The effect of jararhagin, a metalloproteinase from Bothrops jararaca venom, on pro-inflammatory cytokines released by murine peritoneal adherent cells

Toxicon 39 (2001) 1567±1573

www.elsevier.com/locate/toxicon

The effect of jararhagin, a metalloproteinase from Bothrops jararaca venom, on pro-in¯ammatory cytokines released by murine peritoneal adherent cells Patricia B. Clissa a,*, Gavin D. Laing b, R. David G. Theakston b, Ivan Mota a, Mark J. Taylor c, Ana M. Moura-da-Silva a a

LaboratoÂrio de Imunopatologia, Instituto Butantan, Av. Vital Brasil, 1500, Butantan. CEP: 05503-900, SaÄo Paulo, Brazil b Alistair Reid Venom Research Unit, Liverpool School of Tropical Medicine, Pembroke Place, Liverpool L3 5QA, UK c Cellular Immunology Laboratory, Liverpool School of Tropical Medicine, Pembroke Place, Liverpool L3 5QA, UK Received 9 February 2001; accepted 16 April 2001

Abstract The release of pro-in¯ammatory cytokines (IL-1b, IL-6 and TNF-a) from murine peritoneal adherent cells (MPAC) was studied after exposure to jararhagin, a metalloproteinase/disintegrin isolated from Bothrops jararaca venom. MPACs were treated with LPS (lipopolysaccharide), jararhagin, or EDTA-inactivated jararhagin for up to 24 h. Following incubation, the culture supernatant was assayed by ELISA for the presence of cytokines, while the cells were analysed for viability and cytokine mRNA expression. The cells exposed to native jararhagin released TNF-a and IL-1b after 4 and 24 h respectively. When MPACs were exposed to Jararhagin treated with EDTA, TNF-a and IL-1b production was sustained throughout the culture period and IL-6 production was observed. TNF-a, IL-6 and IL-1b mRNA were detected 4 h after stimulation with either native or EDTA-treated jararhagin. Addition of jararhagin to LPS stimulated cells resulted in a dramatic decrease in the release of IL-6 and TNF-a. RT±PCR showed that this inhibition does not occur at the transcriptional level and further experiments showed that jararhagin degraded soluble cytokines by proteolytic activity. This study suggests that jararhagin induces TNF-a, IL-1b and IL-6 expression, which may be rapidly degraded by its proteolytic activity. q 2001 Elsevier Science Ltd. All rights reserved. Keywords: In¯ammation; Cytokines; Metalloproteinase; Jararhagin; Snake venom

1. Introduction The mechanism for local tissue damage due to snake envenoming involves activation of cellular immune responses in which the cascade of events is usually initiated by tissue macrophages and blood monocytes (Voronov et al., 1999). The activated monocytes release a broad spectrum of mediators of which IL-1 and TNF-a are thought to play an important role (Cybulsky et al., 1988). Bothrops jararaca venom is composed of a complex mixture of metalloproteinases (haemorrhagic toxins), phospholipases A2 (myotoxins) and serine-proteinases * Corresponding author. Tel.: 155-11-3726-7222; fax: 155-113726-1505. E-mail address: [email protected] (P.B. Clissa).

(thrombin-like enzymes). Envenoming by B. jararaca is characterized mainly by systemic (renal failure, shock, generalized bleeding and coagulopathy) and local effects (haemorrhage, oedema and necrosis). The local necrotizing effect often results in the rapid development of a frequently severe local lesion (Rosenfeld, 1971), and treatment with speci®c antivenoms does not appear to be capable of neutralizing this venom-induced local in¯ammation. It has been demonstrated by our group that TNF-a antibodies reduced the size of venom-induced necrotic lesions, suggesting that endogenous mechanisms of the in¯ammatory response can be activated by viper venom metalloproteinases (Moura-daSilva et al., 1996). Jararhagin is a hemorrhagic metalloproteinase present in B. jararaca venom (Paine et al., 1992), which belongs to the snake venom metalloproteinase (SVMP) subfamily of

