5005859 by University Library UUtrecht user on 29 May 2018

INTESTINAL HEALTH AND MICROBIAL ECOLOGY

2012; Claus, 2017) have demonstrated that inulin exhibited a significant increase in Anaerostipes and Faecalibacterium. To our knowledge, our study is the first report on chickens to provide findings in line with these results. In the present study, the abundance of Escherichia-Shigella, which was found to be the most abundant genus of the Proteobacteria, increased as a result of the WB+IN treatment. Interestingly, this genus has previously been found to be highly abundant in the feces of low FCR birds compared to high FCR birds (Singh et al., 2012). As the WB+IN treatment also had the lowest FCR, in the present study, our results are in line with these findings of Singh et al. (2012). In conclusion, in this study, for both inulin and wheat bran, similar microbiota changes were observed as in other studies on human or animal, but inulin had a greater ability to shape the microbiota profile. However, the inclusion of 2% inulin in the starter diet might have been too high for these young chicks to positively affect performance, as demonstrated by the BW and gut morphology results. In contrast, wheat bran alone and the combination of wheat bran and inulin as an ingredient of the starter diet for broiler chicks could ameliorate growth performance and/or gut morphology during this early period, possibly without requiring any specific measurable positive effect on the intestinal barrier. The beneficial results for the combined diet on BW, FCR, and gut morphology during the starter period suggested a synergistic effect of inulin and wheat bran. In addition, the greater BW of wheat bran alone or in combination with inulin was found to last for a couple of weeks after several weeks after termination of the supplementation, which suggests a long-term effect that deserves further investigation.

ACKNOWLEDGMENTS We thank the GIGA of the University of Li`ege for the gut morphological analysis, and COSUCRA for the provision of inulin. This study was supported by the Welcome Grant received by Nadia Everaert of the University of Li`ege. It was also partially supported by the China Scholarship Council (CSC).

REFERENCES Alzueta, C., M. L. Rodriguez, L. T. Ortiz, A. Rebole, and J. Trevino. 2010. Effects of inulin on growth performance, nutrient digestibility and metabolisable energy in broiler chickens. Br. Poult. Sci. 51:393–398. Amit-Romach, E., D. Sklan, and Z. Uni. 2004. Microflora ecology of the chicken intestine using 16S ribosomal DNA primers. Poult. Sci. 83:1093–1098. AOAC. 1990. Official Methods of Analysis. Association Official Analytical Chemists, Arlington. Awad, W. A., E. Mann, M. Dzieciol, C. Hess, S. Schmitz-Esser, M. Wagner, and M. Hess. 2016. Age-related differences in the luminal and mucosa-associated gut microbiome of broiler chickens and shifts associated with Campylobacter jejuni infection. Front. Cell. Infect. Microbiol. 6:154.

