- Email: [email protected]
The effect of MSMEG_6402 gene disruption on the cell wall structure of Mycobacterium smegmatis
Microbial Pathogenesis 51 (2011) 156e160
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
The effect of MSMEG_6402 gene disruption on the cell wall structure of Mycobacterium smegmatis Tao Jiang a, Lianqi He b, Yaoyao Zhan c, Shizhu Zang a, Yufang Ma b, Xiaojiao Zhao b, Cuili Zhang a, Yi Xin a, * a
Department of Biotechnology, Dalian Medical University, Dalian 116044, China Department of Biochemistry and Molecular Biology, Dalian Medical University, Dalian 116044, China c Department of Biochemistry and Molecular Biology, Dalian Ocean University, Dalian 116023, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 15 September 2010 Received in revised form 11 April 2011 Accepted 20 April 2011 Available online 6 May 2011
Arabinogalactan (AG) of mycobacterial cell wall consists of arabinan region, galactan region and disaccharide linker. The arabinan is composed of D-arabinofuranose residues, and decaprenyphosphoryl-D-arabinose (DPA) is the donor of the D-arabinofuranose residues. DPA is formed from phosphoribose diphosphate (PRPP) in a four-step process catalyzed by transferase, phosphatase and epimerase, respectively. Mycobacterium tuberculosis Rv3806c has been identified as PRPP: decaprenylphosphate 5-phosphoribosyltransferase，and heteromeric Rv3790/Rv3791 has epimerase activity. Rv3807c is putative phospholipid phosphatase. However, there is no direct biochemical evidence since expression of Rv3807c has been unsuccessful. Mycobacterium smegmatis MSMEG_6402 is ortholog of Rv3807c. To investigate the function of MSMEG_6402 on AG biosynthesis, a conditional MSMEG_6402 gene knock out (M. sm-DM_6402) strain was constructed through homologous recombination technique. The morphological and compositional changes of cell wall were examined in the M. sm-DM_6402 strain. The M. sm-DM_6402 strain grew at non-permissive temperature slower than that at permissive temperature, indicating that MSMEG_6402 is non-essential for growth of M. smegmatis. The change of cell shape and detectable bulging on the cell surface of M. sm-DM_6402 strain were observed by scanning electron microscopy, and curled as well as deformed cell wall of M. sm-DM_6402 strain was revealed by transmission electron microscopy. Analysis of sugar composition in the cell wall by HPLC indicated that the ratio of arabinofuran to galactofuran in M. sm-DM_6402 strain was changed to 1.7:1 comparing with 2:1 in the wild type. It demonstrates that the lacking MSMEG_6402 interferes the biosynthesis of arabinan. Analyzing 50 P-DPR and DPR from both M. sm-DM_6402 strain and wild type M. smegmatis is undergoing in this lab. Ó 2011 Elsevier Ltd. All rights reserved.
Keywords: Mycobacterium smegmatis mc2155 MSMEG_6402 Cell wall structure Decaprenyphosphoryl-D-arabinose (DPA)
1. Introduction The cell wall of mycobacteria is essential for its viability. The core structures include a highly impermeable mycolic acid layer, a peptidoglycan layer, and an arabinogalactan (AG) polysaccharide layer [1]. AG polymers are composed of d-arabinofuran residues (Araf) and d-galactofuran residues (Galf), and the highly branched Araf chains are directly attached to the Galf backbone. Some investigations showed that decaprenyphosphoryl-D-arabinose (DPA) is the only Araf donor for AG biosynthesis [2,3]. DPA biosynthesis is involved in the AG synthetic pathway [2,4,5]. Decapreny phosphate (DP) is primarily transferred to phosphoribose diphosphate (PRPP) to form decaprenyphosphoryl-5* Corresponding author. Tel.: þ86 411 86110295. E-mail addresses: [email protected], [email protected] (Y. Xin). 0882-4010/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.micpath.2011.04.005
phosphoribose (DPPR) [6]. The 50 phosphate is removed to produce decaprenylphos-phoryl-ribose (DPR), which is further epimerized into DPA [7]. It is postulated that the removal of the 50 phosphate on the second step is conducted by putative Rv3807c phospholipid phosphatase [8]. In this study, the function of Rv3807c gene was investigated by gene mutation combined with phenotypical studies since the enzyme assay could not be conducted due to inavailability of DPPR substrate. Mycobacterial smegmatis mc2155, a fast-growing and nonpathogenic mycobacterium, was employed to study the function of Rv3807c gene in this investigation. Bioinformatics analysis demonstrated that ortholog of Rv3807c in Mycobacterium tuberculosis is MSMEG_6402 in M. smegmatis mc2155, and MSMEG_6402 showed 62% identity to Rv3807c. Gene knock out approach has been successfully used to determine functions of mycobacterial genes in many related studies [9e11], therefore a mutant strain of
T. Jiang et al. / Microbial Pathogenesis 51 (2011) 156e160
157
2.2. Growth curve of M. sm-DM_6402 strain
Fig. 1. PCR identification resulting for Sm-DM_6402 mutant selection. M, 250bp DNA ladder; WT, PCR product of genomic DNA from mc2155; Lane 1e6, six S1 mutant strains transformed by pXY2 plasmid; Lane 3e5, three M. sm-DM_6402 mutant strains with significant gene deletion showed 2.2 Kb DNA fragment due to kanR insertion.
M. smegmatis mc2155, M. sm-DM_6402 with MSMEG_6402 gene disruption was generated in this study. The altered physiological, morphological, and chemical compositional characteristics were examined to address the possible role of MSMEG_6402 in the biosynthesis of AG. 2. Results 2.1. Construction of M. sm-DM_6402 strain M. sm-DM_6402 strain (MSMEG_6402 gene knock out strain) where MSMEG_6402 was replaced by MSMEG_6402::kanR was generated by a two-step homologous recombination procedure [10]. The M. smegmatis mc2155 transformant carrying conditional replication plasmid pXYI was grown in LB broth containing kanamycin and gentamycin at 30 C, and spread on LB agar plate containing kanamycin and gentamycin at 42 C. The kanamycin resistant colonies on the plate have necessarily integrated MSMEG_6402::kanR into mc2155 genome at 42 C. Two S1 mutant strains where MSMEG_6402::kanR integrated into MSMEG_6402 locus were selected by PCR. One S1 mutant strain was transformed by rescue plasmid pXYII and the transformants were grown at LB agar plate containing sucrose, kanamycin and streptomycin and incubated at 30 C. M. sm-DM_6402 mutants where MSMEG_6402 was replaced by MSMEG_6402::kanR were selected by PCR. The 2.2 kb-PCR product including MSMEG_6402::kanR was amplified from three colonies, whereas the1.0 kb-PCR product containing only MSMEG_6402 was amplified from mc2155 (Fig. 1).The result indicated that MSMEG_6402 gene knock out mutant, M. sm-DM_6402 was constructed successfully.