0041-0101/01/$ - see front matter q 2001 Elsevier Science Ltd. All rights reserved. PII: S 0041-010 1(01)00131-3

1568

P.B. Clissa et al. / Toxicon 39 (2001) 1567±1573

proteins (Bjarnason and Fox, 1994). Together with ADAM (A Disintegrin And Metalloproteinase), SVMPs belong to the reprolysin family (Fox and Long, 1998). ADAM proteins are expressed by a broad variety of cells; they are involved in different biological functions such as sperm-egg binding (Bigler et al., 1997; Cho et al., 1998), myoblast fusion (Yagami-Hiromasa et al., 1995), neurogenesis (Pan and Rubin, 1997) and ectodomain shedding in cell surface proteins (Peschon et al., 1998; Lunn et al., 1999). SVMPs and ADAMs share signi®cant structural similarities amongst themselves. Both subfamilies contain a pro-protein domain, which renders the protease domain inactive until the pro-domain is proteolytically removed, a zinc-dependent metalloproteinase domain and a disintegrin domain, which disrupts speci®c integrin functions (Killar et al., 1999). The most notable difference between the two subfamilies is that SVMPs do not possess a cytoplasmic and transmembrane domain, while the ADAMs possess a membrane-bound form. This feature can be an important tool to better understand the biologic role of some reprolysins. ADAM 17 or TACE (TNF-a converting enzyme) is a membrane-bound enzyme responsible for the processing of TNF-a, releasing its soluble active form from the membrane (Black and White, 1998; Black et al., 1997; Moss et al., 1997). The TACE enzymatic domain cleaves the membrane-bound pro-TNF-a between Ala76-Val77 (Milla et al., 1999). In a previous study we have shown that jararhagin is also able to process the recombinant proTNF-a from its precursor in the same position, releasing the active TNF-a (Moura-da-Silva et al., 1996). This study hypothesized that SVMPs could be activating endogenous pro-in¯ammatory mechanisms through TNF-a release, contributing to the severe local damage induced by Bothrops jararaca venom. The present study was carried out in an attempt to clarify this mechanism and also to investigate the role of soluble SVMPs in the production and release of pro-TNF-a in a whole cell system. 2. Materials and methods 2.1. Jararhagin Jararhagin was puri®ed as described by Paine et al. (1992). When appropriate, inactivation of its enzymatic activity was carried out by treatment with 1 mM ethylenediaminetetraacetic acid (EDTA) from Amresco. 2.2. Peritoneal cells and culture The production of peritoneal exudate cells from 18 to 22 g male BALB/c mice was elicited by intraperitoneal injection of 1 ml Brewer's thioglycollate medium (Difco Laboratories). Five days later, the cells were collected from the mouse peritoneal cavity in 5 ml of complete RPMI medium (Gibco) containing 2 IU/ml of Heparin (Roche). The pooled cells were then washed twice with