9

Biggs, P., C. M. Parsons, and G. C. Fahey. 2007. The effects of several oligosaccharides on growth performance, nutrient digestibilities, and cecal microbial populations in young chicks. Poult. Sci. 86:2327–2336. Bindels, L. B., A. M. Neyrinck, N. Salazar, B. Taminiau, C. Druart, G. G. Muccioli, E. Fran¸cois, C. Blecker, A. Richel, G. Daube, and J. Mahillon. 2015. Non digestible oligosaccharides modulate the gut microbiota to control the development of leukemia and associated cachexia in mice. PLoS One 10:0131009. Broekaert, W. F., C. M. Courtin, K. Verbeke, T. Van de Wiele, W. Verstraete, and J. A. Delcour. 2011. Prebiotic and other healthrelated effects of cereal-derived arabinoxylans, arabinoxylanoligosaccharides, and xylooligosaccharides. Crit. Rev. Food Sci. Nutr. 51:178–194. Chen, H., X. Mao, J. He, B. Yu, Z. Huang, J. Yu, P. Zheng, and D. Chen. 2013. Dietary fibre affects intestinal mucosal barrier function and regulates intestinal bacteria in weaning piglets. Br. J. Nutr. 110:1837–1848. Chen, K., H. Chen, M. M. Faas, B. J. Haan, J. Li, P. Xiao, H. Zhang, J. Diana, P. Vos, and J. Sun. 2017. Specific inulin-type fructan fibers protect against autoimmune diabetes by modulating gut immunity, barrier function, and microbiota homeostasis. Mol. Nutr. Food Res. 61:1601006. Claus, S. P. 2017. Inulin prebiotic: is it all about bifidobacteria? Gut. 66:1883–1884. Corrigan, A., M. de Leeuw, S. Penaud-Fr´ezet, D. Dimova, and R. A. Murphy. 2015. Phylogenetic and functional alterations in bacterial community compositions in broiler ceca as a result of mannan oligosaccharide supplementation. Appl. Environ. Microbiol. 81:3460–3470. Courtin, C. M., K. Swennen, W. F. Broekaert, Q. Swennen, J. Buyse, E. Decuypere, C. W. Michiels, B. D. Ketelaere, and J. A. Delcour. 2008. Effects of dietary inclusion of xylooligo- saccharides, arabinoxylooligosaccha- rides and soluble arabinoxylan on the microbial composition of caecal contents of chickens. J. Sci. Food Agric. 88:2517–2522. De Paepe, K., F. M. Kerckhof, J. Verspreet, C. M. Courtin, and T. Van de Wiele. 2017. Inter-individual differences determine the outcome of wheat bran colonization by the human gut microbiome. Environ. Microbiol. 19:3251–3267 Dewulf, E. M., P. D. Cani, S. P. Claus, S. Fuentes, P. G. Puylaert, A. M. Neyrinck, L. B. Bindels, W. M. de Vos, G. R. Gibson, J. P. Thissen, and N. M. Delzenne. 2013. Insight into the prebiotic concept: lessons from an exploratory, double blind intervention study with inulin-type fructans in obese women. Gut. 62:1112– 1121. Duncan, S. H., G. Holtrop, G. E. Lobley, A. G. Calder, C. S. Stewart, and H. J. Flint. 2004a. Contribution of acetate to butyrate formation by human faecal bacteria. Br. J. Nutr. 91:915– 923. Duncan, S. H., P. Louis, and H. J. Flint. 2004b. Lactate-utilizing bacteria, isolated from human feces, that produce butyrate as a major fermentation product. Appl. Environ. Microbiol. 70:5810– 5817. Edwards, C. A., and A. M. Parrett. 2002. Intestinal flora during the first months of life: new perspectives. Br. J. Nutr. 88:11–18. Edwards, C. A., and A. M. Parrett. 2003. Dietary fibre in infancy and childhood. Proc. Nutr. Soc. 62:17–23. Eeckhaut, V., F. Van Immerseel, F. Pasmans, E. De Brandt, F. Haesebrouck, R. Ducatelle, and P. Vandamme. 2010. Anaerostipes butyraticus sp. nov., an anaerobic, butyrate-producing bacterium from Clostridium cluster XIVa isolated from broiler chicken caecal content, and emended description of the genus Anaerostipes. Int. J. Syst. Evol. Microbiol. 60:1108–1112 Gibson, G. R., H. M. Probert, J. Van Loo, R. A. Rastall, and M. B. Roberfroid. 2004. Dietary modulation of the human colonic microbiota: updating the concept of prebiotics. Nutr. Res. Rev. 17:259–275. Gibson, G. R., R. Hutkins, M. E. Sanders, S. L. Prescott, R. A. Reimer, S. J. Salminen, K. Scott, C. Stanton, K. S. Swanson, P. D. Cani, and K. Verbeke. 2017. Expert consensus document: The international scientific association for probiotics and prebiotics (ISAPP) consensus statement on the definition and scope of prebiotics. Nat. Rev. Gastroenterol. Hepatol. 14:491–502.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey195/5005859 by University Library UUtrecht user on 29 May 2018

10

LI ET AL.

Hosseini, E., C. Grootaert, W. Verstraete, and T. Van de Wiele. 2011. Propionate as a health-promoting microbial metabolite in the human gut. Nutr. Rev. 69: 245–258. Jenab, M., and L. U. Thompson. 2000. Phytic acid in wheat bran affects colon morphology, cell differentiation and apoptosis. Carcinogenesis. 21:1547–1552. Jørgensen, H., X. Q. Zhao, K. E. B. Knudsen, and B. O. Eggum. 1996. The influence of dietary fibre source and level on the development of the gastrointestinal tract, digestibility and energy metabolism in broiler chickens. Br. J. Nutr. 75:379–395. Kl¨ aring, K., L. Hanske, N. Bui, C. Charrier, M. Blaut, D. Haller, C. M. Plugge, and T. Clavel. 2013. Intestinimonas butyriciproducens gen. nov., sp. nov., a butyrate-producing bacterium from the mouse intestine. Int. J. Syst. Evol. Microbiol. 63:4606– 4612. Louis, P., K. P. Scott, S. H. Duncan, and H. J. Flint. 2007. Understanding the effects of diet on bacterial metabolism in the large intestine. J. Appl. Microbiol. 102:1197–1208. Martin, A. P. 2002. Phylogenetic approaches for describing and comparing the diversity of microbial communities. Appl. Environ. Microbiol. 68:3673–3682 Mart´ınez, Y., Y. Carri´ on, R. Rodr´ıguez, M. Valdivi´e, C. Olmo, C. Betancur, G. Liu, N. A. Al-Dhabi, and V. Duraipandiyan. 2015. Growth performance, organ weights and some blood parameters of replacement laying pullets fed with increasing levels of wheat bran. Rev. Bras. Cienc. Avic. 17:347–354. Myers, W. D., P. A. Ludden, V. Nayigihugu, and B. W. Hess. 2004. Technical Note: A procedure for the preparation and quantitative analysis of samples for titanium dioxide. J. Anim. Sci. 82:179–183. Nabizadeh, A. 2012. The effect of inulin on broiler chicken intestinal microflora, gut morphology, and performance. J. Anim. Feed Sci. 21:725–734. Neyrinck, A. M., and N. M. Delzenne. 2010. Potential interest of gut microbial changes induced by non-digestible carbohydrates of wheat in the management of obesity and related disorders. Curr. Opin. Clin. Nutr. Metab. Care 13:722–728. Neyrinck, A. M., B. Pachikian, B. Taminiau, G. Daube, R. Fr´ed´erick, P. D. Cani, L. B., Bindels, and N. M. Delzenne. 2016. Intestinal sucrase as a novel target contributing to the regulation of glycemia by prebiotics. PLoS One 11:0160488. Neyrinck, A. M., V. F. Van H´ee, N. Piront, F. De Backer, O. Toussaint, P. D. Cani, and N. M. Delzenne. 2012. Wheat-derived arabinoxylan oligosaccharides with prebiotic effect increase satietogenic gut peptides and reduce metabolic endotoxemia in dietinduced obese mice. Nutr. Diabetes 2:e28–e28. Pourabedin, M., and X. Zhao. 2015. Prebiotics and gut microbiota in chickens. FEMS. Microbiol. Lett. 15:362 Ramirez-Farias, C., K. Slezak, Z. Fuller, A. Duncan, G. Holtrop, and P. Louis. 2008. Effect of inulin on the human gut microbiota: stimulation of Bifidobacterium adolescentis and Faecalibacterium prausnitzii. Br. J. Nutr. 101:541–550. Rebol´e, A., L. T. Ortiz, M. Rodr´ıguez, C. Alzueta, J. Trevi˜ no, and S. Velasco. 2010. Effects of inulin and enzyme complex, individually