To investigate the effect of MSMEG_6402 on the growth of M. smegmatis, the OD600 (the optical density at the absorption of 600 nm)of M. sm-DM_6402 strain at either 30 C or 42 C was measured at the interval of 24 h. Wild type M. smegmatis mc2155 was a control. The growth curve of M. sm-DM_6402 mutant showed that M. sm-DM_6402 could grow at 42 C but the growth rate at 42 C was slower than that at 30 C (Fig. 2). Since the rescue plasmid pXYII was unable to replicate at 42 C no more Rv3807c protein was produced to complement MSMEG_6402::kanR. Therefore, the results indicated that MSMEG_6402 is non-essential for the growth of M. smegmatis, but the disruption of MSMEG_6402 caused the reduced growth rate of M. smegmatis mc2155. 2.3. Morphological changes of M. sm-DM_6402 strain Based on the hypothesis that M_6402 gene was involved in DPA biosynthesis, defected cell wall might be detected after the gene was deleted. The changes of cell wall could be exhibited both on cell appearance and cell wall structure. The changes on cell appearance were detected through SEM on M. sm-DM_6402 strain. Deformation and bulge on the side of mutant cells were observed, and some cells were cracked around the bulges after the gene was defected at a non-permissive temperature. As a contrast, M. smegmatis cells showed regular long rod-shape (Fig. 3A). The cell wall structure of M. sm-DM_6402 strain was further examined by TEM. Cytoplasm of mutant appeared to be detached from the cell wall and possessed a discrepancy density compared to wild cells. Cell wall structure tended to be curled, and even tend to cause cellular autolysis. As a contrast, wild M. smegmatis cells wall showed regular patterns, instead the cells treated by EMB were damaged heavily (Fig. 3B). 2.4. Sugar composition changes of AG from mutant strain cell wall In previous reports, the ratio of Araf to Galf for wild type mycobacterial AG was 2:1, and Enthambuto (EMB) inhibited arabinosyl transferase reduced the ratio to 1:1 after 2 h EMB treatment. In this study, the ratios of Araf to Galf were respectively 2.1,1.7 and 1.1 for wild type mc2155, M. sm-DM_6402 strain and mc2155 cell treated by EMB (as shown in Fig. 4B). Content of Araf was reduced significantly for M. sm-DM_6402 strain. A similar ratio was measured from EMB-treatment cells as a positive control in this study. Purified AG from M. sm-DM_6402 mutant was analyzed for Araf content by HPLC. The ratio of Araf to Galf was reduced to 1.7:1 indicating inhibition of Araf chain biosynthesis possibly caused by M. sm-DM_6402 strain although the inhibition was not as strong as that by EMB (Fig. 4). 3. Discussion
Fig. 2. Growth curves of M. smegmatis mc2155 strain at 30 C and 42 C. Wild type mc2155 strain at 42 C（:）; Mc2155 containing pCG76-Tb Rv3807c at 42 C(C); Wild type mc2155 at 30 C(C); mc2155 containing pCG76-Tb Rv3807c at 30 C (,); M. sm-DM_6402 strain at 30 C( ,); M. sm-DM_6402 strain at 42 C(A).
DPA biosynthesis had gradually been elucidated as the functions of Rv3806c, Rv3790 and Rv3791 were reported in the past several years [6,7,12]. The formation of DPA is catalyzed presumably by three enzymes, Rv3806c phosphoribosyltransferase, phospholipids phosphatase and Rv3790/Rv3791 epimerase respectively, but the phospholipid phosphatase has yet not been identified in mycobacteria. Rv3807c, an unknown function protein, was predicted through bioinformatics analysis of protein domain to catalysis the dephosphorylation reaction [8]. However, we yet have little known about functional characteristic of Rv3807c. In this study, we constructed M. sm-DM_6402 mutant, a gene similar to Rv3807c in M. tuberculosis, and further determined the relationship between MSMEG_6402 and DPA biosynthesis.
158
T. Jiang et al. / Microbial Pathogenesis 51 (2011) 156e160
Fig. 3. Effects of M. sm-DM_6402 mutant on the appearance of M. smegmatis mc2155. (A) SEM analysis of M. sm-DM_6402 cell grown at 30 C (panel 1) and 42 C (panel 2) for logarithmic phase in LB broth, Bars ¼ 1 mm, (B) TEM analysis of cells grown of M. sm-DM_6402 strains and wild type mc2155 strains. Wild type mc2155 cells (panel 1), M. smDM_6402 cells (panels 2e3) were grown at 42 C for logarithmic phase, arrowheads indicate cell wall structure ruptured, M. smegmatis mc2155 treated by EMB (panel 4).