phosphate-buffered saline (PBS) and then resuspended in complete RPMI containing 5% heat-inactivated Foetal Calf Serum (FCS) (Bio-Whittaker). The cells were cultured in 96 well (2 £ 10 5 cells/well) or 24 well (1 £ 10 6 cells/well) cell culture plates, incubated at 378C in the presence of CO2 for 2 h. After incubation, they were washed three times with PBS, to remove non-adherent cells, and RPMI containing 5% FCS was added to each well. Approximately 95% of the remaining adherent cells were macrophages as determined by morphology. The adherent cells were stimulated with jararhagin, lipopolysaccharide from E. coli (LPS) (Sigma), jararhagin inactivated by 1mM EDTA, or co-stimulated with LPS together with native or EDTA-treated jararhagin. Treatments with PBS were used as control. After different incubation times, supernatants were collected for cytokines measurement and pellets tested for cell viability or mRNA production. Each experiment was done in triplicate. 2.3. Cytokine measurement Cytokine levels in the cell culture supernatants were measured by ELISA, according to the manufacturer's instructions (R&D Systems). The monoclonal and polyclonal antibodies against IL-1b, IL-6 and TNF-a were from R&D Systems. Cytokine concentrations were calculated by interpolation of the regression curve of known amounts of recombinant cytokines (rIL-6, rIL-1b and rTNF-a from R&D System) and reported as ng/ml. 2.4. Cell viability Viable cells were quanti®ed by the presence in live cells of mitochondrial succinyl dehydrogenase, by adding the enzyme substrate 3-(4,5-dimethylthiazol-2-yl) 2,5 diphenyl-tetrazolium bromide (MTT) (Sigma) to the adhered cells. After stimulation, culture supernatants were discarded and the cells remaining on the plate were incubated with 200 ml of MTT (5 mg/ml in PBS) for 90 min at 378C. The plates were then washed with PBS, and 200 ml/well of dimethyl sulfoxide (Sigma) were added. One hour later, the optical density was determined at 490 nm. The absorbancy obtained using non-treated cells was used as 100% viability. 2.5. RNA extraction Total RNA was extracted from adherent cells by the TriReagent TM (Sigma) method following the manufacturer's instructions. The RNA extraction was carried out in an RNAse-free environment. RNA was quanti®ed by reading the absorbancy at 260 nm according to the methods described by Sambrook et al. (1989). 2.6. RT±PCR The reverse transcription of 1 mg RNA was carried out using AMV reverse transcriptase (7.5 U), oligo (dT)15

P.B. Clissa et al. / Toxicon 39 (2001) 1567±1573

1569

Table 1 Sequence of primers used in the experiments of RT±PCR according to Seguin et al. (1994) and Wesseling et al. (1994) Primer

Forward (3 0 )

Backward (5 0 )

Product size (bp)

IL-1b Il-6 TNF-a b-Actin

GAGATTGAGCTGTCTGCTCA GTACTCCAGAAGACCAGAGG TTGACCTCAGCGCTGAGTTG CGTGGGCCGCCCTAGGCACCAGGG

AAGGAGAACCAAGCAACGAC TGCTGGTGACAACCACGGCC CCTGTAGCCCACGTCGTAGC CGGAGGAAGAGGATGCGGCAGTGG

401 282 366 604

primer (2.5 mg/ml), dNTP (0.5 mM), MgCl2 (2.5 mM) and 0.5 U RNAse inhibitor (Reverse Transcription System from Promega). After incubation at 428C for 30 min, AMV reverse transcriptase was inactivated by heating at 908C for 10 min. For the polymerase chain reaction (PCR), the cDNA obtained was incubated with 1.25 IU AmpliTaq Gold DNA polymerase (Perkin Elmer), 50 mM 3 0 and 5 0 primers and 200 mM dNTP in 200 mM Tris-HCl buffer, pH 8.4, containing 500 mM KCl and 1±4 mM MgCl2 (depending on the primer used). The PCRs were run at 948C for 9 min (hot start), followed by 35 cycles of 948C for 1 min (denaturing), 588C for 1 min (annealing temperature) and 728C for 1.5 min (extension). PCR products were detected on 2% agarose electrophoresis using as nucleotide size markers the 100 bp Ladder (Promega). The primers used for the IL-1b, IL-6, TNF-a (Wesseling et al., 1994) and b-Actin (Seguin et al., 1994) and the product size are shown in Table 1.