or in combination, on growth performance, intestinal microflora, cecal fermentation characteristics, and jejunal histomorphology in broiler chickens fed a wheat- and barley-based diet. Poult. Sci. 89:276–286. Rehman, H., P. Hellweg, D. Taras, and J. Zentek. 2008. Effects of dietary inulin on the intestinal short chain fatty acids and microbial ecology in broiler chickens as revealed by denaturing gradient gel electrophoresis. Poult. Sci. 87:783–789. Rehman, H., C. Rosenkranz, J. B¨ ohm, and J. Zentek. 2007. Dietary inulin affects the morphology but not the sodium-dependent glucose and glutamine transport in the jejunum of broilers. Poult. Sci. 86:118–122. Scheppach, W. 1994. Effects of short chain fatty acids on gut morphology and function. Gut. 35:S35–S38. Schoefer, L., R. Mohan, A. Schwiertz, A. Braune, and M. Blaut. 2003. Anaerobic degradation of flavonoids by Clostridium orbiscindens. Appl. Environ. Microbiol. 69:5849–5854. Singh, K. M., T. Shah, S. Deshpande, S. J. Jakhesara, P. G. Koringa, D. N. Rank, and C. G. Joshi. 2012. High through put 16S rRNA gene-based pyrosequencing analysis of the fecal microbiota of high FCR and low FCR broiler growers. Mol. Biol. Rep. 39:10595– 10602. Sokol, H., B. Pigneur, L. Watterlot, O. Lakhdari, L. G. Berm´ udezHumar´ an, J. J. Gratadoux, S. Blugeon, C. Bridonneau, J. P. Furet, G. Corthier, and C. Grangette. 2008. Faecalibacterium prausnitzii is an anti-inflammatory commensal bacterium identified by gut microbiota analysis of Crohn disease patients. Proc. Natl. Acad. Sci. USA. 105:16731–16736. ´ atkiewicz, S., J. Koreleski, and A. Arczewska-Wlosek. 2011. EfSwi  fect of inulin and oligofructose on performance and bone characteristics of broiler chickens fed on diets with different concentrations of calcium and phosphorus. Br. Poult. Sci. 52:483–491. Thompson, C. L., B. Wang, and A. J. Holmes. 2008. The immediate environment during postnatal development has long-term impact on gut community structure in pigs. ISME J. 2:739– 748. Topping, D. L., and P. M. Clifton. 2001. Short-chain fatty acids and human colonic function: roles of resistant starch and nonstarch polysaccharides. Physiol. Rev. 81:1031–1064. Van den Abbeele, P., C. Belzer, M. Goossens, M. Kleerebezem, W. M. De Vos, O. Thas, R. De Weirdt, F. M. Kerckhof, and T. Van de Wiele. 2013. Butyrate-producing Clostridium cluster XIVa species specifically colonize mucins in an in vitro gut model. ISME J. 7:949–961. Wu, R. Y., M. Abdullah, P. M¨ aa¨tt¨ anen, A. V. C. Pilar, E. Scruten, K. C. Johnson-Henry, S. Napper, C. O’Brien, N. L. Jones, and P. M. Sherman. 2017. Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function. Sci. Rep. 7:40820. Xu, Z. R., C. H. Hu, M. S. Xia, X. A. Zhan, and M. Q. Wang. 2003. Effects of dietary fructooligosaccharide on digestive enzyme activities, intestinal microflora and morphology of male broilers. Poult. Sci. 82:1030–1036.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey195/5005859 by University Library UUtrecht user on 29 May 2018