The changes on cell appearance and cell wall structure were detected after MSMEG_6402 was mutated, and utd and biosynthesis of arabinose for AG was found to be reduced. These results were important toward to finally determine the gene function of Rv3807c in M. tuberculosis. Under physiological conditions, cell wall of mycobacterium was thought to manifest rigid rod-shapes [13], and alterations of cell morphology were resulted largely from nutrient default, polar differentiation and cell wall biosynthesis disorder [14,15]. DPA is the only Araf donor in mycobacterium for AG biosynthesis, therefore DPA decrease can reduce directly AG biosynthesis, even destroy cell wall. EMB, an anti-tuberculosis drug, effects cell wall structure due to the inhibition of DPA biosynthesis [16]. Therefore, the mutation of MSMEG_6402 was likely to interfere with cell wall biosynthesis, especially to reduce biosynthesis of Araf for AG. It is postulated that MSMEG_6402 is directly or indirectly involved in DPA biosynthesis. AG composition analysis indicates that M. sm-DM_6402 strain contains a significantly low quantity of Araf residues. The fact that Araf was reduced but not totally absent demonstrated that role of MSMEG_6402 protein maybe is not the only way for DPA synthesis. Furthermore, there might be a complement system, and the further study is needed for revealing full metabolism pathways. In short, MSMEG_6402 gene deletion may affect the integrity of mycobacterial cell wall, reduce content of Araf residues for AG, and change growth characteristic. However, we were still struggling on
enzymatic evidence catalyzed by MSMEG_6402; further works are determination of its precise role. 4. Materials and methods 4.1. Bacterial strains and growth conditions M. smegmatis mc2155 strain (ATCC) was grown in LB broth containing 0.05% Tween 80 at designated temperatures either at 30 C or 42 C. Antibiotics and sucrose were added in the LB broth or agar at the described concentrations [10]. Escherichia coli NovaBlue cells were grown in LB broth at 37 C. 4.2. Construction of plasmids and selection of M. sm-DM_6402 strain The genomic DNA of M. smegmatis mc2155 was prepared as previously described [17]. MSMEG_6402 with its upstream sequence (496 bp) was amplified from mc2155 genomic DNA using upstream primer 50 ACTAGTTGTTCTCGATCCTGGAGTCG 30 and downstream primer 50 TCATCTGTCTCCTTCGGCAC 30 and cloned into pMD18-T plasmid. After confirmation by DNA sequencing, MSMEG_6402 was disrupted by inserting the kanR cassette from pUC4K (GE Healthcare). The DNA fragment of MSMEG_6402-kanR was ligated to pPR27-xylE to generate a conditional replication plasmid pPR27- MSMEG_6402::kanR (pXYI).
T. Jiang et al. / Microbial Pathogenesis 51 (2011) 156e160
159
Fig. 4. Quantitative analysis of the Alaf and Galf constituents from cell wall AG. A, The detection of the Alaf and Galf content for wild type mc2155, M. sm-DM_6402 cell and mc2155 treated by EMB through HPLC;B, The ratio compare of the Alaf and Galf constituents, the values are the means of at least 3 independent experiments.
The Rv3807c was amplified from M. tuberculosis H37Rv genomic DNA (supplied by Colorado State University via an NIH contract) using upstream primer 50 ATTCATATGGTGGCCGTGCAGTCGGC 30 and downstream primer 50 ATTGGATCCTCATCTCTTCCGGGCCCTTTGC 30 and was cloned into pMD18-T. The positive recombinant plasmid was confirmed by sequencing and the Rv3807c was ligated to the NdeI and BamHI sites of pET23b-Phsp60. The DNA fragment containing
Phsp60-Rv3807c was cloned to the XbaI and BamHI sites of pCG76 to yield a rescue plasmid pCG76-Phsp60-Rv3807c (pXYII) [18]. M. smegmatis mc2155 electrocompetent cells were prepared as described [19]. The pXYI plasmid was electroporated to mc2155 competent cells with Electroporator 2510 (Eppendorf). Transformants were grown on LB agar plates containing kanamycin and gentamicin at 30 C. The S1 mutant (carrying both
160
T. Jiang et al. / Microbial Pathogenesis 51 (2011) 156e160
MSMEG_6402 and MSMEG_6402::kanR copies) grown at 42 C was selected by PCR. The rescue plasmid pXYII was electroporated into the S1 mutant. Transformants were grown on LB agar plates containing kanamycin and streptomycin at 30 C. The M. sm-DM_6402 mutant strain (MSMEG_6402 gene knock out strain) grown on LB agar plates containing 10% sucrose, kanamycin and streptomycin was selected by PCR and verified by DNA sequencing [20]. 4.3. Growth curve of M. sm-DM_6402 strain The growth of M. sm-DM_6402 and mc2155 strain was followed by monitoring the optical density (OD) at the absorption of 600 nm. The cells were inoculated to 5 ml of LB broth containing 0.05% Tween 80 at 30 C and 42 C respectively. The wild type mc2155 and mc2155 with rescue plasmid were used as controls, and the OD600 was detected at the interval of 24 h and the growth curves at both 30 C and 42 C were obtained. 4.4. Morphology of M. sm-DM_6402 strains by electron microscopy For scanning electron microscopy study, the cultures of M. sm-
DM_6402 mutant and wild type mc2155 in logarithmic phase
(OD600 z 0.4) were harvested by centrifugation at 5000 g for 5 min, and the cells were fixed with ice-cold 2.5% glutaraldehyde. The cells were washed with PBS and fixed in isoamyl acetate at 4 C overnight. After dehydration in gradient ethanol (20%w100%), the cells were critical point dried and applied to adhesive carbon films and coated with gold [21,22], and then examined with a JSM-6360LV scanning electron microscope (JEOL). For transmission electron microscopy study, the fixed cells in 2.5% glutaraldehyde were rinsed with 0.2 M phosphate salt buffer (pH ¼ 7.4), followed by dehydration with gradient alcohol. Cells were embedded with epon embedding kit and cut into ultrathin sections. The sections were stained with 2% uranyl acetate for 30 min and lead citrate for 20 min [9] and finally examined with a JEM-2000EX transmission electron microscope (JEOL). 4.5. Sugar composition of cell wall AG Wild type, M.sm-DM_6402 mutant, and 10 mg/ml EMB treated cells each in 500 ml culture were harvested in 5 ml deionized water and homogenized by sonication. Cell wall fractions were collected by centrifugation (10,000 g, 4 C and 20 min). To remove lipid component, the wall pellets were resuspended in 5 ml acetone, heated at 90 C for 1 h, and centrifuged (10,000 g, 4 C, 10 min). The pellets were treated with 10% SDS (w/v) at 90 C for 1 h and centrifuged as above. SDS treatment was conducted twice, and wall pellets were washed 3 times by deionized water. The lipid-free wall pellets were treated with 5 ml 1 M NaOH at 90 C overnight to cleave AG from peptideoglycan. Peptideoglycan was removed by centrifugation, and the AG supernatant was neutralized with addition of glacial acetic acid, dialyzed overnight, and lyophilized. AG sample was hydrolyzed with 2 M trifluoroacetic acid, at 120 C for 2 h and dried with Savant spin dryer. The hydrolyzed samples from wild type, M. sm-DM_6402 mutant, and 10 mg/ml EMB treated cells were injected onto a Dionex HPLC equipped with a CarboPac PA-1 anion-exchange chromatography column and PDA detector. The samples were eluted with 0.1 M NaOH isocratic gradient, and Araf and Galf was quantified based on the two sugar standard.