IL-6 production by MPACs and subsequently degrade the cytokines produced by proteolytic cleavage. We further investigated proteolytic cleavage of soluble cytokines by jararhagin, incubating soluble recombinant

3. Results 3.1. Effects of Jararhagin on pro-in¯ammatory cytokines produced by MPAC Exposure of cells to native jararhagin (50 mg/ml) resulted in the release of TNF-a and IL-1b after 4 and 24 h respectively (Fig. 1(A) and (C)). Levels of IL-6 were not detectable after stimulus with native jararhagin (Fig. 1(B)). Stimulation of MPACs with EDTA-treated jararhagin, at the same concentration, resulted in a sustained production of TNF-a 4±12 h and IL-1b 12±24 h after the stimulus, and the release of IL-6 at all time intervals tested (Fig. 1). The production of LPS-induced pro-in¯ammatory cytokines IL1b, IL-6 and TNF-a over time was also evaluated using MPACs stimulated with 1 mg/mL LPS plus 50 mg/ml jararhagin. Levels of LPS-induced TNF-a and IL-6 were drastically decreased by co-incubation with native jararhagin, reaching approximately the basal levels of production by MPACs immediately after stimulus (Fig. 2(A) and (B)). Interestingly, LPS-induced IL-1b was relatively unaffected by jararhagin (Fig. 2(C)). After co-stimulation with LPS and EDTA-treated jararhagin, levels of TNF-a, IL-1b and IL-6 differed only slightly with those recorded for stimulus only with LPS (Fig. 2). Taken together, these results suggested that jararhagin could initially stimulate TNF-a, IL-1b and

Fig. 1. Production of TNF-a, IL-6 and IL-1b by MPACs stimulated with native or EDTA-treated Jararhagin: TNF-a (A), IL-6 (B) and IL-1b (C) were assayed by ELISA in supernatants of MPACs stimulated with 50 mg/ml native jararhagin (JAR) or jararhagin inactivated with 1 mM EDTA (JAR/EDTA), collected at time periods of 4 (B), 12 (A) or 24 (p) h after stimulus. The results are expressed as mean ^ SD of triplicates.

1570

P.B. Clissa et al. / Toxicon 39 (2001) 1567±1573

Fig. 3. Effect of Jararhagin on soluble recombinant cytokines in vitro: Recombinant IL-6 (W), IL-1b (X) and TNF-a (O) (2 ng/ml) were incubated with PBS or 50mg/ml of jararhagin for 2, 6, 12 and 24 h, and the ®nal reaction assayed for the respective cytokine by ELISA. The value of 100% was taken at each incubation time using PBS as control.

Fig. 2. Effects of Jararhagin on the production of LPS induced cytokines by MPACs: TNF-a (A), IL-6 (B) and IL-1b (C) were assayed by ELISA in supernatants of MPACs stimulated with 1 mg/ml LPS (LPS) alone or together with 50 mg/ml native jararhagin (LPS 1 JAR) or jararhagin inactivated with 1 mM EDTA (LPS 1 JAR/ EDTA), collected at time periods of 4 (B), 12 (A) or 24 (p) h after stimulus. The results are expressed as mean ^ SD of triplicates.

TNF-a, IL-1b and IL-6 in vitro with 50 mg/ml jararhagin for up to 24 h and analyzing the remaining cytokines in the reaction using ELISA. The results observed (Fig. 3) were consistent with the data presented above: IL-6 and TNF-a, were rapidly degraded with only minimal activity on IL-1b. 3.2. Induction of cytokine mRNAs by jararhagin The effect of jararhagin in inducing the transcription for mRNAs coding for pro-in¯ammatory cytokines was evaluated by RT±PCR after stimulus with native and EDTAtreated toxin or after co-stimulus with LPS. As can be seen in Fig. 4, 4 h after stimulus with either native or

EDTA-treated jararhagin, IL-6, TNF-a and IL-1b mRNA, were detected. Although this test was not quantitative, the intensity of the bands resulting from both treatments was comparable. In order to eliminate the possibility that downregulation of LPS-induced cytokines by co-stimulation with jararhagin was due to inhibition of synthesis, RT±PCRs were also run after stimulus with LPS or LPS plus native or EDTA-treated jararhagin. The production of TNF-a, IL1b and IL-6 mRNAs was detected 4, 12 and 24 h after stimulus. The intensity of TNF-a, IL-1b and IL-6 mRNA bands induced by stimulation with LPS was not altered by co-stimulation with either untreated jararhagin or enzymeinactivated toxin, showing that down-regulation of LPSinduced cytokines by native jararhagin was not related to inhibition of the ®rst steps of MPAC activation, leading to mRNA synthesis (Fig. 4).