Acknowledgments This study is supported by the grants from National Natural Science Foundation of China (30970647) and Key Project of Major Infectious Diseases (2008ZX10003-006). References [1] Daffe M, Draper P. The envelope layers of mycobacteria with reference to their pathogenicity. Adv Microb Physiol 1998;39:131e203. [2] Scherman M, Weston A, Duncan K, Whittington A, Upton R, Deng L, et al. Biosynthetic origin of mycobacterial cell wall arabinosyl residues. J Bacteriol 1995;177:7125e30. [3] Brennan PJ. Structure, function, and biogenesis of the cell wall of Mycobacterium tuberculosis Tuberculosis. Edinb 2003;83:91e7. [4] Watanabe M, Kudoh S, Yamada Y, Iguchi K, Minnikin DE. A new glycolipid from Mycobacterium avium: Mycobacterium intracellulare complex. Biochim. Biophys Acta 1992;1165:53e60. [5] Wolucka BA, McNeil MR, de Hoffmann E, Chojnacki T, Brennan PJ. Recognition of the lipid intermediate for arabinogalactan ⁄ arabinomannan biosynthesis and its relation to the mode of action of ethambutol on mycobacteria. J Biol Chem 1994;269:23328e35. [6] Huang Hairong, Scherman Michael S, D’Haeze Wim, Vereecke Danny, Holsters Marcelle, Crick Dean C, et al. Identification and Active expression of the mycobacterium tuberculosis gene encoding 5-Phospho-D-ribose-1-diphosphate: decaprenyl-phosphate 5-Phosphoribosyltransferase, the first enzyme committed to Decaprenylphosphoryl-D-arabinose synthesis. J Biol Chem 2005; 280(26):24539e43. [7] Mikusova K, Huang H, Yagi T, Holsters M, Vereecke D, ’Haeze WD, et al. Decaprenylphosphoryl arabinofuranose, the donor of the D-arabinofuranosyl residues of mycobacterial arabinan, is formed via a two-step epimerization of decaprenylphosphoryl ribose. J Bacteriol 2005;187:8020e5. [8] .Wolucka BA. Biosynthesis of D-arabinose in mycobacteria - a novel bacterial pathway with implications for antimycobacterial therapy. FEBS J 2008;275: 2691e711. [9] Wang L, Slayden RA, Barry III CE, Liu J. Cell wall structure of a mutant of Mycobacterium smegmatis defective in the biosynthesis of mycolic acids. J Biol Chem 2000;275:7224e9. [10] Li Wei, Xin Yi, McNeil Michael R, Yufang Ma. rmlB and rmlC genes are essential for growth of mycobacteria. Biochem Biophysical Res Commun 2006;2006(342):170e8. [11] Zhang Wenli, Jones Victoria C, Scherman Michael S, Mahapatra Sebabrata, Crick Dean, Bhamidi Suresh, et al. Expression, essentiality, and a microtiter plate assay for mycobacterial GlmU, the bifunctional glucosamine-1-phosphate acetyltransferase and N-acetylglucosamine-1-phosphate uridyltransferase. Int J Biochem Cell Biol 2008;40(11):2560e71. [12] Alderwick LJ, Seidel M, Sahm H, Besra GS, Eggeling L. Identification of a novel arabinofuranosyltransferase(AftA) involved in cell wall arabinan biosynthesis in Mycobacterium tuberculosis. J Biol Chem 2006;281:15653e61. [13] Sliusarenko O, Cabeen MT, Wolgemuth CW, Jacobs-Wagner C, Emonet T. Processivity of peptidoglycan synthesis provides a built-in mechanism for the robustness of straight-rod cell morphology. Proc Natl Acad Sci U.S.A 2010; 107:10086e91. [14] Hett EC, Rubin EJ. Bacterial growth and cell division: a mycobacterial perspective. Microbiol Mol Biol Rev 2008;72:126e56. [15] Hiraga S, Niki H, Imamura R, Ogura T, Yamanaka K, .Feng J, et al. Mutants defective in chromosome partitioning in E. coli. Res Microbiol 1991;142:189e94. [16] Dong X, Bhamidi S, Scherman M, Xin Y, McNeil MR. Development of a quantitative assay for mycobacterial endogenous arabinase and ensuing studies of arabinase levels and arabinan metabolism in Mycobacterium smegmatis. Appl Environ Microbiol 2006;72:2601e5. [17] Jackson M, Crick DC, Brennan DCPJ. Phosphatidylinositol is an essential phospholipid of mycobacteria. J Biol Chem 2000;275:30092e9. [18] Guilhot C, Otal I, Van Rompaey I, Martin C, Gicquel B. Efficient transposition in mycobacteria: construction of Mycobacterium smegmatis insertional mutant libraries. J Bacteriol 1994;176:535e9. [19] Jackson Pelicic M, Reyrat JM, Jacobs Jr WR, Gicquel B, Guilhot C. Efficient allelic exchange and transposon mutagenesis in Mycobacterium tuberculosis. Proc Natl Acad Sci USA 1997;94:10955e60. [20] Pelicic V, Reyrat JM, Gicquel B. Generation of unmarked directed mutations in mycobacteria, using sucrose counter-selectable suicide vectors. Mol Microbiol 1996;20:919e25. [21] Bleck CK, Merz A, Gutierrez MG, Walther P, Dubochet J, Zuber B, et al. Comparison of different methods for thin section EM analysis of Mycobacterium smegmatis. J Microsc 2010;237:23e38. [22] Dahl JL. Scanning electron microscopy analysis of aged Mycobacterium tuberculosis cells. Can J Microbiol 2005;51:277e81.
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
The effect of MSMEG_6402 gene disruption on the cell wall structure of Mycobacterium smegmatis Tao Jiang a, Lianqi He b, Yaoyao Zhan c, Shizhu Zang a, Yufang Ma b, Xiaojiao Zhao b, Cuili Zhang a, Yi Xin a, * a
Department of Biotechnology, Dalian Medical University, Dalian 116044, China Department of Biochemistry and Molecular Biology, Dalian Medical University, Dalian 116044, China c Department of Biochemistry and Molecular Biology, Dalian Ocean University, Dalian 116023, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 15 September 2010 Received in revised form 11 April 2011 Accepted 20 April 2011 Available online 6 May 2011
Arabinogalactan (AG) of mycobacterial cell wall consists of arabinan region, galactan region and disaccharide linker. The arabinan is composed of D-arabinofuranose residues, and decaprenyphosphoryl-D-arabinose (DPA) is the donor of the D-arabinofuranose residues. DPA is formed from phosphoribose diphosphate (PRPP) in a four-step process catalyzed by transferase, phosphatase and epimerase, respectively. Mycobacterium tuberculosis Rv3806c has been identified as PRPP: decaprenylphosphate 5-phosphoribosyltransferase，and heteromeric Rv3790/Rv3791 has epimerase activity. Rv3807c is putative phospholipid phosphatase. However, there is no direct biochemical evidence since expression of Rv3807c has been unsuccessful. Mycobacterium smegmatis MSMEG_6402 is ortholog of Rv3807c. To investigate the function of MSMEG_6402 on AG biosynthesis, a conditional MSMEG_6402 gene knock out (M. sm-DM_6402) strain was constructed through homologous recombination technique. The morphological and compositional changes of cell wall were examined in the M. sm-DM_6402 strain. The M. sm-DM_6402 strain grew at non-permissive temperature slower than that at permissive temperature, indicating that MSMEG_6402 is non-essential for growth of M. smegmatis. The change of cell shape and detectable bulging on the cell surface of M. sm-DM_6402 strain were observed by scanning electron microscopy, and curled as well as deformed cell wall of M. sm-DM_6402 strain was revealed by transmission electron microscopy. Analysis of sugar composition in the cell wall by HPLC indicated that the ratio of arabinofuran to galactofuran in M. sm-DM_6402 strain was changed to 1.7:1 comparing with 2:1 in the wild type. It demonstrates that the lacking MSMEG_6402 interferes the biosynthesis of arabinan. Analyzing 50 P-DPR and DPR from both M. sm-DM_6402 strain and wild type M. smegmatis is undergoing in this lab. Ó 2011 Elsevier Ltd. All rights reserved.
Keywords: Mycobacterium smegmatis mc2155 MSMEG_6402 Cell wall structure Decaprenyphosphoryl-D-arabinose (DPA)
1. Introduction The cell wall of mycobacteria is essential for its viability. The core structures include a highly impermeable mycolic acid layer, a peptidoglycan layer, and an arabinogalactan (AG) polysaccharide layer [1]. AG polymers are composed of d-arabinofuran residues (Araf) and d-galactofuran residues (Galf), and the highly branched Araf chains are directly attached to the Galf backbone. Some investigations showed that decaprenyphosphoryl-D-arabinose (DPA) is the only Araf donor for AG biosynthesis [2,3]. DPA biosynthesis is involved in the AG synthetic pathway [2,4,5]. Decapreny phosphate (DP) is primarily transferred to phosphoribose diphosphate (PRPP) to form decaprenyphosphoryl-5* Corresponding author. Tel.: þ86 411 86110295. E-mail addresses: [email protected], [email protected] (Y. Xin). 0882-4010/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.micpath.2011.04.005
phosphoribose (DPPR) [6]. The 50 phosphate is removed to produce decaprenylphos-phoryl-ribose (DPR), which is further epimerized into DPA [7]. It is postulated that the removal of the 50 phosphate on the second step is conducted by putative Rv3807c phospholipid phosphatase [8]. In this study, the function of Rv3807c gene was investigated by gene mutation combined with phenotypical studies since the enzyme assay could not be conducted due to inavailability of DPPR substrate. Mycobacterial smegmatis mc2155, a fast-growing and nonpathogenic mycobacterium, was employed to study the function of Rv3807c gene in this investigation. Bioinformatics analysis demonstrated that ortholog of Rv3807c in Mycobacterium tuberculosis is MSMEG_6402 in M. smegmatis mc2155, and MSMEG_6402 showed 62% identity to Rv3807c. Gene knock out approach has been successfully used to determine functions of mycobacterial genes in many related studies [9e11], therefore a mutant strain of
T. Jiang et al. / Microbial Pathogenesis 51 (2011) 156e160
157
2.2. Growth curve of M. sm-DM_6402 strain
Fig. 1. PCR identification resulting for Sm-DM_6402 mutant selection. M, 250bp DNA ladder; WT, PCR product of genomic DNA from mc2155; Lane 1e6, six S1 mutant strains transformed by pXY2 plasmid; Lane 3e5, three M. sm-DM_6402 mutant strains with significant gene deletion showed 2.2 Kb DNA fragment due to kanR insertion.
M. smegmatis mc2155, M. sm-DM_6402 with MSMEG_6402 gene disruption was generated in this study. The altered physiological, morphological, and chemical compositional characteristics were examined to address the possible role of MSMEG_6402 in the biosynthesis of AG. 2. Results 2.1. Construction of M. sm-DM_6402 strain M. sm-DM_6402 strain (MSMEG_6402 gene knock out strain) where MSMEG_6402 was replaced by MSMEG_6402::kanR was generated by a two-step homologous recombination procedure [10]. The M. smegmatis mc2155 transformant carrying conditional replication plasmid pXYI was grown in LB broth containing kanamycin and gentamycin at 30 C, and spread on LB agar plate containing kanamycin and gentamycin at 42 C. The kanamycin resistant colonies on the plate have necessarily integrated MSMEG_6402::kanR into mc2155 genome at 42 C. Two S1 mutant strains where MSMEG_6402::kanR integrated into MSMEG_6402 locus were selected by PCR. One S1 mutant strain was transformed by rescue plasmid pXYII and the transformants were grown at LB agar plate containing sucrose, kanamycin and streptomycin and incubated at 30 C. M. sm-DM_6402 mutants where MSMEG_6402 was replaced by MSMEG_6402::kanR were selected by PCR. The 2.2 kb-PCR product including MSMEG_6402::kanR was amplified from three colonies, whereas the1.0 kb-PCR product containing only MSMEG_6402 was amplified from mc2155 (Fig. 1).The result indicated that MSMEG_6402 gene knock out mutant, M. sm-DM_6402 was constructed successfully.