4. Discussion The results presented in this paper show that jararhagin stimulates MPACs to produce pro-in¯ammatory cytokines as observed by the transcription of TNF-a, IL-1b and IL-6 mRNAs 4 h after stimulus. The production of mRNA correlated with the production of the same cytokines in MPAC supernatants treated with EDTA-jararhagin. Although the levels of cytokines induced by native and EDTA-treated jararhagin cannot be compared because of degradation of soluble cytokines by the proteolytic activity of jararhagin, mRNA bands were equally observed in both stimuli. This suggested that stimulation of MPACs is independent of proteolysis. Jararhagin contains the essential elements required for cleavage of pro-TNF-a in a cell-free system (Moura-da-Silva et al., 1996). Processing of membranebound pro-TNF-a would result in the active cytokine,

P.B. Clissa et al. / Toxicon 39 (2001) 1567±1573

1571

Fig. 4. Transcription of cytokines mRNA by MPACs stimulated with Jararhagin: The production of mRNA coding for TNF-a, IL-6 and IL-1b was evaluated on MPAC treated with 50 mg/ml jararhagin (JAR); 1 mg/ml LPS (LPS); 50 mg/ml jararhagin inactivated with 1 mM EDTA (JAR/EDTA), or co-stimulated with the same doses of LPS and native jararhagin (JAR 1 LPS) or LPS and jararhagin inactivated by EDTA (LPS 1 JAR/EDTA). The cells were collected at 4, 12 and 24 h after the treatment. The RT±PCRs were run as described in material and methods using the cytokines primers IL-1b, IL-6, and TNF-a incubated together with the b-actin primers, which were used as control of mRNA production.

which up-regulates its own synthesis and also the synthesis of IL-1b and IL-6. However, this mechanism is not apparently involved in our experimental model since it depends on conserved catalytic activity of jararhagin and because jararhagin proteolysis may further degrade the liberated TNF-a, interrupting the subsequent up-regulation of cytokine production. In addition, EDTA-treated jararhagin is devoid of TACE-like activity and also induced cytokine liberation. Moreover, it is unlikely that native jararhagin possesses a TACE-like activity in vivo. Jararhagin is a soluble molecule compared to the transmembrane TACE. In order to process pro-TNF-a, TACE must be anchored to the membrane of the same cell expressing the pro-TNF-a (Reddy et al., 2000). Raised levels of pro-in¯ammatory cytokines have been detected in the serum of human victims or in experimental models following Bothrops envenoming (Lomonte et al., 1993; Barravieira et al., 1995; Petricevich et al., 2000). However the mechanism by which this occurs is not clear, since there is no data from these studies concerning levels of cytokines at the site of venom introduction. It is known that the haemorrhagic toxins present in the venoms act directly on the capillary basement membrane and the endothelial cells to cause internal haemorrhage and oedema (Hati et al., 1999). This damage can activate cellular effects to release endogenous mediators of in¯ammation, such as cytokines. In parallel, our data show a direct effect of jararhagin in MPACs. The mechanism by which jararhagin is stimulating in¯ammatory cells is being studied by our group. We have shown that jararhagin induces in¯ux of neutrophils subcutaneously by directly binding to macrophages (Costa et al., 2000). The target of the binding of jararhagin to macrophages has not yet been characterised. However, jararhagin has a selective disintegrin activity towards a2b1 integrin present on transfected and endothelial cells (Moura-da-Silva et al., 2001). It was recently reported that binding of a2b1 to matrix collagen plays an important