To investigate the effect of MSMEG_6402 on the growth of M. smegmatis, the OD600 (the optical density at the absorption of 600 nm)of M. sm-DM_6402 strain at either 30 C or 42 C was measured at the interval of 24 h. Wild type M. smegmatis mc2155 was a control. The growth curve of M. sm-DM_6402 mutant showed that M. sm-DM_6402 could grow at 42 C but the growth rate at 42 C was slower than that at 30 C (Fig. 2). Since the rescue plasmid pXYII was unable to replicate at 42 C no more Rv3807c protein was produced to complement MSMEG_6402::kanR. Therefore, the results indicated that MSMEG_6402 is non-essential for the growth of M. smegmatis, but the disruption of MSMEG_6402 caused the reduced growth rate of M. smegmatis mc2155. 2.3. Morphological changes of M. sm-DM_6402 strain Based on the hypothesis that M_6402 gene was involved in DPA biosynthesis, defected cell wall might be detected after the gene was deleted. The changes of cell wall could be exhibited both on cell appearance and cell wall structure. The changes on cell appearance were detected through SEM on M. sm-DM_6402 strain. Deformation and bulge on the side of mutant cells were observed, and some cells were cracked around the bulges after the gene was defected at a non-permissive temperature. As a contrast, M. smegmatis cells showed regular long rod-shape (Fig. 3A). The cell wall structure of M. sm-DM_6402 strain was further examined by TEM. Cytoplasm of mutant appeared to be detached from the cell wall and possessed a discrepancy density compared to wild cells. Cell wall structure tended to be curled, and even tend to cause cellular autolysis. As a contrast, wild M. smegmatis cells wall showed regular patterns, instead the cells treated by EMB were damaged heavily (Fig. 3B). 2.4. Sugar composition changes of AG from mutant strain cell wall In previous reports, the ratio of Araf to Galf for wild type mycobacterial AG was 2:1, and Enthambuto (EMB) inhibited arabinosyl transferase reduced the ratio to 1:1 after 2 h EMB treatment. In this study, the ratios of Araf to Galf were respectively 2.1,1.7 and 1.1 for wild type mc2155, M. sm-DM_6402 strain and mc2155 cell treated by EMB (as shown in Fig. 4B). Content of Araf was reduced significantly for M. sm-DM_6402 strain. A similar ratio was measured from EMB-treatment cells as a positive control in this study. Purified AG from M. sm-DM_6402 mutant was analyzed for Araf content by HPLC. The ratio of Araf to Galf was reduced to 1.7:1 indicating inhibition of Araf chain biosynthesis possibly caused by M. sm-DM_6402 strain although the inhibition was not as strong as that by EMB (Fig. 4). 3. Discussion
Fig. 2. Growth curves of M. smegmatis mc2155 strain at 30 C and 42 C. Wild type mc2155 strain at 42 C（:）; Mc2155 containing pCG76-Tb Rv3807c at 42 C(C); Wild type mc2155 at 30 C(C); mc2155 containing pCG76-Tb Rv3807c at 30 C (,); M. sm-DM_6402 strain at 30 C( ,); M. sm-DM_6402 strain at 42 C(A).
DPA biosynthesis had gradually been elucidated as the functions of Rv3806c, Rv3790 and Rv3791 were reported in the past several years [6,7,12]. The formation of DPA is catalyzed presumably by three enzymes, Rv3806c phosphoribosyltransferase, phospholipids phosphatase and Rv3790/Rv3791 epimerase respectively, but the phospholipid phosphatase has yet not been identified in mycobacteria. Rv3807c, an unknown function protein, was predicted through bioinformatics analysis of protein domain to catalysis the dephosphorylation reaction [8]. However, we yet have little known about functional characteristic of Rv3807c. In this study, we constructed M. sm-DM_6402 mutant, a gene similar to Rv3807c in M. tuberculosis, and further determined the relationship between MSMEG_6402 and DPA biosynthesis.
158
T. Jiang et al. / Microbial Pathogenesis 51 (2011) 156e160
Fig. 3. Effects of M. sm-DM_6402 mutant on the appearance of M. smegmatis mc2155. (A) SEM analysis of M. sm-DM_6402 cell grown at 30 C (panel 1) and 42 C (panel 2) for logarithmic phase in LB broth, Bars ¼ 1 mm, (B) TEM analysis of cells grown of M. sm-DM_6402 strains and wild type mc2155 strains. Wild type mc2155 cells (panel 1), M. smDM_6402 cells (panels 2e3) were grown at 42 C for logarithmic phase, arrowheads indicate cell wall structure ruptured, M. smegmatis mc2155 treated by EMB (panel 4).