role in neutrophil migration being expressed soon after extravasation of these cells from blood vessels (Fougerolles et al., 2000; Werr et al., 2000). Similarly, a2b1 integrin could be present at the surface of peritoneal macrophages presenting a target for jararhagin in MPAC activation. The interaction of jararhagin with endothelial cells a2b1 integrin is independent of proteolytic activity (Moura-da-Silva et al., 2001); this is consistent with our data. An interesting observation recorded here is the degradation of soluble cytokines by native jararhagin. The shedding of TACE from the cell surface releasing a soluble ADAM appears to be a regulation mechanism responsible for controlling TNF-a activity (Schlondorff et al., 2000). Jararhagin, as its soluble counterpart, is involved in the degradation of TNF-a and other cytokines. It is not yet clear whether soluble TACE is also able to degrade free mature TNF-a, but it can be suggested that its shedding from the cell surface could act as a down-regulatory mechanism either by reducing processing of pro-TNF-a or by degrading already synthesised cytokines. Kuo and his group (1991), studying Crotalus atrox venom, detected a degradation effect of this venom on IFN-g and IL-2 cytokines. This venom contains several haemorrhagic toxins known as atrolysins (Bjarnason and Fox, 1994) which may be responsible for this effect. Interestingly, degradation of IFN-g was not observed after treatment with jararhagin (data not shown). The higher susceptibility of TNF-a and IL-6 to the catalytic effect of jararhagin is still unclear. Structural properties of the cytokines may be a major factor contributing to this degradation. The data observed was correlated with the presence of disulphide bonds. TNF-a and IL-6, which possess one and two disulphide bonds respectively (Callard and Gearing, 1994), were more susceptible to proteolytic degradation than IL-1b that does not possess disulphide bonds. Disulphide bonds could be generating structural features exposing the hydrophobic residues at the surface

1572

P.B. Clissa et al. / Toxicon 39 (2001) 1567±1573

of the molecules, which are necessary for the proteolytic activity of jararhagin. This study therefore supports the hypothesis that jararhagin can act as a pro-in¯ammatory stimulus, by inducing the production of cytokines by in¯ammatory cells. However, degradation of the cytokines by proteolytic cleavage could be a mechanism by which the action of the cytokines is down regulated within the locality of venom-induced injury. Acknowledgements The authors wish to thank Dr. Sabri Saeed Al-Sanabani for the critical reading of the article, Katja Bilo for the technical assistance, FAPESP, CNPq and Wellcome Trust for the ®nancial support. References Barravieira, B., Lomonte, B., Tarkowski, A., Hanson, L.A., Maira, D.A., 1995. Acute-phase reactions, including cytokines, in patients bitten by Bothrops and Crotalus snakes in Brazil. J. Venom Anim. Toxins 1, 11±22. Bigler, D., Chen, M., Waters, S., White, J.M., 1997. A model for sperm-egg binding and fusion based on ADAMs and integrins. Trends Cell Biol. 7, 220±225. Bjarnason, J.B., Fox, J.W., 1994. Haemorrhagic metalloproteinase from snake venom. Pharmac. Ther. 62, 325±372. Black, R.A., Rauch, T.C., Kozlosky, C.J., Peschon, J.J., Slack, J.L., Wolfson, M.F., Castner, B.J., Stocking, K.L., Reddy, P., Srinivasan, S., Nelson, N., Boiani, N., Schooley, K.A., Gerhart, M., Davis, R., Fitzner, J.N., Johnson, R.S., Paxton, R.J., March, C.J., Cerretti, D.P., 1997. A metalloproteinase disintegrin that releases tumornecrosis factor-a from cells. Nature 385, 729±732. Black, R.A., White, J.M., 1998. ADAMs: Focus on the protease domain. Curr. Opin. Cell Biol. 10, 654±659. Callard, R.E., Gearing, A.J.H., 1994. The Cytokine Facts Book. Academic Press, 31. Cho, C., O'Dell, B.D., Faure, J.E., Goulding, E.H., Eddy, E.M., Primakoff, P., Myles, D.G., 1998. Fertilisation defects in sperm from mice lacking Fertilin-b. Science 281, 1857±1859. Costa, E.C., Teixeira, C.F.P., Toffoli, M.C., Zamuner, S.R., Mourada-Silva, A.M., 2000. In¯ammatory response induced by jararhagin in mouse subcutaneous tissue. Toxicon 38, 587. Cybulsky, M.I., Chan, M.K.W., Movat, H.Z., 1988. Acute in¯ammation and microthrombosis induced by endotoxin, interleukin1, tumor necrosis factor and the implications in gram-negative infection. Lab. Invest. 58, 365±371. Fougerolles, A.R., Sprague, A.G., Nickerson-Nutter, C.L., 2000. Regulation of in¯ammation by collagen-binding integrins a1b1 and a2b1 in models of hypersensitivity and arthritis. J. Clin. Invest. 105, 721±729. Fox, J.W., Long, C., 1998. The ADAMs/MDC family of proteins and their relationships to the snake venom metalloproteinases. In: Bailey, G.S. (Ed.). Enzymes From Snake Venom. Fort Colli, C.O., Alaken, 1998, pp. 151±178. Hati, R., Mitra, P., Sarker, S., Bhattacharyya, K.K., 1999. Snake venom hemorrhagins. Crit. Rev. Toxin 29, 1±19. Killar, L., White, J., Black, R., Peschon, J., 1999. Adamalysins: A

family of metzincins including TNF-a converting enzyme (TACE). Annals New York Acad. Sci. 878, 442±452. Kuo, W.N., Ganesan, U., Robinson, A., Flanders, J.R., Fausti, M.E., Jean, M.N., Gurnee, M.L., Kuo, J., 1991. Proteolysis of interleukin-2, interferon and immunoglobulin by venoms. Cytobios 67, 45±151. Lomonte, B., Tarkowski, A., Hanson, L.A., 1993. Host response to Bothrops asper snake venom. Analysis of edema formation, in¯ammatory cells and cytokine release in a mouse model. In¯ammation 17, 93±105. Lunn, L., Wong, B.R., Josien, R., Becherer, J.D., Erdjument-Bromage, H., SchloÈndorff, J., Tempst, P., Choi, Y., Blobel, C.P., 1999. Evidence for a role of a tumor necrosis Factor-a (TNFa)-converting enzyme-like protease in shedding of TRANCE, a TNF family member involved in osteoclastogenesis and dendritic cell survival. J. Biol. Chem. 19, 13613±13618. Milla, M.E., Leesnitzer, M.A., Moss, M.L., Clay, W.C., Carter, H.L., Miller, A.B., Su, J.L., Lambert, M.H., Willard, D., Sheeley, D.M., Kost, T.A., Burkhart, W., Moyer, M., Blackburn, R.K., Pahel, G.L., Mitchell, J., Hoffman, C.R., Becherer, J.D., 1999. Speci®c sequence elements are required for the expression of functional tumor necrosis factor-a-converting enzyme (TACE). J. Bio. Chem. 274, 30563±30570. Moss, M.L., Jin, S.L.C., Milla, M.E., Burkhart, W., Carter, H.L., Chen, W.J., Clay, W.C., Didsbury, J.R., Hassler, D., Hoffman, C.R., Kost, T.A., Lambert, M.H., Leesnitzer, M.A., McCauley, P., McGeehan, G., Mitchell, J., Moyer, M., Pahel, G., Rocque, W., Overton, L.K., Schoenen, F., Seaton, T., Su, J.L., Warner, J., Willard, D., Becherer, J.D., 1997. Cloning of a disintegrin metalloproteinase that processes precursor tumor-necrosis factor-a. Nature 385, 733±736. Moura-da-Silva, A.M., Laing, G.D., Paine, M.J.I., Politi, V., Crampton, J.M., Theakston, R.D.G., 1996. Processing of protumour necrosis factor-( by venom metalloproteinases: a hypothesis explaining local tissue damage following snake bite. Eur. J. Immunol. 26, 2000±2005. Moura-da-Silva, A.M., Marcinkiewicz, C., Marcinkiewicz, M., Niewiarowski, S., 2001. Selective recognition of a2b1 integrin by jararhagin, a metalloproteinase/disintegrin from Bothrops jararaca venom. Thromb. Res. 102, 153±159. Paine, M.J.I., Desmond, H.P., Theakston, R.D.G., Crampton, J.M., 1992. Puri®cation, cloning and molecular characterisation of a high molecular weight haemorrhagic metalloproteinase, Jararhagin, from Bothrops jararaca venom. J. Biol. Chem. 267, 22869±22876. Pan, D., Rubin, G.M., 1997. Kuzbanian controls proteolytic processing of notch and mediated lateral inhibition during Drosophila and Vertebrate neurogenesis. Cell 90, 271±280. Peschon, J.J., Slack, J.L., Reddy, P., Stocking, K.L., Sunnarborg, S.W., Lee, D.C., Russell, W.E., Castner, B.J., Johnson, R.S., Fitzner, J.N., Boyce, R.W., Nelson, N., Kozlosky, C.J., Wolfson, M.F., Rauch, C.T., Cerretti, D.P., Paxton, R.J., March, C.J., Black, R.A., 1998. An essential role for ectodomain shedding in mammalian development. Science 282, 1281± 1284. Petricevich, V.L., Teixeira, C.F.T., Tambourgi, D.V., GutieÂrrez, J.M., 2000. Increments in serum cytokine and nitric oxide levels in mice injected with Bothrops asper and Bothrops jararaca snake venoms. Toxicon 38, 1253±1266. Reddy, P., Slack, J.L., Davis, R., Cerreti, D.P., Kozlosky, C.J., Blanton, R.A., Shows, D., Peschon, J.J., Black, R.A., 2000.