The changes on cell appearance and cell wall structure were detected after MSMEG_6402 was mutated, and utd and biosynthesis of arabinose for AG was found to be reduced. These results were important toward to finally determine the gene function of Rv3807c in M. tuberculosis. Under physiological conditions, cell wall of mycobacterium was thought to manifest rigid rod-shapes [13], and alterations of cell morphology were resulted largely from nutrient default, polar differentiation and cell wall biosynthesis disorder [14,15]. DPA is the only Araf donor in mycobacterium for AG biosynthesis, therefore DPA decrease can reduce directly AG biosynthesis, even destroy cell wall. EMB, an anti-tuberculosis drug, effects cell wall structure due to the inhibition of DPA biosynthesis [16]. Therefore, the mutation of MSMEG_6402 was likely to interfere with cell wall biosynthesis, especially to reduce biosynthesis of Araf for AG. It is postulated that MSMEG_6402 is directly or indirectly involved in DPA biosynthesis. AG composition analysis indicates that M. sm-DM_6402 strain contains a significantly low quantity of Araf residues. The fact that Araf was reduced but not totally absent demonstrated that role of MSMEG_6402 protein maybe is not the only way for DPA synthesis. Furthermore, there might be a complement system, and the further study is needed for revealing full metabolism pathways. In short, MSMEG_6402 gene deletion may affect the integrity of mycobacterial cell wall, reduce content of Araf residues for AG, and change growth characteristic. However, we were still struggling on
enzymatic evidence catalyzed by MSMEG_6402; further works are determination of its precise role. 4. Materials and methods 4.1. Bacterial strains and growth conditions M. smegmatis mc2155 strain (ATCC) was grown in LB broth containing 0.05% Tween 80 at designated temperatures either at 30 C or 42 C. Antibiotics and sucrose were added in the LB broth or agar at the described concentrations [10]. Escherichia coli NovaBlue cells were grown in LB broth at 37 C. 4.2. Construction of plasmids and selection of M. sm-DM_6402 strain The genomic DNA of M. smegmatis mc2155 was prepared as previously described [17]. MSMEG_6402 with its upstream sequence (496 bp) was amplified from mc2155 genomic DNA using upstream primer 50 ACTAGTTGTTCTCGATCCTGGAGTCG 30 and downstream primer 50 TCATCTGTCTCCTTCGGCAC 30 and cloned into pMD18-T plasmid. After confirmation by DNA sequencing, MSMEG_6402 was disrupted by inserting the kanR cassette from pUC4K (GE Healthcare). The DNA fragment of MSMEG_6402-kanR was ligated to pPR27-xylE to generate a conditional replication plasmid pPR27- MSMEG_6402::kanR (pXYI).
T. Jiang et al. / Microbial Pathogenesis 51 (2011) 156e160
159
Fig. 4. Quantitative analysis of the Alaf and Galf constituents from cell wall AG. A, The detection of the Alaf and Galf content for wild type mc2155, M. sm-DM_6402 cell and mc2155 treated by EMB through HPLC;B, The ratio compare of the Alaf and Galf constituents, the values are the means of at least 3 independent experiments.
The Rv3807c was amplified from M. tuberculosis H37Rv genomic DNA (supplied by Colorado State University via an NIH contract) using upstream primer 50 ATTCATATGGTGGCCGTGCAGTCGGC 30 and downstream primer 50 ATTGGATCCTCATCTCTTCCGGGCCCTTTGC 30 and was cloned into pMD18-T. The positive recombinant plasmid was confirmed by sequencing and the Rv3807c was ligated to the NdeI and BamHI sites of pET23b-Phsp60. The DNA fragment containing
Phsp60-Rv3807c was cloned to the XbaI and BamHI sites of pCG76 to yield a rescue plasmid pCG76-Phsp60-Rv3807c (pXYII) [18]. M. smegmatis mc2155 electrocompetent cells were prepared as described [19]. The pXYI plasmid was electroporated to mc2155 competent cells with Electroporator 2510 (Eppendorf). Transformants were grown on LB agar plates containing kanamycin and gentamicin at 30 C. The S1 mutant (carrying both
160
T. Jiang et al. / Microbial Pathogenesis 51 (2011) 156e160
MSMEG_6402 and MSMEG_6402::kanR copies) grown at 42 C was selected by PCR. The rescue plasmid pXYII was electroporated into the S1 mutant. Transformants were grown on LB agar plates containing kanamycin and streptomycin at 30 C. The M. sm-DM_6402 mutant strain (MSMEG_6402 gene knock out strain) grown on LB agar plates containing 10% sucrose, kanamycin and streptomycin was selected by PCR and verified by DNA sequencing [20]. 4.3. Growth curve of M. sm-DM_6402 strain The growth of M. sm-DM_6402 and mc2155 strain was followed by monitoring the optical density (OD) at the absorption of 600 nm. The cells were inoculated to 5 ml of LB broth containing 0.05% Tween 80 at 30 C and 42 C respectively. The wild type mc2155 and mc2155 with rescue plasmid were used as controls, and the OD600 was detected at the interval of 24 h and the growth curves at both 30 C and 42 C were obtained. 4.4. Morphology of M. sm-DM_6402 strains by electron microscopy For scanning electron microscopy study, the cultures of M. sm-
DM_6402 mutant and wild type mc2155 in logarithmic phase
(OD600 z 0.4) were harvested by centrifugation at 5000 g for 5 min, and the cells were fixed with ice-cold 2.5% glutaraldehyde. The cells were washed with PBS and fixed in isoamyl acetate at 4 C overnight. After dehydration in gradient ethanol (20%w100%), the cells were critical point dried and applied to adhesive carbon films and coated with gold [21,22], and then examined with a JSM-6360LV scanning electron microscope (JEOL). For transmission electron microscopy study, the fixed cells in 2.5% glutaraldehyde were rinsed with 0.2 M phosphate salt buffer (pH ¼ 7.4), followed by dehydration with gradient alcohol. Cells were embedded with epon embedding kit and cut into ultrathin sections. The sections were stained with 2% uranyl acetate for 30 min and lead citrate for 20 min [9] and finally examined with a JEM-2000EX transmission electron microscope (JEOL). 4.5. Sugar composition of cell wall AG Wild type, M.sm-DM_6402 mutant, and 10 mg/ml EMB treated cells each in 500 ml culture were harvested in 5 ml deionized water and homogenized by sonication. Cell wall fractions were collected by centrifugation (10,000 g, 4 C and 20 min). To remove lipid component, the wall pellets were resuspended in 5 ml acetone, heated at 90 C for 1 h, and centrifuged (10,000 g, 4 C, 10 min). The pellets were treated with 10% SDS (w/v) at 90 C for 1 h and centrifuged as above. SDS treatment was conducted twice, and wall pellets were washed 3 times by deionized water. The lipid-free wall pellets were treated with 5 ml 1 M NaOH at 90 C overnight to cleave AG from peptideoglycan. Peptideoglycan was removed by centrifugation, and the AG supernatant was neutralized with addition of glacial acetic acid, dialyzed overnight, and lyophilized. AG sample was hydrolyzed with 2 M trifluoroacetic acid, at 120 C for 2 h and dried with Savant spin dryer. The hydrolyzed samples from wild type, M. sm-DM_6402 mutant, and 10 mg/ml EMB treated cells were injected onto a Dionex HPLC equipped with a CarboPac PA-1 anion-exchange chromatography column and PDA detector. The samples were eluted with 0.1 M NaOH isocratic gradient, and Araf and Galf was quantified based on the two sugar standard.