P.B. Clissa et al. / Toxicon 39 (2001) 1567±1573 Functional analysis of the domain structure of tumor necrosis factor-a converting enzyme. J. Biol. Chem. 275, 14608±14614. Rosenfeld, G., 1971. Symptomatology, pathology and treatment of snake bites in South America. In: Bucherl, W., Buckley, E.E. (Eds.). Venomous Animals and their Venoms, Vol. 2. Academic Press, New York, pp. 345±362. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory Press, United States of America, p. 7.8. Schlondorff, J., Becherer, J.D., Blobel, C.P., 2000. Intracellular maturation and localization of the tumor necrosis factor alpha convertase (TACE). Biochem. J. 347 (1), 131±138. Seguin, M.C., Klotz, F.W., Scheider, I., Weir, J.P., Goodbary, M., Slayter, M., Raney, J.J., Aniagolu, J.U., Green, S.J., 1994. Induction of nitric oxide synthase protects against malaria in mice exposed to irradiated Plasmodium berghei infected

1573

mosquitoes: Involvement of Interferon gamma and CD8 1 T cells. J. Exp. Med. 180, 353±358. Voronov, E., Apte, R.N., Sofer, S., 1999. The systemic in¯ammatory response syndrome related to the release of cytokines following severe envenomation. J. Venom. Anim. Toxins 5, 5±33. Werr, J., Johansson, J., Eriksson, E.E., Hedqvist, P., Ruoslahti, E., Lindbom, L., 2000. Integrin a2b1 (VLA-2) is a principal receptor used by neutrophils for locomotion in extravascular tissue. Blood 95, 1804±1810. Wesseling, S.I., Levine, B., Fox, R.J., Choi, S., Grif®n, D.E., 1994. Intracranial cytokine mRNA expression during fatal and nonfatal alphavirus encephalitis suggests a predominant type 2 cell response. J. Immunol. 152, 1289±1297. Yagami-Hiromasa, T., Sato, T., Kurisaki, T., Kamijo, K., Nabeshima, Y., Fujisawa-Sehara, A., 1995. A metalloproteinase-disintegrin participating in myoblast fusion. Nature 377, 652±656.