Acknowledgments This study is supported by the grants from National Natural Science Foundation of China (30970647) and Key Project of Major Infectious Diseases (2008ZX10003-006). References [1] Daffe M, Draper P. The envelope layers of mycobacteria with reference to their pathogenicity. Adv Microb Physiol 1998;39:131e203. [2] Scherman M, Weston A, Duncan K, Whittington A, Upton R, Deng L, et al. Biosynthetic origin of mycobacterial cell wall arabinosyl residues. J Bacteriol 1995;177:7125e30. [3] Brennan PJ. Structure, function, and biogenesis of the cell wall of Mycobacterium tuberculosis Tuberculosis. Edinb 2003;83:91e7. [4] Watanabe M, Kudoh S, Yamada Y, Iguchi K, Minnikin DE. A new glycolipid from Mycobacterium avium: Mycobacterium intracellulare complex. Biochim. Biophys Acta 1992;1165:53e60. [5] Wolucka BA, McNeil MR, de Hoffmann E, Chojnacki T, Brennan PJ. Recognition of the lipid intermediate for arabinogalactan ⁄ arabinomannan biosynthesis and its relation to the mode of action of ethambutol on mycobacteria. J Biol Chem 1994;269:23328e35. [6] Huang Hairong, Scherman Michael S, D’Haeze Wim, Vereecke Danny, Holsters Marcelle, Crick Dean C, et al. Identification and Active expression of the mycobacterium tuberculosis gene encoding 5-Phospho-D-ribose-1-diphosphate: decaprenyl-phosphate 5-Phosphoribosyltransferase, the first enzyme committed to Decaprenylphosphoryl-D-arabinose synthesis. J Biol Chem 2005; 280(26):24539e43. [7] Mikusova K, Huang H, Yagi T, Holsters M, Vereecke D, ’Haeze WD, et al. Decaprenylphosphoryl arabinofuranose, the donor of the D-arabinofuranosyl residues of mycobacterial arabinan, is formed via a two-step epimerization of decaprenylphosphoryl ribose. J Bacteriol 2005;187:8020e5. [8] .Wolucka BA. Biosynthesis of D-arabinose in mycobacteria - a novel bacterial pathway with implications for antimycobacterial therapy. FEBS J 2008;275: 2691e711. [9] Wang L, Slayden RA, Barry III CE, Liu J. Cell wall structure of a mutant of Mycobacterium smegmatis defective in the biosynthesis of mycolic acids. J Biol Chem 2000;275:7224e9. [10] Li Wei, Xin Yi, McNeil Michael R, Yufang Ma. rmlB and rmlC genes are essential for growth of mycobacteria. Biochem Biophysical Res Commun 2006;2006(342):170e8. [11] Zhang Wenli, Jones Victoria C, Scherman Michael S, Mahapatra Sebabrata, Crick Dean, Bhamidi Suresh, et al. Expression, essentiality, and a microtiter plate assay for mycobacterial GlmU, the bifunctional glucosamine-1-phosphate acetyltransferase and N-acetylglucosamine-1-phosphate uridyltransferase. Int J Biochem Cell Biol 2008;40(11):2560e71. [12] Alderwick LJ, Seidel M, Sahm H, Besra GS, Eggeling L. Identification of a novel arabinofuranosyltransferase(AftA) involved in cell wall arabinan biosynthesis in Mycobacterium tuberculosis. J Biol Chem 2006;281:15653e61. [13] Sliusarenko O, Cabeen MT, Wolgemuth CW, Jacobs-Wagner C, Emonet T. Processivity of peptidoglycan synthesis provides a built-in mechanism for the robustness of straight-rod cell morphology. Proc Natl Acad Sci U.S.A 2010; 107:10086e91. [14] Hett EC, Rubin EJ. Bacterial growth and cell division: a mycobacterial perspective. Microbiol Mol Biol Rev 2008;72:126e56. [15] Hiraga S, Niki H, Imamura R, Ogura T, Yamanaka K, .Feng J, et al. Mutants defective in chromosome partitioning in E. coli. Res Microbiol 1991;142:189e94. [16] Dong X, Bhamidi S, Scherman M, Xin Y, McNeil MR. Development of a quantitative assay for mycobacterial endogenous arabinase and ensuing studies of arabinase levels and arabinan metabolism in Mycobacterium smegmatis. Appl Environ Microbiol 2006;72:2601e5. [17] Jackson M, Crick DC, Brennan DCPJ. Phosphatidylinositol is an essential phospholipid of mycobacteria. J Biol Chem 2000;275:30092e9. [18] Guilhot C, Otal I, Van Rompaey I, Martin C, Gicquel B. Efficient transposition in mycobacteria: construction of Mycobacterium smegmatis insertional mutant libraries. J Bacteriol 1994;176:535e9. [19] Jackson Pelicic M, Reyrat JM, Jacobs Jr WR, Gicquel B, Guilhot C. Efficient allelic exchange and transposon mutagenesis in Mycobacterium tuberculosis. Proc Natl Acad Sci USA 1997;94:10955e60. [20] Pelicic V, Reyrat JM, Gicquel B. Generation of unmarked directed mutations in mycobacteria, using sucrose counter-selectable suicide vectors. Mol Microbiol 1996;20:919e25. [21] Bleck CK, Merz A, Gutierrez MG, Walther P, Dubochet J, Zuber B, et al. Comparison of different methods for thin section EM analysis of Mycobacterium smegmatis. J Microsc 2010;237:23e38. [22] Dahl JL. Scanning electron microscopy analysis of aged Mycobacterium tuberculosis cells. Can J Microbiol 2005;51:277e81.